Search NASA⌕ Search

Engineering topics

Ahkami, Amir H.

Publications and source records attributed to Ahkami, Amir H..

17 records
All sourcesNASA NTRSDOE OSTI
DOE OSTI2024

Salinity-Induced Photorespiration in Populus Vascular Tissues Facilitate Nitrogen Reallocation

Adaptation to abiotic stress is critical for the survival of perennial tree species. Salinity affects plant growth and productivity by interfering with major biosynthetic processes. Detrimental effects of salinity may vary between different plant tissues and cell types. However, spatial molecular mechanisms controlling plant responses to salinity stress are not yet thoroughly understood in perennial trees. Here, we used laser capture microdissection in clones of Populus tremula x alba to isolate palisade and vascular cells of intermediary leaf from plants exposed to 150 mM NaCl for 10 days, followed by a recovery period. Cell-specific changes in proteins and metabolites were determined. Salinity induced a vascular-specific accumulation of proteins associated with photorespiration, and the accumulation of serine, 3-phosphoglycerate and NH 4 + suggesting changes in N metabolism. Accumulation of the GLUTAMINE SYNTHETASE 2 protein, and increased GS1.1 gene expression, indicated that NH 4 + produced in photorespiration was assimilated to glutamine, the main amino acid translocated in Populus trees. Further analysis of total soluble proteins in stems and roots showed the accumulation of bark storage proteins induced by the salinity treatments. Collectively, our results suggest that the salt-induced photorespiration in vascular cells mediates N-reallocation in Populus, an essential process for the adaptation of trees to adverse conditions.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

RhizoMAP: a comprehensive, nondestructive, and sensitive platform for metabolic imaging of the rhizosphere

Elucidating the intricate structural organization and spatial gradients of biomolecular composition within the rhizosphere is critical to understanding important biogeochemical processes, which include the mechanisms of root-microbe interactions for maintaining sustainable plant ecosystem services. While various analytical methods have been developed to assess the spatial heterogeneity within the rhizosphere, a comprehensive view of the fine distribution of metabolites within the root-soil interface has remained a significant challenge. This is primarily due to the difficulty of maintaining the original spatial organization during sample preparation without compromising its molecular content.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Editorial: Cellular heterogeneity in plants

Multicellular eukaryotic organisms, such as plants, consist of various cell types. Despite possessing the same genetic information, each cell exhibits distinct utilization of this information, resulting in the development of unique molecular, physiological, and morphological properties as well as cellular heterogeneity within the organism. This cellular heterogeneity is needed to support plant development and adaptation to environmental changes. Identifying the mechanisms responsible for the differentiation of distinct cell types and precisely characterizing the molecular, biochemical, biophysical, and morphological characteristics of each cell type in various plant species remains a significant objective for plant scientists. Despite the biological importance of these cellular attributes, they have not been adequately described. In this Frontiers Research Topic, “Cellular Heterogeneity in Plants,” various scientific papers provide valuable new insights into the causes and consequences of cellular heterogeneity in plants.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Spatiotemporal metabolic responses to water deficit stress in distinct leaf cell-types of poplar

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue ‘omics’-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar ( Populus tremula× P. alba ) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach (Final Report)

SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach In the SyPro Poplar project, we aimed to integrate omics, bioinformatics, synthetic biology, and genetic engineering approaches to develop transgenic poplar trees with sustained photosynthetic activity and increased biomass production under individual and the simultaneous occurrence of water deficit, increased soil salinity, and elevated temperatures. Specifically, we intended to (i) study the functions of selected stress-responsive genes at tissue and cell type-specific levels, (ii) discover novel motifs and construct stress-responsive synthetic promoters, and (iii) use these promoters to drive the expression of genes shown to confer abiotic stress tolerance in a variety of crops and develop abiotic stress-tolerant poplars in a coordinated fashion.

09 BIOMASS FUELS↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Dynamic nitrogen fixation in an aerobic endophyte of Populus

Biological nitrogen fixation by microbial diazotrophs can contribute significantly to nitrogen availability in non-nodulating plant species. In this study of molecular mechanisms and gene expression relating to biological nitrogen fixation, the aerobic nitrogen-fixing endophyte Burkholderia vietnamiensis, strain WPB, isolated from Populus trichocarpa served as a model for endophyte–poplar interactions. Nitrogen-fixing activity was observed to be dynamic on nitrogen-free medium with a subset of colonies growing to form robust, raised globular like structures. Secondary ion mass spectrometry (NanoSIMS) confirmed that N-fixation was uneven within the population. A fluorescent transcriptional reporter (GFP) revealed that the nitrogenase subunit nifH is not uniformly expressed across genetically identical colonies of WPB and that only ~11% of the population was actively expressing the nifH gene. Higher nifH gene expression was observed in clustered cells through monitoring individual bacterial cells using single-molecule fluorescence in situ hybridization. Through 15 N 2 enrichment, we identified key nitrogenous metabolites and proteins synthesized by WPB and employed targeted metabolomics in active and inactive populations. We cocultivated WPB Pnif-GFP with poplar within a RhizoChip, a synthetic soil habitat, which enabled direct imaging of microbial nifH expression within root epidermal cells. We observed that nifH expression is localized to the root elongation zone where the strain forms a unique physical interaction with the root cells. This work employed comprehensive experimentation to identify novel mechanisms regulating both biological nitrogen fixation and beneficial plant–endophyte interactions.

15 N-tracking metabolomics↗
DOE OSTI2023

Expanded Coverage of Phytocompounds by Mass Spectrometry Imaging Using On-Tissue Chemical Derivatization by 4-APEBA

Probing the entirety of any species metabolome is an analytical grand challenge, especially at a cellular scale. Where spatial metabolomics, completed primarily by matrix-assisted laser desorption/ionization (MALDI), has limited molecular coverage for several reasons. To expand the scope of spatial metabolomics, we developed an on-tissue chemical derivatization (OTCD) workflow using 4-APEBA for confident identification of several dozen elusive phytocompounds, including several phytohormones, which have various roles within stress responses and cellular communication. Superiority of 4-APEBA is established in comparison to other derivatization agents with (1) broad specificity towards carbonyls, (2) low background, and (3) introduction of bromine isotopes, where the latter two facilitate confident bioinformatics. In conclusion, the outlined workflow trailblazes a path towards spatial hormonomics within plant samples, enhancing detection of carboxylates, aldehydes, ketones, and plausibly phenols.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2023

Synthetic Promoter Screening Using Poplar Mesophyll Protoplast Transformation

Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

The incongruity of validating quantitative proteomics using western blots

Similar to the age-old reviewer request for quantitative PCR validation of RNA sequencing data, nearly every researcher using proteomics technologies has, at one time or another, been asked by a reviewer to provide “western blot validation” of their mass spectrometry-based protein abundance data. We believe this request demonstrates a lack of awareness amongst the plant biology community about the extraordinary improvements in cost, sensitivity and reliability the field of mass spectrometry-based proteomics has made in recent years. Here, in this study, as a group of experts in different domains of quantitative plant proteomics, we explain why “western blot validation” of quantitative proteomics data is both unnecessary and invalid. Furthermore, we invite our colleagues in the plant science community to update their perception of quantitative mass spectrometry as a sensitive and reliable method of protein identification and quantitation.

Mehta, Devang↗
DOE OSTI2022

Performance of abiotic stress-inducible synthetic promoters in genetically engineered hybrid poplar (Populus tremula × Populus alba)

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six s ynthetic d rought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis -regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Plant synthetic biology innovations for biofuels and bioproducts

Plant-based biosynthesis of fuels, chemicals, and materials promotes environmental sustainability, which includes decreases in greenhouse gas emissions, water pollution, and loss of biodiversity. Advances in plant synthetic biology (synbio) should improve precision and efficacy of genetic engineering for sustainability. Applicable synbio innovations include genome editing, gene circuit design, synthetic promoter development, gene stacking technologies, and the design of environmental sensors. Moreover, recent advancements in developing spatially resolved and single-cell omics contribute to the discovery and characterization of cell-type-specific mechanisms and spatiotemporal gene regulations in distinct plant tissues for the expression of cell- and tissue-specific genes, resulting in improved bioproduction. In conclusion, this review highlights recent plant synbio progress and new single-cell molecular profiling towards sustainable biofuel and biomaterial production.

Yang, Yongil↗
DOE OSTI2021

Cell-Type-Specific Proteomics Analysis of a Small Number of Plant Cells by Integrating Laser Capture Microdissection with a Nanodroplet Sample Processing Platform

Plant organs and tissues contain multiple cell types, which are well organized in 3-dimensional structure to efficiently perform physiological functions such as homeostasis, response to environmental perturbation, pathogen infection. It is critically important to perform molecular measurements at the cell-type-specific level to discover mechanisms and unique features of cell populations that govern differentiation and respond to external perturbations. Although mass spectrometry-based proteomics has been demonstrated as an enabling discovery tool to study plant physiology, conventional approaches require millions of cells to generate robust biological conclusions. Such requirements mask the cell-to-cell heterogeneities and limit the comprehensive profiling of plant proteins at spatially resolved and cell-type-specific resolutions. This protocol describes a recently-developed proteomics workflow for studying a small number of plant cells by integrating laser capture microdissection, microfluidic nanodroplet-based sample preparation, with ultrasensitive liquid chromatography-mass spectrometry. Using poplar as a model tree species, we provide detailed protocols, including plant tissue harvest, tissue preparation, cryosectioning, laser microdissection, protein digestion, mass spectrometry measurement, and data analysis. We show the workflow enables the precise identification and quantification of thousands of proteins from hundreds of isolated plant root and leaf cells.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

09 BIOMASS FUELS↗
DOE OSTI2020

Dynamics of Global Gene Expression and Regulatory Elements in Growing Brachypodium Root System

Root systems are dynamic and adaptable organs that play critical roles in plant development. However, how roots grow and accumulate biomass during plant life cycle and in relation to shoot growth phenology remains understudied. A comprehensive time-dependent root morphological analysis integrated with molecular signatures is then required to advance our understanding of root growth and development. Here we studied Brachypodium distachyon rooting process by monitoring root morphology, biomass production, and C/N ratios during developmental stages. To provide insight into gene regulation that accompanies root growth, we generated comprehensive transcript profiles of Brachypodium whole-root system at four developmental stages. Our data analysis revealed that multiple biological processes including trehalose metabolism and various families of transcription factors (TFs) were differentially expressed in root system during plant development. In particular, the AUX/IAA, ERFs, WRKY, NAC, and MADS TF family members were upregulated as plant entered the booting/heading stage, while ARFs and GRFs were downregulated suggesting these TF families as important factors involved in specific phases of rooting, and possibly in regulation of transition to plant reproductive stages. We identified several Brachypodium candidate root biomass-promoting genes and cis -regulatory elements for further functional validations and root growth improvements in grasses.

59 BASIC BIOLOGICAL SCIENCES↗