Search NASA⌕ Search

SEARCH · Search NASA

Results for “motifs”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 199 records · Page 11
All sourcesNASA NTRSDOE OSTI
DOE OSTI2020

Reinterpreting π-stacking

The nature of π–π interactions has long been debated. The term “π-stacking” is considered by some to be a misnomer, in part because overlapping π-electron densities are thought to incur steric repulsion, and the physical origins of the widely-encountered “slip-stacked” motif have variously been attributed to either sterics or electrostatics, in competition with dispersion. Here, we use quantum-mechanical energy decomposition analysis to investigate π–π interactions in supramolecular complexes of polycyclic aromatic hydrocarbons, ranging in size up to realistic models of graphene, and for comparison we perform the same analysis on stacked complexes of polycyclic saturated hydrocarbons, which are cyclohexane-based analogues of graphane. Our results help to explain the short-range structure of liquid hydrocarbons that is inferred from neutron scattering, trends in melting-point data, the interlayer separation of graphene sheets, and finally band gaps and observation of molecular plasmons in graphene nanoribbons. Analysis of intermolecular forces demonstrates that aromatic π–π interactions constitute a unique and fundamentally quantum-mechanical form of non-bonded interaction. Not only do stacked π–π architectures enhance dispersion, but quadrupolar electrostatic interactions that may be repulsive at long range are rendered attractive at the intermolecular distances that characterize π-stacking, as a result of charge penetration effects. The planar geometries of aromatic sp 2 carbon networks lead to attractive interactions that are “served up on a molecular pizza peel”, and adoption of slip-stacked geometries minimizes steric (rather than electrostatic) repulsion. The slip-stacked motif therefore emerges not as a defect induced by electrostatic repulsion but rather as a natural outcome of a conformational landscape that is dominated by van der Waals interactions (dispersion plus Pauli repulsion), and is therefore fundamentally quantum-mechanical in its origins. This reinterpretation of the forces responsible for π-stacking has important implications for the manner in which non-bonded interactions are modeled using classical force fields, and for rationalizing the prevalence of the slip-stacked π–π motif in protein crystal structures.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2020

Bonding similarities and differences between Y–Sb–Te and Sc–Sb–Te phase-change memory materials

The scandium (Sc) – alloyed Sb 2 Te 3 phase-change alloy has recently been found to enable ultrafast crystal nucleation due to the formation of Sc-stabilized octahedral motifs in the amorphous phase, rendering cache-type phase-change memory feasible. When yttrium (Y) is added, however, non-octahedral bonding patterns form in the amorphous Sb 2 Te 3 -based network even though Y has a valence electron configuration similar to that of Sc and also forms perfect octahedral bonding environments with tellurium in the YTe crystal. Here we elucidate the origin of this difference between Sc and Y, by carrying out thorough ab initio simulations and orbital-based bonding analyses on amorphous Y–Sb–Te and Sc–Sb–Te compounds. We also demonstrate how the smooth overlap of atomic positions (SOAP) similarity kernel can be used to quantify the structural similarity of local motifs in the amorphous phase with respect to various crystalline yttrium and scandium tellurides, both in the nearest-neighbor shell and beyond. We discover that the bonding contrast of Y- and Sc-centered structural motifs in amorphous Sb 2 Te 3 stems from their parent crystals at high Te concentrations. The larger atomic radius of Y and the weaker charge transfer when bonded with Te is found to allow more Te neighbors and cause a more open bonding environment, leading to higher coordination numbers and non-octahedral environments. We discuss the implications of the different local environments for practical applications in memory devices.

36 MATERIALS SCIENCE↗
DOE OSTI2023

Advanced supramolecular design for direct ink writing of soft materials

The exciting advancements in 3D-printing of soft materials are changing the landscape of materials development and fabrication. Among various 3D-printers that are designed for soft materials fabrication, the direct ink writing (DIW) system is particularly attractive for chemists and materials scientists due to the mild fabrication conditions, compatibility with a wide range of organic and inorganic materials, and the ease of multi-materials 3D-printing. Inks for DIW need to possess suitable viscoelastic properties to allow for smooth extrusion and be self-supportive after printing, but molecularly facilitating 3D printability to functional materials remains nontrivial. While supramolecular binding motifs have been increasingly used for 3D-printing, these inks are largely optimized empirically for DIW. Hence, this review aims to establish a clear connection between the molecular understanding of the supramolecularly bound motifs and their viscoelastic properties at bulk. Herein, extrudable (but not self-supportive) and 3D-printable (self-supportive) polymeric materials that utilize noncovalent interactions, including hydrogen bonding, host–guest inclusion, metal–ligand coordination, micro-crystallization, and van der Waals interaction, have been discussed in detail. In particular, the rheological distinctions between extrudable and 3D-printable inks have been discussed from a supramolecular design perspective. Examples shown in this review also highlight the exciting macroscale functions amplified from the molecular design. Challenges associated with the hierarchical control and characterization of supramolecularly designed DIW inks are also outlined. The perspective of utilizing supramolecular binding motifs in soft materials DIW printing has been discussed. Finally, this review serves to connect researchers across disciplines to develop innovative solutions that connect top-down 3D-printing and bottom-up supramolecular design to accelerate the development of 3D-print soft materials for a sustainable future.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2023

Structural relaxation of water during rapid cooling from ambient temperatures

Experiments investigating the properties of deeply supercooled liquid water are needed to develop a comprehensive understanding of water’s anomalous properties. One approach involves transiently heating nanoscale water films into the supercooled region for several nanoseconds at a time and then interrogating the water films after they have quenched to cryogenic temperatures. To relate the results obtained with this approach to other experiments and simulations on supercooled water, it is important to understand how closely the quenched structure tracks the (metastable) equilibrium structure of water as a function of the transient heating temperature. A key step involves quantifying the extent to which water that is transiently heated to ambient temperatures [hyperquenched water (HQW)] subsequently relaxes toward the structure of low-density amorphous (LDA) ice as it cools. We analyzed the infrared reflection–absorption spectra of LDA, HQW, and crystalline ice films to determine their complex indices of refraction. With this information, we estimate that HQW retains ~50%–60% of a structural motif characteristic of water at high temperatures with the balance comprised of a low-temperature motif. This result, along with results from x-ray diffraction experiments on water and amorphous ices, allows one to quantify the fraction of the high-temperature motif at approximately zero pressure as a function of temperature from 150 to 350 K.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2021

Structural basis for Clostridium perfringens enterotoxin targeting of claudins at tight junctions in mammalian gut

The bacterium Clostridium perfringens causes severe, sometimes lethal gastrointestinal disorders in humans, including enteritis and enterotoxemia. Type F strains produce an enterotoxin (CpE) that causes the third most common foodborne illness in the United States. CpE induces gut breakdown by disrupting barriers at cell–cell contacts called tight junctions (TJs), which are formed and maintained by claudins. Targeted binding of CpE to specific claudins, encoded by its C-terminal domain (cCpE), loosens TJ barriers to trigger molecular leaks between cells. Cytotoxicity results from claudin-bound CpE complexes forming pores in cell membranes. In mammalian tissues, ~24 claudins govern TJ barriers—but the basis for CpE’s selective targeting of claudins in the gut was undetermined. We report the structure of human claudin-4 in complex with cCpE, which reveals that enterotoxin targets a motif conserved in receptive claudins and how the motif imparts high-affinity CpE binding to these but not other subtypes. The structural basis of CpE targeting is supported by binding affinities, kinetics, and half-lives of claudin–enterotoxin complexes and by the cytotoxic effects of CpE on claudin-expressing cells. By correlating the binding residence times of claudin–CpE complexes we determined to claudin expression patterns in the gut, we uncover that the primary CpE receptors differ in mice and humans due to sequence changes in the target motif. These findings provide the molecular and structural element CpE employs for subtype-specific targeting of claudins during pathogenicity of C. perfringens in the gut and a framework for new strategies to treat CpE-based illnesses in domesticated mammals and humans.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

The GRAS protein RAM1 interacts with WRI transcription factors to regulate plant genes required for arbuscule development and function

During arbuscular mycorrhiza (AM) symbiosis AM fungi form tree-shaped structures called arbuscules in root cortex cells of host plants. Arbuscules and their host cells are central for reciprocal nutrient exchange between the symbionts.REQUIRED FOR ARBUSCULAR MYCORRHIZATION1(RAM1) encodes a GRAS protein crucial for transcriptionally regulating plant genes needed for arbuscule development and nutrient exchange. Similar to other GRAS proteins, RAM1 likely does not bind to DNA and how RAM1 activates its target promoters remained elusive. Here, we demonstrate that RAM1 interacts with five AM-induced APETALA 2 (AP2) transcription factors of the WRINKLED1-like family called CTTC MOTIF-BINDING TRANSCRIPTION FACTOR1 (CBX1), WRI3, WRI5a, WRI5b, and WRI5c via a C-terminal domain containing the M2/M2a motif. This motif is conserved and enriched in WRI proteins encoded by genomes of AM-competent plants. RAM1 together with any of these WRI proteins activates the promoters of genes required for symbiotic nutrient exchange, namelyRAM2,STUNTED ARBUSCULES (STR),andPHOSPHATE TRANSPORTER 4 (PT4), inNicotiana benthamianaleaves. This activation as well as target promoter induction inLotus japonicushairy roots depends onMYCS(MYCORRHIZA SEQUENCE)-elements andAW-boxes, previously identified as WRI-binding sites. TheWRIgenes are activated in two waves: Transcription ofRAM1,CBX1,andWRI3is coregulated by calcium- and calmodulin-dependent protein kinase-activated CYCLOPS, through theAMCYC-REin their promoter, and DELLA, whileWRI5a,b,andcpromoters containMYCS-elements andAW-boxes and can be activated by RAM1 heterocomplexes with CBX1 or WRI3. We propose that RAM1 provides an activation domain to DNA-binding WRI proteins to activate genes with central roles in AM development and function.

Science & Technology - Other Topics↗
DOE OSTI2023

Conserved unique peptide patterns (CUPP) online platform 2.0: implementation of +1000 JGI fungal genomes

Carbohydrate-processing enzymes, CAZymes, are classified into families based on sequence and three-dimensional fold. Because many CAZyme families contain members of diverse molecular function (different EC-numbers), sophisticated tools are required to further delineate these enzymes. Such delineation is provided by the peptide-based clustering method CUPP, Conserved Unique Peptide Patterns. CUPP operates synergistically with the CAZy family/subfamily categorizations to allow systematic exploration of CAZymes by defining small protein groups with shared sequence motifs. The updated CUPP library contains 21,930 of such motif groups including 3,842,628 proteins. The new implementation of the CUPP-webserver, https://cupp.info/, now includes all published fungal and algal genomes from the Joint Genome Institute (JGI), genome resources MycoCosm and PhycoCosm, dynamically subdivided into motif groups of CAZymes. This allows users to browse the JGI portals for specific predicted functions or specific protein families from genome sequences. Thus, a genome can be searched for proteins having specific characteristics. All JGI proteins have a hyperlink to a summary page which links to the predicted gene splicing including which regions have RNA support. The new CUPP implementation also includes an update of the annotation algorithm that uses only a fourth of the RAM while enabling multi-threading, providing an annotation speed below 1 ms/protein.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Decagonal Sn clathrate on d-Al-Ni-Co

Decagonal quasiperiodic ordering of Sn thin films on d-Al-Ni-Co is shown based on scanning tunneling microscopy (STM), low-energy electron diffraction, and density functional theory (DFT). Interestingly, the decagonal structural correlations are partially retained even up to a large film thickness of 10 nm grown at 165±10K. The nucleation centers called “Sn white flowers” identified by STM at submonolayer thickness are recognized as valid patches of the decagonal clathrate structure with low adsorption energies of these motifs. Due to the excellent lattice matching (to within 1%) between columns of Sn dodecahedra in the clathrate structure and pentagonal motifs at the d-Al-Ni-Co surface, the interfacial energy favors clathrate over the competing Sn crystalline forms. DFT study of the Sn/Al-Ni-Co composite model shows good mechanical stability, as shown by the work of separation of Sn from Al-Ni-Co slab that is comparable to the clathrate self-separation energy. Finally, the relaxed surface terminations of the R 2 T 4 clathrate approximant are in self-similarity correspondence with the motifs observed in the STM images from monolayer to the thickest Sn film.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2025

Physical properties of intergrowth compound Eu 2 CuZn 2 P 3

Here, the physical properties of single-crystalline Eu 2 ⁢CuZn 2 ⁢P 3 were inspected via thermodynamic, transport, and neutron diffraction measurements. Eu 2 ⁢ CuZn 2⁢ P 3 is composed of EuCuP and EuZn 2 ⁢ P 2 motifs stacked in a one-to-one ratio. The magnetic response of Eu 2 ⁢ CuZn 2 ⁢ P 3 is similar to that of EuZn 2 ⁢ P 2 in its A-type antiferromagnetic (semiconducting) state. A Néel temperature of T N = 40.3K is obtained from the specific heat capacity. Single-crystal neutron diffraction reveals a (001) magnetic propagation vector, with primarily in-plane moments coupled along [001] in an up-up-down-down pattern. This spin structure retains the ferromagnetic EuCuP motifs and antiferromagnetic coupling across the EuZn 2 ⁢P 2 motifs. The electrical resistivity is characterized by metallic behavior above 100 K, an increase in ρ upon cooling below ≈ 75K, and a large negative magnetoresistance below T N . First principles calculations evidence a narrow band gap for antiferromagnetic ordering and semimetallic behavior for the ferromagnetic state. This is consistent with the observed effect of magnetic field on the electrical resistivity. Hall effect measurements reveal a field-induced, negative anomalous Hall effect that increases on cooling down to 2 K. Also, an unconventional contribution to the Hall effect dominates the low-field Hall signal, particularly near T N , and is similar in appearance to a topological Hall effect. However, further work is necessary to understand if any of the transport properties have topological origins or if magnetism-induced modifications to the Fermi surface induce these unusual Hall effect signals in this and related materials.

36 MATERIALS SCIENCE↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

The ICF syndrome protein CDCA7 harbors a unique DNA binding domain that recognizes a CpG dyad in the context of a non-B DNA

CDCA7, encoding a protein with a carboxyl-terminal cysteine-rich domain (CRD), is mutated in immunodeficiency, centromeric instability, and facial anomalies (ICF) syndrome, a disease related to hypomethylation of juxtacentromeric satellite DNA. How CDCA7 directs DNA methylation to juxtacentromeric regions is unknown. Here, we show that the CDCA7 CRD adopts a unique zinc-binding structure that recognizes a CpG dyad in a non-B DNA formed by two sequence motifs. CDCA7, but not ICF mutants, preferentially binds the non-B DNA with strand-specific CpG hemi-methylation. The unmethylated sequence motif is highly enriched at centromeres of human chromosomes, whereas the methylated motif is distributed throughout the genome. At S phase, CDCA7, but not ICF mutants, is concentrated in constitutive heterochromatin foci, and the formation of such foci can be inhibited by exogenous hemi-methylated non-B DNA bound by the CRD. Binding of the non-B DNA formed in juxtacentromeric regions during DNA replication provides a mechanism by which CDCA7 controls the specificity of DNA methylation.

Science & Technology - Other Topics↗
DOE OSTI2021

Peptidoglycan Contribution to the B Cell Superantigen Activity of Staphylococcal Protein A

Staphylococcus aureus causes reiterative and chronic persistent infections. This can be explained by the formidable ability of this pathogen to escape immune surveillance mechanisms. Cells of S. aureus display the abundant staphylococcal protein A (SpA). SpA binds to immunoglobulin (Ig) molecules and coats the bacterial surface to prevent phagocytic uptake. SpA also binds and cross-links variable heavy 3 (V H 3) idiotype (IgM) B cell receptors, promoting B cell expansion and the secretion of nonspecific V H 3-IgM via a mechanism requiring CD4 + T cell help. SpA binding to antibodies is mediated by the N-terminal Ig-binding domains (IgBDs). The so-called region X, uncharacterized LysM domain, and C-terminal LPXTG sorting signal for peptidoglycan attachment complete the linear structure of the protein. Here, we report that both the LysM domain and the LPXTG motif sorting signal are required for the B cell superantigen activity of SpA in a mouse model of infection. SpA molecules purified from staphylococcal cultures are sufficient to exert B cell superantigen activity and promote immunoglobulin secretion as long as they carry intact LysM and LPXTG motif domains with bound peptidoglycan fragments. The LysM domain binds the glycan chains of peptidoglycan fragments, whereas the LPXTG motif is covalently linked to wall peptides lacking glycan. These findings emphasize the complexity of SpA interactions with B cell receptors.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

G4Boost: a machine learning-based tool for quadruplex identification and stability prediction

Background: G-quadruplexes (G4s), formed within guanine-rich nucleic acids, are secondary structures involved in important biological processes. Although every G4 motif has the potential to form a stable G4 structure, not every G4 motif would, and accurate energy-based methods are needed to assess their structural stability. Here, we present a decision tree-based prediction tool, G4Boost, to identify G4 motifs and predict their secondary structure folding probability and thermodynamic stability based on their sequences, nucleotide compositions, and estimated structural topologies. Results: G4Boost predicted the quadruplex folding state with an accuracy greater then 93% and an F1-score of 0.96, and the folding energy with an RMSE of 4.28 and R 2 of 0.95 only by the means of sequence intrinsic feature. G4Boost was successfully applied and validated to predict the stability of experimentally-determined G4 structures, including for plants and humans. Conclusion: G4Boost outperformed the three machine-learning based prediction tools, DeepG4, Quadron, and G4RNA Screener, in terms of both accuracy and F1-score, and can be highly useful for G4 prediction to understand gene regulation across species including plants and humans.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Improved recovery of cell-cycle gene expression in Saccharomyces cerevisiae from regulatory interactions in multiple omics data

Gene expression is regulated by DNA-binding transcription factors (TFs). Together with their target genes, these factors and their interactions collectively form a gene regulatory network (GRN), which is responsible for producing patterns of transcription, including cyclical processes such as genome replication and cell division. However, identifying how this network regulates the timing of these patterns, including important interactions and regulatory motifs, remains a challenging task. Results We employed four in vivo and in vitro regulatory data sets to investigate the regulatory basis of expression timing and phase-specific patterns cell-cycle expression in Saccharomyces cerevisiae . Specifically, we considered interactions based on direct binding between TF and target gene, indirect effects of TF deletion on gene expression, and computational inference. We found that the source of regulatory information significantly impacts the accuracy and completeness of recovering known cell-cycle expressed genes. The best approach involved combining TF-target and TF-TF interactions features from multiple datasets in a single model. In addition, TFs important to multiple phases of cell-cycle expression also have the greatest impact on individual phases. Important TFs regulating a cell-cycle phase also tend to form modules in the GRN, including two sub-modules composed entirely of unannotated cell-cycle regulators ( STE12-TEC1 and RAP1-HAP1-MSN4 ). Conclusion Our findings illustrate the importance of integrating both multiple omics data and regulatory motifs in order to understand the significance regulatory interactions involved in timing gene expression. This integrated approached allowed us to recover both known cell-cycles interactions and the overall pattern of phase-specific expression across the cell-cycle better than any single data set. Likewise, by looking at regulatory motifs in the form of TF-TF interactions, we identified sets of TFs whose co-regulation of target genes was important for cell-cycle expression, even when regulation by individual TFs was not. Overall, this demonstrates the power of integrating multiple data sets and models of interaction in order to understand the regulatory basis of established biological processes and their associated gene regulatory networks.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

High-density binding to Plasmodium falciparum circumsporozoite protein repeats by inhibitory antibody elicited in mouse with human immunoglobulin repertoire

Antibodies targeting the human malaria parasite Plasmodium falciparum circumsporozoite protein (PfCSP) can prevent infection and disease. PfCSP contains multiple central repeating NANP motifs; some of the most potent anti-infective antibodies against malaria bind to these repeats. Multiple antibodies can bind the repeating epitopes concurrently by engaging into homotypic Fab-Fab interactions, which results in the ordering of the otherwise largely disordered central repeat into a spiral. Here, we characterize IGHV3-33/IGKV1-5-encoded monoclonal antibody (mAb) 850 elicited by immunization of transgenic mice with human immunoglobulin loci. mAb 850 binds repeating NANP motifs with picomolar affinity, potently inhibits Plasmodium falciparum (Pf) in vitro and, when passively administered in a mouse challenge model, reduces liver burden to a similar extent as some of the most potent anti-PfCSP mAbs yet described. Like other IGHV3-33/IGKV1-5-encoded anti-NANP antibodies, mAb 850 primarily utilizes its HCDR3 and germline-encoded aromatic residues to recognize its core NANP motif. Biophysical and cryo-electron microscopy analyses reveal that up to 19 copies of Fab 850 can bind the PfCSP repeat simultaneously, and extensive homotypic interactions are observed between densely-packed PfCSP-bound Fabs to indirectly improve affinity to the antigen. Together, our study expands on the molecular understanding of repeat-induced homotypic interactions in the B cell response against PfCSP for potently protective mAbs against Pf infection.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Genome-Wide Discovery of G-Quadruplexes in Wheat: Distribution and Putative Functional Roles

G-quadruplexes are nucleic acid secondary structures formed by a stack of square planar G-quartets. G-quadruplexes were implicated in many biological functions including telomere maintenance, replication, transcription, and translation, in many species including humans and plants. For wheat, however, though it is one of the world’s most important staple food, no G-quadruplex studies have been reported to date. Here, we computationally identify putative G4 structures (G4s) in wheat genome for the first time and compare its distribution across the genome against five other genomes (human, maize, Arabidopsis, rice, and sorghum). We identified close to 1 million G4 motifs with a density of 76 G4s/Mb across the whole genome and 93 G4s/Mb over genic regions. Remarkably, G4s were enriched around three regions, two located on the antisense and one on the sense strand at the following positions: 1) the transcription start site (TSS) (antisense), 2) the first coding domain sequence (CDS) (antisense), and 3) the start codon (sense). Functional enrichment analysis revealed that the gene models containing G4 motifs within these peaks were associated with specific gene ontology (GO) terms, such as developmental process, localization, and cellular component organization or biogenesis. We investigated genes encoding MADS-box transcription factors and showed examples of G4 motifs within critical regulatory regions in the VRN-1 genes in wheat. Furthermore, comparison with other plants showed that monocots share a similar distribution of G4s, but Arabidopsis shows a unique G4 distribution. Our study shows for the first time the prevalence and possible functional roles of G4s in wheat.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Atomic-scale cryogenic electron microscopy imaging of self-assembled peptoid nanostructures

Amphiphilic polypeptoids with defined sequences, versatile in forming various nanostructures, are ideal for mimicking biomacromolecular structures. The predictive design of nanostructures depends on our understanding of the relationship between molecular structure and the locations of atoms in the nanostructure. Factors of importance include chain conformation, crystal motifs, and the arrangement of the molecules within the nanostructure. Here, this review introduces the cryogenic transmission electron microscopy (cryo-TEM) method, sorting and averaging unit cells in nanosheets for resolution enhancement and identifying structural heterogeneity. The resulting atomic-scale images reveal the presence of two types of crystal motifs. The impact of processing conditions, capping group chemistry, and side chain chemistry on structural heterogeneity and crystal motifs can be quantified. The 3D reconstruction of nanosheets, wherein atomic-scale corrugations were revealed, is introduced in this review. New developments in cryo-TEM, such as phase retrieval reconstruction, hold great promise for atomic-scale imaging of soft nanostructures.

36 MATERIALS SCIENCE↗
DOE OSTI2024

Evaluation of Additively Manufactured Monolithic SiC and SiC Ceramic Matrix Composites for Concentrating Solar Receiver Applications

Supported by an award from the Solar Technology Office, US Department of Energy, GE Aerospace Research in collaboration with Heliogen Holdings Inc, is engaged in the development of ultra-High Operating Temperature SiC-matrix Solar Thermal Air Receiver (HOTSSTAR). We report the results of our study of the effective heat transfer characteristic of several candidate structure motifs, or feature geometries, made of SiC via additive manufacturing in a simulative laboratory test. The SiC structure motifs studied include different permutations of three-dimensional periodic lattices and defined shapes. The solar-thermal simulating laboratory test setup is constructed using a 4kW CO2 laser system with beam shaping optics to apply radiative heating power on one face of 2”-diameter cylindrical feature specimens representing the structure motifs of interest for receiver element design. Using the test setup, simulative test conditions representative of a concentrated solar flux of up to ~2000 suns could be achieved in the lab tests under varying air flow through the test structure. A numerical analysis scheme is developed to extract an effective or compound heat transfer coefficient representative of the test structure under steady-state heat flow conditions.

14 SOLAR ENERGY↗