Search NASA⌕ Search

SEARCH · Search NASA

Results for “DNA construct”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 181 records · Page 10
All sourcesNASA NTRSDOE OSTI
DOE OSTI2025

Complete replacement of Arabidopsis oil-producing enzymes with heterologous diacylglycerol acyltransferases

Acyl-CoA:diacylglycerol acyltransferase 1 (DGAT1) and phospholipid:diacylglycerol acyltransferase 1 (PDAT1) share responsibility for triacylglycerol (TAG) biosynthesis, and their selectivities control TAG fatty acid (FA) compositions. For rational metabolic engineering of seed oils, replacing endogenous TAG biosynthesis with exogenous enzymes containing different substrate FA selectivities is desirable; however, the dgat1-1/pdat1-2 double mutant is pollen lethal. Here, we evaluated the ability of 3 DGAT1s, from phylogenetically diverse plants with distinct TAG assembly processes, to completely replace endogenous TAG biosynthesis in Arabidopsis ( Arabidopsis thaliana ). We transformed dgat1-1 mutant plants with expression constructs for DGAT1 s from Camelina sativa , Physaria fendleri , and castor ( Ricinus communis ). Transgene expression was properly “contextualized” by using a previously determined minimum necessary expression unit containing the promoter/5′ UTR and first intron of native AtDGAT1 ; both of these DNA elements are essential for pollen expression. Next, we crossed homozygous lines with a DGAT1/DGAT1/PDAT1/pdat1-2 parent. C. sativa and P. fendleri DGAT1s restored the FA compositions and transcriptional differences of dgat1-1 to near wild-type and rescued the dgat1-1/pdat1-2 pollen lethality. R. communis DGAT1 was active in dgat1-1 seeds but produced unique oil profiles and alterations in the expression of lipid metabolic genes; it also failed to rescue dgat1-1/pdat1-2 lethality. This study confirms that the promoter and first intron of AtDGAT1 can modulate the expression of foreign DGAT1 genes to fit the correct spatiotemporal profile necessary for completely replacing endogenous TAG biosynthesis. Furthermore, it demonstrates an additional layer of unexpected enzyme incompatibility between oilseed lineages, which may complicate bioengineering approaches that seek to replace essential genes with orthologs.

McGuire, Sean T. [Washington State Univ., Pullman,↗
DOE OSTI2021

A Systems Biology Approach to Identify Essential Epigenetic Regulators for Specific Biological Processes in Plants

Upon sensing developmental or environmental cues, epigenetic regulators transform the chromatin landscape of a network of genes to modulate their expression and dictate adequate cellular and organismal responses. Knowledge of the specific biological processes and genomic loci controlled by each epigenetic regulator will greatly advance our understanding of epigenetic regulation in plants. To facilitate hypothesis generation and testing in this domain, we present EpiNet, an extensive gene regulatory network (GRN) featuring epigenetic regulators. EpiNet was enabled by (i) curated knowledge of epigenetic regulators involved in DNA methylation, histone modification, chromatin remodeling, and siRNA pathways; and (ii) a machine-learning network inference approach powered by a wealth of public transcriptome datasets. We applied GENIE3, a machine-learning network inference approach, to mine public Arabidopsis transcriptomes and construct tissue-specific GRNs with both epigenetic regulators and transcription factors as predictors. The resultant GRNs, named EpiNet, can now be intersected with individual transcriptomic studies on biological processes of interest to identify the most influential epigenetic regulators, as well as predicted gene targets of the epigenetic regulators. We demonstrate the validity of this approach using case studies of shoot and root apical meristem development.

root apical meristem↗
DOE OSTI2026

Data for Protoplast Fusion as a Strategy to Increase Ploidy in Rhodotorula toruloides for Strain Development

Rhodotorula toruloides is a red oleaginous yeast with growing commercial interest because of its hardiness and exceptional lipid production capacity. Because it is a basidiomycete yeast with a complex life cycle, many of the classical breeding methods used with ascomycetes are unavailable for strain improvement. However, we have been able to construct polyploid yeast by fusing protoplasts of parents with the same mating type. Fusing of Y-6985 (A2) and Y-48190 (A2), which had been transformed with complementary antibiotic markers, led to the recovery of two diploids and one triploid. The stability of the fusion yeasts was tested by plating them on non-selective medium after several growth cycles under antibiotics and then testing five colonies per strain for nuclear DNA contents using flow cytometry and standard cell cycle analysis: the triploid and one diploid were stable. Fusants inherited their mitochondria from a single parent, which was demonstrated using restriction fragment length polymorphism (RFLP) of mitochondrial DNA. The phenotypic properties of the parents and fusants were compared in glucose fed-batch bioreactor studies and cellulosic sugar batch cultures. The final lipid titers for the fed-batch cultures were 24.9–39.7 g/L with Y-6985 and the diploid and triploid performing the best and worst, respectively. The fusants demonstrated intermediate hardiness for growth on hydrolysate prepared with dilute-acid pretreated switchgrass and were outperformed by Y-48190. Unlike one of the haploid parents, the fusants grew in 70% v/v concentrated hydrolysate. However, they did not grow as fast as the other haploid. In this study, a modernized protoplast fusion method is resurrected a useful tool for strain development in this yeast, which is complementary with other available methods.

FOS: Biological sciences↗
DOE OSTI2026

Models and Algorithms for Equilibrium Analysis of Mixed-Material Nucleic Acid Systems

Dynamic programming algorithms within the NUPACK software suite enable analysis of equilibrium base-pairing properties for complex and test tube ensembles containing arbitrary numbers of interacting nucleic acid strands. Currently, calculations are limited to single-material systems that are either all-RNA or all-DNA. Here, to enable analysis of mixed-material systems that are critical for modern applications in vitro, in situ, and in vivo, we develop physical models and dynamic programming algorithms that allow the material of the system to be specified at nucleotide resolution. Free energy parameter sets are constructed for both RNA/DNA and RNA/2'OMe-RNA mixed-material systems by combining available empirical mixed-material parameters with single-material parameter sets to enable treatment of the full complex and test tube ensembles. New dynamic programming recursions account for the material of each nucleotide throughout the recursive process. For a complex with N nucleotides, the mixed-material dynamic programming algorithms maintain the O(N 3 ) time complexity of the single-material algorithms, enabling efficient calculation of diverse physical quantities over complex and test tube ensembles (e.g., complex partition function, equilibrium complex concentrations, equilibrium base-pairing probabilities, minimum free energy secondary structure(s), and Boltzmann-sampled secondary structures) at a cost increase of roughly 2.0-3.5×. The results of existing single-material algorithms are exactly reproduced when applying the new mixed-material algorithms to single-material systems. Accuracy is significantly enhanced using mixed-material models and algorithms to predict RNA/DNA and RNA/2'OMe-RNA duplex melting temperatures from the experimental literature as well as RNA/DNA melt profiles from new experiments. In conclusion, mixed-material analyses can be performed online using the NUPACK web app (www.nupack.org) or locally using the NUPACK Python module.

2′OMe-RNA↗
DOE OSTI2020

Improved bacterial recombineering by parallelized protein discovery

Exploiting bacteriophage-derived homologous recombination processes has offered precise, multiplex editing of microbial genomes and the construction of billions of customized genetic variants in a single day. The techniques that enable this, multiplex automated genome engineering (MAGE) and directed evolution with random genomic mutations (DIvERGE), are however, currently limited to a handful of microorganisms for which single-stranded DNA-annealing proteins (SSAPs) that promote efficient recombineering have been identified. Thus, to enable genome-scale engineering in new hosts, efficient SSAPs must first be found. Here we present a high-throughput method for SSAP discovery that we call “serial enrichment for efficient recombineering” (SEER). By performing SEER in Escherichia coli to screen hundreds of putative SSAPs, we identify highly active variants PapRecT and CspRecT. CspRecT increases the efficiency of single-locus editing to as high as 50% and improves multiplex editing by 5- to 10-fold in E. coli , while PapRecT enables efficient recombineering in Pseudomonas aeruginosa , a concerning human pathogen. CspRecT and PapRecT are also active in other, clinically and biotechnologically relevant enterobacteria. We envision that the deployment of SEER in new species will pave the way toward pooled interrogation of genotype-to-phenotype relationships in previously intractable bacteria.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2024

Engineering tertiary chirality in helical biopolymers

Tertiary chirality describes the handedness of supramolecular assemblies and relies not only on the primary and secondary structures of the building blocks but also on topological driving forces that have been sparsely characterized. Helical biopolymers, especially DNA, have been extensively investigated as they possess intrinsic chirality that determines the optical, mechanical, and physical properties of the ensuing material. Here, we employ the DNA tensegrity triangle as a model system to locate the tipping points in chirality inversion at the tertiary level by X-ray diffraction. We engineer tensegrity triangle crystals with incremental rotational steps between immobile junctions from 3 to 28 base pairs (bp). We construct a mathematical model that accurately predicts and explains the molecular configurations in both this work and previous studies. Our design framework is extendable to other supramolecular assemblies of helical biopolymers and can be used in the design of chiral nanomaterials, optically active molecules, and mesoporous frameworks, all of which are of interest to physical, biological, and chemical nanoscience.

Science & Technology - Other Topics↗
DOE OSTI2025

Nanopore Activity Assays for Detection of Biomarker Protease Activity: Design and Testing of Substrates for Both Nanopore Sequencing and PCR-Based Detection Methods

The work performed in this project has demonstrated the ability to construct proteolytic enzyme substrates that are PCR and sequencing-readable reporter molecules. Specifically, the goal was to detect those reporter molecules via PCR and Oxford Nanopore Technologies MinION sequencing methods following exposure to the biomarker protease thrombin. The assay development focused on binding the constructed peptide-oligonucleotide chimera to immobilized streptavidin. The action of thrombin on the peptide portion of the molecule released the oligonucleotide for detection. Detection of protease activity was demonstrated in a concentration-dependent manner using MALDI-MS, RT-PCR and DNA sequencing. Additional steps to remove background release of reporter molecules during the assay was used to improve the difference in detected oligonucleotide reporter following protease activity. Additional steps in assay development will be to (1) test the assay in an appropriate matrix, (2) investigate detection using additional DNA sequencing platforms and (3) demonstrate multiplexed detection of multiple protease markers in a single reaction.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS1996

Identification of a TAAT-containing motif required for high level expression of the COL1A1 promoter in differentiated osteoblasts of transgenic mice

Our previous studies have shown that the 49-base pair region of promoter DNA between -1719 and -1670 base pairs is necessary for transcription of the rat COL1A1 gene in transgenic mouse calvariae. In this study, we further define this element to the 13-base pair region between -1683 and -1670. This element contains a TAAT motif that binds homeodomain-containing proteins. Site-directed mutagenesis of this element in the context of a COL1A1-chloramphenicol acetyltransferase construct extending to -3518 base pairs decreased the ratio of reporter gene activity in calvariae to tendon from 3:1 to 1:1, suggesting a preferential effect on activity in calvariae. Moreover, chloramphenicol acetyltransferase-specific immunofluorescence microscopy of transgenic calvariae showed that the mutation preferentially reduced levels of chloramphenicol acetyltransferase protein in differentiated osteoblasts. Gel mobility shift assays demonstrate that differentiated osteoblasts contain a nuclear factor that binds to this site. This binding activity is not present in undifferentiated osteoblasts. We show that Msx2, a homeodomain protein, binds to this motif; however, Northern blot analysis revealed that Msx2 mRNA is present in undifferentiated bone cells but not in fully differentiated osteoblasts. In addition, cotransfection studies in ROS 17/2.8 osteosarcoma cells using an Msx2 expression vector showed that Msx2 inhibits a COL1A1 promoter-chloramphenicol acetyltransferase construct. Our results suggest that high COL1A1 expression in bone is mediated by a protein that is induced during osteoblast differentiation. This protein may contain a homeodomain; however, it is distinct from homeodomain proteins reported previously to be present in bone.

NASA Discipline Cell Biology↗
DOE OSTI2023

A Telomerase-Activated Magnetic Resonance Imaging Probe for Consecutively Monitoring Tumor Growth Kinetics and In Situ Screening Inhibitors

Telomerase has long been considered as a biomarker for cancer diagnosis and a therapeutic target for drug discovery. Detecting telomerase activity in vivo could provide more direct information of tumor progression and response to drug treatment, which, however, is hampered by the lack of an effective probe that can generate an output signal without a tissue penetration depth limit. Here in this study, using the principle of distance-dependent magnetic resonance tuning, we constructed a telomerase-activated magnetic resonance imaging probe (TAMP) by connecting superparamagnetic ferroferric oxide nanoparticles (SPFONs) and paramagnetic Gd-DOTA (Gd(III) 1,4,7,10- tetraazacyclododecane-1,4,7,10-tetraazacyclododecane-1,4,7,10-tet-raacetic acid) complexes via telomerase-responsive DNA motifs. Upon telomerase-catalyzed extension of the primer in TAMP, Gd-DOTA-conjugated oligonucleotides can be liberated from the surface of SPFONs through a DNA strand displacement reaction, restoring the T 1 signal of the Gd-DOTA for a direct readout of the telomerase activity. Here we show that, by tracking telomerase activity, this probe provides consistent monitoring of tumor growth kinetics during progression and in response to drug treatment and enables in situ screening of telomerase inhibitors in whole-animal models. This study provides an alternative toolkit for cancer diagnosis, treatment response assessment, and anticancer drug screening.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2022

Leakless end-to-end transport of small molecules through micron-length DNA nanochannels

Designed and engineered protein and DNA nanopores can be used to sense and characterize single molecules and control transmembrane transport of molecular species. However, designed biomolecular pores are less than 100 nm in length and are used primarily for transport across lipid membranes. Nanochannels that span longer distances could be used as conduits for molecules between nonadjacent compartments or cells. We design micrometer-long, 7-nm-diameter DNA nanochannels that small molecules can traverse according to the laws of continuum diffusion. Binding DNA origami caps to channel ends eliminates transport and demonstrates that molecules diffuse from one channel end to the other rather than permeating through channel walls. These micrometer-length nanochannels can also grow, form interconnects, and interface with living cells. This work thus shows how to construct multifunctional, dynamic agents that control molecular transport, opening ways of studying intercellular signaling and modulating molecular transport between synthetic and living cells.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Toward three-dimensional DNA industrial nanorobots

Nanoscale industrial robots have potential as manufacturing platforms and are capable of automatically performing repetitive tasks to handle and produce nanomaterials with consistent precision and accuracy. We demonstrate a DNA industrial nanorobot that fabricates a three-dimensional (3D), optically active chiral structure from optically inactive parts. By making use of externally controlled temperature and ultraviolet (UV) light, our programmable robot, ~100 nanometers in size, grabs different parts, positions and aligns them so that they can be welded, releases the construct, and returns to its original configuration ready for its next operation. Our robot can also self-replicate its 3D structure and functions, surpassing single-step templating (restricted to two dimensions) by using folding to access the third dimension and more degrees of freedom. Our introduction of multiple-axis precise folding and positioning as a tool/technology for nanomanufacturing will open the door to more complex and useful nano- and microdevices.

Robotics↗
DOE OSTI2019

Building in vitro transcriptional regulatory networks by successively integrating multiple functional circuit modules

The regulation of cellular dynamics and responses to stimuli by genetic regulatory networks suggests how in vitro chemical reaction networks might analogously direct the dynamics of synthetic materials or chemistries. A key step in developing genetic regulatory network analogues capable of this type of sophisticated regulation is the integration of multiple coordinated functions within a single network. In this study, we demonstrate how such functional integration can be achieved using in vitro transcriptional genelet circuits that emulate essential features of cellular genetic regulatory networks. By successively incorporating functional genelet modules into a bistable circuit, we construct an integrated regulatory network that dynamically changes its state in response to upstream stimuli and coordinates the timing of downstream signal expression. We use quantitative models to guide module integration and develop strategies to mitigate undesired interactions between network components that arise as the size of the network increases. This approach could enable the construction of in vitro networks capable of multifaceted chemical and material regulation.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2019

DNA-Enabled Chiral Gold Nanoparticle–Chromophore Hybrid Structure with Resonant Plasmon–Exciton Coupling Gives Unusual and Strong Circular Dichroism

Circular dichroism (CD) from hybrid complexes of plasmonic nanostructures and chiral molecules has recently attracted significant interest. Yet, the hierarchical chiral self-assembly of molecules on surfaces of metal nanostructures has remained challenging. As a result, a deep understanding of plasmon–exciton coupling between surface plasmons and chiral collective molecular excitations has not been achieved. In particular, the critical impact of resonant plasmon–exciton coupling within the hybrid is unclear. Here, we employed DNA-templated strategies to control the chiral self-assembly of achiral chromophores with rationally tuned exciton transitions on gold nanosphere (AuNP) or gold nanorod (AuNR) surfaces. Unlike many previous chiral plasmonic hybrids utilizing chiral biomolecules with CD signals in the UV range, we designed structures with the chiral excitonic resonances at visible wavelengths. The constructed hybrid complexes displayed strong chiroptical activity that depends on the spectral overlap between the chiral collective molecular excitations and the plasmon resonances. We find that when spectral overlap is optimized, the molecular CD signal originating from the chiral self-assemblies of chromophores was strongly enhanced (maximum enhancement of nearly an order of magnitude) and a plasmonic CD signal was induced. Surprisingly, the sign of the molecular CD was reversed despite different self-assembly mechanisms of the Au nanoparticle–chromophore hybrids. Our findings offer new insight into plasmonic CD enhancements and will inspire further studies on chiral light–matter interactions in strongly coupled plasmonic–excitonic systems.

77 NANOSCIENCE AND NANOTECHNOLOGY↗
DOE OSTI2025

Nucleic Acid-Based Detection Protease Activity

Proteases include clinically relevant markers for clotting disorders, certain cancers as well as toxins. Assays for protease activity often use designed peptides mimicking natural substrates and detection with colorometric and fluorescence-based detection that is difficult to multiplex without expensive and resource demanding instruments. This work demonstrates detection of proteolytic activity using PCR and sequencing-readable reporter molecules. The assay development focused on binding the constructed peptide-oligonucleotide chimera to immobilized streptavidin. Thrombin, an essential component of the clotting cascade, was used as a model system for testing peptide substrate recognition and release of a designed oligonucleotide for detection. Detection of protease activity was demonstrated in a concentration-dependent manner using MALDI-MS, RT-PCR and DNA sequencing.

Wunschel, David S [Pacific Northwest National Labo↗
DOE OSTI2025

Yeast Transformation on Hamilton Vantage (YT Vantage) v1

Our software program is designed for the Hamilton Vantage liquid handling robot, automating the Build step in the Design-Build-Test-Learn (DBTL) cycle for Saccharomyces cerevisiae. This program minimizes human intervention, enabling rapid identification of pathway bottlenecks and genes that enhance verazine production. The program takes competent yeast and plasmid DNA as input and generates an output library of engineered strains compatible with automated colony picking, high-throughput culturing, and chemical extraction for downstream LC-MS analysis. A user-friendly interface, developed using the Hamilton Method Editor software, allows for on-demand parameter customization. By automating this process, our program streamlines the construction of Saccharomyces cerevisiae, reducing manual labor and increasing efficiency. While the manual process is well-documented, integration with robotic automation is less common, making our program a valuable tool for researchers. With this software, we achieved 2-5 fold increases in verazine production, demonstrating its potential to accelerate research in this field.

Louie, Randy [Lawrence Berkeley National Laborator↗
DOE OSTI2018

Short fish-origin DNA elements served as flanking sequences in a knockdown cloning vector enabling the generation of a functional siRNA molecule in mammalian cells and fish embryos

Improving the quality of a siRNA-knockdown cloning vector requires simpler, shorter, and more effective flanking sequences. In this study, we designed such flanking sequences based on those found in zebrafish pre-miR3906, namely, internal element (IE) 1 and IE2. We engineered a vegf-shRNA fragment flanked by an 80-bp IE1/IE2 and then inserted into the 3′ UTR of GFP reporter cDNA driven by a cytomegalovirus promoter to obtain a plasmid containing gfp-IE-vegf-shRNA-polA. Upon microinjection of this plasmid into zebrafish embryos, we found that IE flanking sequences could effectively induce the production of vegf-shRNA fragment, which was then processed into a functional siRNA to silence the target vegf121 gene. Northern blot showed that the vegf-shRNA fragment was cleaved from gfp-IE-vegf-shRNA-polA, resulting in the loss of polyA tails, subsequently degrading the remaining RNA-containing GFP. Moreover, Western blot revealed that addition of IE-based vegf-shRNA fragment could markedly decrease the expression of VEGF. Finally, to facilitate a more versatile application of the IE-based knockdown vector, we generated an inducible expression vector in which IE-vegf-shRNA was constructed downstream in a Tet-on system to generate a Tet-on-IE-vegf-shRNA construct. After doxycycline induction, the protein level of VEGF in SW620 cells harboring the Tet-on-IE-vegf-shRNA construct was decreased 77%. Interestingly, when SW620 cells harboring Tet-on-IE-vegf-shRNA cells were induced and transplanted into zebrafish embryos, we found that abnormal branch of the sub-intestinal vessels was reduced in the recipient embryos, suggesting that vegf-shRNA cleaved from Tet-on-IE-vegf-shRNA-polA was processed into a functional vegf-siRNA in embryos suppressing endogenous VEGF and reducing tumor angiogenesis. Therefore, we conclude that fish-origin IEs are flanking sequences with short, simple, and effective DNA elements. This IE-based knockdown cloning vector provides a new alternative material to facilitate the generation of functional siRNA with which to perform loss-of-function experiments, both in vitro (mammalian cells) and in vivo (zebrafish embryos).

60 APPLIED LIFE SCIENCES↗
DOE OSTI2023

eYGFPuv-Assisted Transgenic Selection in Populus deltoides WV94 and Multiplex Genome Editing in Protoplasts of P. trichocarpa × P. deltoides Clone ‘52-225’

Although CRISPR/Cas-based genome editing has been widely used for plant genetic engineering, its application in the genetic improvement of trees has been limited, partly because of challenges in Agrobacterium-mediated transformation. As an important model for poplar genomics and biotechnology research, eastern cottonwood (Populus deltoides) clone WV94 can be transformed by A. tumefaciens, but several challenges remain unresolved, including the relatively low transformation efficiency and the relatively high rate of false positives from antibiotic-based selection of transgenic events. Moreover, the efficacy of CRISPR-Cas system has not been explored in P. deltoides yet. Here, we first optimized the protocol for Agrobacterium-mediated stable transformation in P. deltoides WV94 and applied a UV-visible reporter called eYGFPuv in transformation. Our results showed that the transgenic events in the early stage of transformation could be easily recognized and counted in a non-invasive manner to narrow down the number of regenerated shoots for further molecular characterization (at the DNA or mRNA level) using PCR. We found that approximately 8.7% of explants regenerated transgenic shoots with green fluorescence within two months. Next, we examined the efficacy of multiplex CRISPR-based genome editing in the protoplasts derived from P. deltoides WV94 and hybrid poplar clone ‘52-225’ (P. trichocarpa × P. deltoides clone ‘52-225’). The two constructs expressing the Trex2-Cas9 system resulted in mutation efficiency ranging from 31% to 57% in hybrid poplar clone 52-225, but no editing events were observed in P. deltoides WV94 transient assay. The eYGFPuv-assisted plant transformation and genome editing approach demonstrated in this study has great potential for accelerating the genome editing-based breeding process in poplar and other non-model plants species and point to the need for additional CRISPR work in P. deltoides.

59 BASIC BIOLOGICAL SCIENCES↗