Engineering topics

Blumwald, Eduardo

Publications and source records attributed to Blumwald, Eduardo.

12 records

DOE OSTI2024

Salinity-Induced Photorespiration in Populus Vascular Tissues Facilitate Nitrogen Reallocation

Adaptation to abiotic stress is critical for the survival of perennial tree species. Salinity affects plant growth and productivity by interfering with major biosynthetic processes. Detrimental effects of salinity may vary between different plant tissues and cell types. However, spatial molecular mechanisms controlling plant responses to salinity stress are not yet thoroughly understood in perennial trees. Here, we used laser capture microdissection in clones of Populus tremula x alba to isolate palisade and vascular cells of intermediary leaf from plants exposed to 150 mM NaCl for 10 days, followed by a recovery period. Cell-specific changes in proteins and metabolites were determined. Salinity induced a vascular-specific accumulation of proteins associated with photorespiration, and the accumulation of serine, 3-phosphoglycerate and NH 4 + suggesting changes in N metabolism. Accumulation of the GLUTAMINE SYNTHETASE 2 protein, and increased GS1.1 gene expression, indicated that NH 4 + produced in photorespiration was assimilated to glutamine, the main amino acid translocated in Populus trees. Further analysis of total soluble proteins in stems and roots showed the accumulation of bark storage proteins induced by the salinity treatments. Collectively, our results suggest that the salt-induced photorespiration in vascular cells mediates N-reallocation in Populus, an essential process for the adaptation of trees to adverse conditions.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2024

Spatiotemporal metabolic responses to water deficit stress in distinct leaf cell-types of poplar

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue ‘omics’-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar ( Populus tremula× P. alba ) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2024

SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach (Final Report)

SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach In the SyPro Poplar project, we aimed to integrate omics, bioinformatics, synthetic biology, and genetic engineering approaches to develop transgenic poplar trees with sustained photosynthetic activity and increased biomass production under individual and the simultaneous occurrence of water deficit, increased soil salinity, and elevated temperatures. Specifically, we intended to (i) study the functions of selected stress-responsive genes at tissue and cell type-specific levels, (ii) discover novel motifs and construct stress-responsive synthetic promoters, and (iii) use these promoters to drive the expression of genes shown to confer abiotic stress tolerance in a variety of crops and develop abiotic stress-tolerant poplars in a coordinated fashion.

09 BIOMASS FUELS↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2023

Synthetic Promoter Screening Using Poplar Mesophyll Protoplast Transformation

Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2022

Performance of abiotic stress-inducible synthetic promoters in genetically engineered hybrid poplar (Populus tremula × Populus alba)

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six s ynthetic d rought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis -regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2022

Plant synthetic biology innovations for biofuels and bioproducts

Plant-based biosynthesis of fuels, chemicals, and materials promotes environmental sustainability, which includes decreases in greenhouse gas emissions, water pollution, and loss of biodiversity. Advances in plant synthetic biology (synbio) should improve precision and efficacy of genetic engineering for sustainability. Applicable synbio innovations include genome editing, gene circuit design, synthetic promoter development, gene stacking technologies, and the design of environmental sensors. Moreover, recent advancements in developing spatially resolved and single-cell omics contribute to the discovery and characterization of cell-type-specific mechanisms and spatiotemporal gene regulations in distinct plant tissues for the expression of cell- and tissue-specific genes, resulting in improved bioproduction. In conclusion, this review highlights recent plant synbio progress and new single-cell molecular profiling towards sustainable biofuel and biomaterial production.

Yang, Yongil↗

DOE OSTI2022

Haploidy and aneuploidy in switchgrass mediated by misexpression of CENH3

Cross bred species such as switchgrass may benefit from advantageous breeding strategies requiring inbred lines. Doubled haploid production methods offer several ways that these lines can be produced that often involve uniparental genome elimination as the rate limiting step. We have used a centromere-mediated genome elimination strategy in which modified CENH3 is expressed to induce the process. Transgenic tetraploid switchgrass lines coexpressed Cas9, a poly-cistronic tRNA-gRNA tandem array containing eight guide RNAs that target two CENH3 genes, and different chimeric versions of CENH3 with alterations to the N-terminal tail region. Genotyping of CENH3 genes in transgenics identified edits including frameshift mutations and deletions in one or both copies of the two CENH3 genes. Flow cytometry of T 1 seedlings identified two T 0 lines that produced five haploid individuals representing an induction rate of 0.5% and 1.4%. Eight different T0 lines produced aneuploids at rates ranging from 2.1 to 14.6%. A sample of aneuploid lines were sequenced at low coverage and aligned to the reference genome, revealing missing chromosomes and chromosome arms.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2021

Cell-Type-Specific Proteomics Analysis of a Small Number of Plant Cells by Integrating Laser Capture Microdissection with a Nanodroplet Sample Processing Platform

Plant organs and tissues contain multiple cell types, which are well organized in 3-dimensional structure to efficiently perform physiological functions such as homeostasis, response to environmental perturbation, pathogen infection. It is critically important to perform molecular measurements at the cell-type-specific level to discover mechanisms and unique features of cell populations that govern differentiation and respond to external perturbations. Although mass spectrometry-based proteomics has been demonstrated as an enabling discovery tool to study plant physiology, conventional approaches require millions of cells to generate robust biological conclusions. Such requirements mask the cell-to-cell heterogeneities and limit the comprehensive profiling of plant proteins at spatially resolved and cell-type-specific resolutions. This protocol describes a recently-developed proteomics workflow for studying a small number of plant cells by integrating laser capture microdissection, microfluidic nanodroplet-based sample preparation, with ultrasensitive liquid chromatography-mass spectrometry. Using poplar as a model tree species, we provide detailed protocols, including plant tissue harvest, tissue preparation, cryosectioning, laser microdissection, protein digestion, mass spectrometry measurement, and data analysis. We show the workflow enables the precise identification and quantification of thousands of proteins from hundreds of isolated plant root and leaf cells.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2021

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

09 BIOMASS FUELS↗

DOE OSTI2020

A Cytoplasmic Receptor-like Kinase Contributes to Salinity Tolerance

Receptor-like cytoplasmic kinases (RLCKs) are receptor kinases that lack extracellular ligand-binding domains and have emerged as a major class of signaling proteins that regulate plant cellular activities in response to biotic/abiotic stresses and endogenous extracellular signaling molecules. We have identified a rice RLCK (OsRLCK311) that was significantly higher in transgenic pSARK-IPT rice (Oryza sativa) that exhibited enhanced growth under saline conditions. Overexpression of OsRLCK311 full-length protein (RLCK311FL) and the C-terminus of OsRLCK311 (ΔN) in Arabidopsis confirmed its role in salinity tolerance, both in seedlings and mature plants. Protein interaction assays indicated that OsRLCK311 and ΔN interacted in-vivo with the plasma membrane AQP AtPIP2;1. The RLCK311-PIP2;1 binding led to alterations in the stomata response to ABA, which was characterized by more open stomata of transgenic plants. Moreover, OsRLCK311-ΔN effect in mediating enhanced plant growth under saline conditions was also observed in the perennial grass Brachypodium sylvaticum, confirming its role in both dicots and monocots species. Lastly, OsRLCK311 interacted with the rice OsPIP2;1. We suggest that the rice OsRLCK311 play a role in regulating the plant growth response under saline conditions via the regulation of the stomata response to stress. This role seems to be independent of the RLCK311 kinase activity, since the overexpression of the RLCK311 C-terminus (ΔN), which lacks the kinase full domain, has a similar phenotype to RLCK311FL.

54 ENVIRONMENTAL SCIENCES↗

DOE OSTI2020

Correlation-based network analysis combined with machine learning techniques highlight the role of the GABA shunt in Brachypodium sylvaticum freezing tolerance

Perennial grasses will account for approximately 16 billion gallons of renewable fuels by the year 2022, contributing significantly to carbon and nitrogen sequestration. However, perennial grasses productivity can be limited by severe freezing conditions in some geographical areas, although these risks could decrease with the advance of climate warming, the possibility of unpredictable early cold events cannot be discarded. We conducted a study on the model perennial grass Brachypodium sylvaticum to investigate the molecular mechanisms that contribute to cold and freezing adaption. The study was performed on two different B. sylvaticum accessions, Ain1 and Osl1, typical to warm and cold climates, respectively. Both accessions were grown under controlled conditions with subsequent cold acclimation followed by freezing stress. For each treatment a set of morphological parameters, transcription, metabolite, and lipid profiles were measured. State-of-the-art algorithms were employed to analyze cross-component relationships. Phenotypic analysis revealed higher adaption of Osl1 to freezing stress. Our analysis highlighted the differential regulation of the TCA cycle and the GABA shunt between Ain1 and Osl1. Osl1 adapted to freezing stress by repressing the GABA shunt activity, avoiding the detrimental reduction in fatty acid biosynthesis and the concomitant detrimental effects on membrane integrity.

54 ENVIRONMENTAL SCIENCES↗