Search NASA⌕ Search

SEARCH · Search NASA

Results for “populus”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 199 records · Page 11
All sourcesNASA NTRSDOE OSTI
DOE OSTI2021

Heterospecific Neighbor Plants Impact Root Microbiome Diversity and Molecular Function of Root Fungi

Within the forest community, competition and facilitation between adjacent-growing conspecific and heterospecific plants are mediated by interactions involving common mycorrhizal networks. The ability of plants to alter their neighbor’s microbiome is well documented, but the molecular biology of plant-fungal interactions during competition and facilitation has not been previously examined. We used a common soil-plant bioassay experiment to study molecular plant-microbial interactions among rhizosphere communities associated with Pinus taeda (native host) and Populus trichocarpa (non-native host). Gene expression of interacting fungal and bacterial rhizosphere communities was compared among three plant-pairs: Populus growing with Populus , Populus with Pinus , and Pinus with Pinus . Our results demonstrate that heterospecific plant partners affect the assembly of root microbiomes, including the changes in the structure of host specific community. Comparative metatranscriptomics reveals that several species of ectomycorrhizal fungi (EMF) and saprotrophic fungi exhibit different patterns of functional and regulatory gene expression with these two plant hosts. Heterospecific plants affect the transcriptional expression pattern of EMF host-specialists (e.g., Pinus -associated Suillus spp.) on both plant species, mainly including the genes involved in the transportation of amino acids, carbohydrates, and inorganic ions. Alteration of root microbiome by neighboring plants may help regulate basic plant physiological processes via modulation of molecular functions in the root microbiome.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Leveraging hyperspectral phenotyping for accurate, non-destructive prediction of metabolite profiles in poplar under drought stress

Accurately predicting drought tolerance in woody perennial bioenergy crops is critical for sustainable biomass production under fluctuating precipitation. Hyperspectral imaging (HSI) in the visible-near-infrared (VNIR) and shortwave-infrared (SWIR) ranges offers a promising approach for predicting plant biochemical traits, yet its application in metabolite profiling remains underexplored. We integrated VNIR+SWIR HSI with untargeted metabolomics to investigate drought-induced metabolic shifts in Populus leaves from eight Populus genotypes. Metabolite profiling identified 127 compounds, with 73 showing significant drought responses spanning amino acids (AA), carbohydrates (CHO), phenolic glycosides (PG), organic acids (OA), fatty acids and alcohols (FA), terpenes (T), phenolic metabolites (P), and unclassified metabolites. Spectral analysis revealed consistently higher reflectance across VNIR and SWIR wavelengths in drought-stressed plants, corresponding with increased accumulation of AA and reduced CHO and PG levels. Least absolute shrinkage and selection operator (LASSO) regression modeling identified robust spectral predictors of metabolite concentrations, associating VNIR wavelengths (500–700 nm) predominantly with AA and P, whereas SWIR wavelengths (1680–1700 nm) reliably predicted CHO, OA, and T. Several stable spectral-metabolite associations persisted across the two watering regimes (drought vs. well-watered), highlighting their potential as spectral biomarkers for non-destructive stress monitoring. Minimal genotype-specific variation suggests that observed spectral and metabolic responses were driven primarily by environmental factors, likely reflecting limited genetic diversity among the commercial Populus genotypes examined. This work establishes VNIR+SWIR hyperspectral imaging as a powerful, non-destructive phenotyping tool for precision monitoring and targeted improvement of drought resilience in bioenergy crops.

Biochemical trait prediction↗
DOE OSTI2024

Perturbation of tonoplast sucrose transport alters carbohydrate utilization for seasonal growth and defense metabolism in coppiced poplar

Abstract Nonstructural carbohydrate reserves of stems and roots underpin overall tree fitness and productivity under short-rotation management practices such as coppicing for bioenergy. While sucrose and starch comprise the predominant stem carbohydrate reserves of Populus, utilization for fitness and agricultural productivity is understood primarily in terms of starch turnover. The tonoplast sucrose transport protein SUT4 modulates sucrose export from source leaves to distant sinks during photoautotrophic growth, but the possibility of its involvement in remobilizing carbohydrates from storage organs during heterotrophic growth has not been explored. Here, we used PtaSUT4-knockout mutants of Populus tremula × P. alba (INRA 717-1B4) in winter (cool) and summer (warm) glasshouse coppicing experiments to assess SUT4 involvement in reserve utilization. Conditions preceding and supporting summer sprouting were considered favorable for growth, while those preceding and supporting cool temperature sprouting were suboptimal akin to conditions associated with coppicing as generally practiced. Epicormic bud emergence was delayed in sut4 mutants following lower temperature ‘winter’ but not summer coppicing. Winter xylem hexose increases were observed in control but not in sut4 stumps after coppicing. The magnitude of starch and sucrose reserve depletion was similar in control and sut4 stumps during the winter and did not explain the sprouting and xylem hexose differences. However, winter maintenance costs appeared higher in sut4 based partly on Krebs cycle intermediate levels. In control plants, bark accrual of abundant defense metabolites, including salicinoids and condensed tannins, was higher in summer than in winter, but this increase of summer defense allocations was attenuated in sut4 mutants. Temperature-sensitive trade-offs between growth and other priorities may therefore depend on SUT4 in Populus.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Overexpression of plasma membrane SUT1 in poplar alters lateral sucrose partitioning in stem and promotes leaf necrosis

Abstract In Populus and many other tree species, photoassimilate sucrose diffuses down a concentration gradient via symplastically connected mesophyll cells to minor vein phloem for long‐distance transport. There is no evidence for apoplastic phloem‐loading in Populus . However, plasma membrane sucrose transporters (SUT1 and SUT3) orthologous to those associated with apoplastic phloem loading are expressed in vascular tissues of poplar. While SUT3 functions in sucrose import into developing xylem, the role of SUT1 remains unclear. Here, we overexpressed PtaSUT1 in Populus tremula x P. alba to examine the effects on sucrose partitioning in transgenic plants. Overall leaf sucrose levels were similar between wild type and transgenic lines. Stem sucrose levels were not changed in bark but were significantly reduced in the adjacent xylem, suggesting hindered intercellular sucrose trafficking from the phloem to the developing xylem. Fully expanded leaves of transgenic plants deteriorated prematurely with declining photosynthesis prior to severe necrotic spotting. Necrotic spotting advanced most rapidly in the distal portion of mature leaves and was accompanied by sharp hexose increases and sharp sucrose decreases there. Leaf transcriptome profiling and network inference revealed the down‐regulation of copper proteins and elevated expression of copper microRNAs prior to noticeable leaf injury. Our results suggest ectopic expression of PtaSUT1 altered sucrose partitioning in stems with systemic effects on leaf health and copper homeostasis mediated in part by sucrose‐sensitive copper miRNAs.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

p HBMT1, a BAHD-family monolignol acyltransferase, mediates lignin acylation in poplar

Abstract Poplar (Populus) lignin is naturally acylated with p-hydroxybenzoate ester moieties. However, the enzyme(s) involved in the biosynthesis of the monolignol–p-hydroxybenzoates have remained largely unknown. Here, we performed an in vitro screen of the Populus trichocarpa BAHD acyltransferase superfamily (116 genes) using a wheatgerm cell-free translation system and found five enzymes capable of producing monolignol–p-hydroxybenzoates. We then compared the transcript abundance of the five corresponding genes with p-hydroxybenzoate concentrations using naturally occurring unrelated genotypes of P. trichocarpa and revealed a positive correlation between the expression of p-hydroxybenzoyl-CoA monolig-nol transferase (pHBMT1, Potri.001G448000) and p-hydroxybenzoate levels. To test whether pHBMT1 is responsible for the biosynthesis of monolignol–p-hydroxybenzoates, we overexpressed pHBMT1 in hybrid poplar (Populus alba × P. grandidentata) (35S::pHBMT1 and C4H::pHBMT1). Using three complementary analytical methods, we showed that there was an increase in soluble monolignol–p-hydroxybenzoates and cell-wall-bound monolignol–p-hydroxybenzoates in the poplar transgenics. As these pendent groups are ester-linked, saponification releases p-hydroxybenzoate, a precursor to parabens that are used in pharmaceuticals and cosmetics. This identified gene could therefore be used to engineer lignocellulosic biomass with increased value for emerging biorefinery strategies.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

A Viable New Strategy for the Discovery of Peptide Proteolytic Cleavage Products in Plant-Microbe Interactions

Small peptides that are proteolytic cleavage products (PCPs) of less than 100 amino acids are emerging as key signaling molecules that mediate cell-to-cell communication and biological processes that occur between and within plants, fungi, and bacteria. Yet, the discovery and characterization of these molecules is largely overlooked. Today, selective enrichment and subsequent characterization by mass spectrometry–based sequencing offers the greatest potential for their comprehensive characterization, however qualitative and quantitative performance metrics are rarely captured. Herein, we addressed this need by benchmarking the performance of an enrichment strategy, optimized specifically for small PCPs, using state-of-the-art de novo–assisted peptide sequencing. As a case study, we implemented this approach to identify PCPs from different root and foliar tissues of the hybrid poplar Populus × canescens 717-1B4 in interaction with the ectomycorrhizal basidiomycete Laccaria bicolor . In total, we identified 1,660 and 2,870 Populus and L. bicolor unique PCPs, respectively. Qualitative results supported the identification of well-known PCPs, like the mature form of the photosystem II complex 5-kDa protein (approximately 3 kDa). A total of 157 PCPs were determined to be significantly more abundant in root tips with established ectomycorrhiza when compared with root tips without established ectomycorrhiza and extramatrical mycelium of L. bicolor . These PCPs mapped to 64 Populus proteins and 69 L. bicolor proteins in our database, with several of them previously implicated in biologically relevant associations between plant and fungus.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Kraken2 Metagenomic Virus Database

The Database: Kraken2 [1] database built from a classification tree containing over 700k metagenomic viruses from JGI IMG/VR [2]. (1) Wood, D. E., Lu, J., and Langmead, B. (2019). Improved metagenomic analysis with Kraken 2. Genome Biol., 20(1), 1–13. doi: 10.1186/s13059-019-1891-0 (2) Paez-Espino D, Chen I-MA, Palaniappan K, Ratner A, Chu K, Szeto E, et al. IMG/VR: a database of cultured and uncultured DNA Viruses and retroviruses. Nucleic Acids Res. 2017;45:D457-65. For Paper: Title: A k-mer based approach for virus classification in metatranscriptomic and metagenomic samples identifies viral associations in the Populus phytobiome and autism brains Abstract Background Viruses are an underrepresented taxa in the study and identification of microbiome constituents; however, they play an important role in health, microbiome regulation, and transfer of genetic material. Only a few thousand viruses have been isolated, sequenced, and assigned a taxonomy, which further limits the ability to identify and quantify viruses in the microbiome. Additionally, the vast diversity of viruses represents a challenge for classification, not only in constructing a viral taxonomy, but also in identifying similarities between a virus' genotype and its phenotype. However, the diversity of viral sequences can be leveraged to classify their sequences in metagenomic and metatranscriptomic samples. Methods To identify viruses in transcriptomic and genomic samples, we developed a dynamic programming algorithm for creating a classification tree out of 715,672 metagenome viruses. To create the classification tree, we clustered proportional similarity scores generated from the k-mer profiles of each of the metagenome viruses. We then integrated the viral classification tree with the NCBI taxonomy for use with ParaKraken, a metagenomic/transcriptomic classifier. Results To illustrate the breadth of our utility for classifying viruses with ParaKraken, we analyzed data from a plant metagenome study identifying the differences between two Populus genotypes in three different compartments and on a human metatranscriptome study identifying the differences between Autism Spectrum Disorder patients and controls in post mortem brain biopsies. In the Populus study, we identified genotype and compartment specific viral signatures, while in the Autism study we identified a significant increased abundance of eight viral sequences in Autism brain biopsies. Conclusion Viruses represent an important aspect of the microbiome. The ability to classify viruses represents the first step in being able to better understand their role in the microbiome. The viral classification method presented here allows for more complete identification of viral sequences for use in identifying associations between viruses and the host and viruses and other microbiome members. Acknowledgements and Funding This research used resources of the Oak Ridge Leadership Computing Facility at the Oak Ridge National Laboratory, which is supported by the Office of Science of the U.S. Department of Energy under Contract No. DE-AC05-00OR22725. This research was also supported by the Plant-Microbe Interfaces Scientific Focus Area in the Genomic Science Program, the Office of Biological and Environmental Research (BER) in the U.S. Department of Energy Office of Science, and by the Department of Energy, Laboratory Directed Research and Development funding (ProjectID 8321), at the Oak Ridge National Laboratory. Oak Ridge National Laboratory is managed by UT-Battelle, LLC, for the US DOE under contract DE-AC05-00OR22725. This research used resources of the Compute and Data Environment for Science (CADES).

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

Hyaloscypha finlandica Metabolome Repository

This repository provides the curated data tables, manuscript figure and table exports, dependency records, and workflow scripts supporting an integrated comparative genomics and untargeted LC-MS/MS metabolomics analysis of Hyaloscypha finlandica strain PMI 746, a root-associated dark septate endophyte of poplar. The repository includes genome-mining summaries from antiSMASH, FunBGCeX, BGC-Prophet, and BiG-SCAPE; processed metabolomics inputs; metabolite annotation evidence; statistical outputs; and publication-facing figures and tables. Raw LC-MS/MS spectra, full genome/protein downloads, and large generated tool outputs are referenced through public archive/accession records and are not stored in Git.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Tonoplast Sucrose Transporter SUT4-Dependent Sugar Partitioning Modulates Phenological Transitions and Reproductive Success in Poplar

Climate uncertainty is intensifying the need for greater plasticity in carbohydrate reserve utilization to support winter survival and spring growth in woody perennials. In poplar, the single-copy SUT4, which encodes a tonoplast-localized sucrose transporter, and the SUT5/SUT6 genome duplicates, which encode plasma membrane-localized transporters, are expressed year-round, with SUT4 showing the highest expression during cool seasons. Given its role in vacuolar sucrose efflux and winter-predominant expression, SUT4 may play a key role in modulating seasonal carbohydrate dynamics. While SUT4-knockdown and knockout effects have been studied under greenhouse conditions, their impact under field conditions remains unexplored. Here, we report a field-based study comparing CRISPR knockout mutants of winter-expressed SUT4 and SUT5/SUT6 in Populus tremula x alba. We show that sut4, but not sut5/6, mutants exhibited earlier autumn leaf senescence, delayed spring bud flush, reduced stem growth, and altered sugar partitioning in winter xylem and bark relative to controls. After 2 years in the field, all genotypes flowered before leaf flush in early spring; however, sut4 mutants produced sterile ovules despite developing normal-looking catkins. Metabolic profiling revealed disrupted sucrose and raffinose dynamics in elongating sut4 catkins. This was accompanied by transcriptomic signatures of elevated stress and downregulation of proanthocyanidin biosynthesis and circadian clock genes. These findings highlight the critical role of SUT4 in coordinating sugar allocation, stress responses, and seasonal development in poplar.

09 BIOMASS FUELS↗
DOE OSTI2026

Pre- and post-coppice production and biomass chemistry of eastern cottonwood and hybrid poplars in the southeastern US

Sustainably grown feedstocks for bioenergy and bioproducts are important tools to fight climate change, provide ecosystem services, and sequester carbon. Populus species including hybrid poplars have been utilized around the world, and in the southeastern US native eastern cottonwood (P. deltoides) is often favored due to its resistance to stem cankers. However, P. deltoides has historically been grown in single stem production and its relative performance in short rotation coppice production, prevalent in Europe, is not well documented. Therefore, this study's goals were to evaluate eastern cottonwood (D × D) and hybrid poplar (P. deltoides × P. maximowiczii (D × M) and P. deltoides × P. trichocarpa (D × T) taxa) productivity under a two-year establishment and two-year coppice cycle, analyze biomass chemistry properties, identify drivers of productivity, and select clones suited for marginal vs. optimal sites. We found that D × M and D × D grew best in both establishment and coppice rotation with production increasing after coppice. Taxa and clones exhibited few differences in select biomass chemistry properties despite differences in growth rate and stem size. Across years and sites, production was correlated with the soil's carbon to nitrogen ratio, percentage of sand, and shrink-swell potential of the soil. A D × M clone ‘9709’ tended to perform better than other tested clones on marginal sites and had the highest survival rate after four years. Overall, this research suggests that Populus species can be grown in coppice rotation in the southeastern US with the potential for hybrid poplars to be successful on certain sites in the region although longer term studies are necessary to confirm these results.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

Sap Velocity Data for East River Watershed Sites (2023-2025)

This dataset includes sap velocity measurements for aspen (populus tremuloides), fir (abies lasiocarpa), spruce (Engelmann spruce) and lodgepole pine (pinus contorta) trees at nine sites in the East River Watershed near Gothic, CO. This dataset was generated following a similar method as a previous dataset (Dataset. doi:10.15485/1647654) but was conducted at different sites in the area and now includes lodgepole pine. Site selection was done to explicitly improve understanding of topographic controls of tree water use. The data collection began in June 2023 and we provide data until December 2025 - though data collection is ongoing. The sap flux data were collected using ICT SFM1 sensors and are presented in both units of cm h^-1 and as kg h^-1 by multiplying the sap flux by the sapwood area of the tree. All sap flow data has been been corrected using estimates of wounding diameter, water content of wood and sap wood depth. We also provide a normalized sap velocity estimate by subtracting each measurement from that trees' annual minimum and dividing by that trees' annual maximum. This provides data for each tree and year on a 0-1 scale. This data entry contains one CSV file that includes all available sap flow data. The timestamps are provided in local time as year, day of year and hour and each measurement contains an associated latitude, longitude and site number which can be used to identify trees in a given stand. Each species is given a numeric value as: 1= populus tremuloides, 2=Engelmann spruce, 3=abies lasiocarpa and 4=pinus contorta.

abies↗
DOE OSTI2023

Nitrogen addition alters soil fungal communities, but root fungal communities are resistant to change

Plants are colonized by numerous microorganisms serving important symbiotic functions that are vital to plant growth and success. Understanding and harnessing these interactions will be useful in both managed and natural ecosystems faced with global change, but it is still unclear how variation in environmental conditions and soils influence the trajectory of these interactions. In this study, we examine how nitrogen addition alters plant-fungal interactions within two species of Populus - Populus deltoides and P. trichocarpa. In this experiment, we manipulated plant host, starting soil (native vs. away for each tree species), and nitrogen addition in a fully factorial replicated design. After ~10 weeks of growth, we destructively harvested the plants and characterized plant growth factors and the soil and root endosphere fungal communities using targeted amplicon sequencing of the ITS2 gene region. Overall, we found nitrogen addition altered plant growth factors, e.g., plant height, chlorophyll density, and plant N content. Interestingly, nitrogen addition resulted in a lower fungal alpha diversity in soils but not plant roots. Further, there was an interactive effect of tree species, soil origin, and nitrogen addition on soil fungal community composition. Starting soils collected from Oregon and West Virginia were dominated by the ectomycorrhizal fungi Inocybe (55.8% relative abundance), but interestingly when P. deltoides was grown in its native West Virginia soil, the roots selected for a high abundance of the arbuscular mycorrhizal fungi, Rhizophagus. These results highlight the importance of soil origin and plant species on establishing plant-fungal interactions.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Insights of Molecular Mechanism of Xylem Development in Five Black Poplar Cultivars

Black poplar (Populus deltoides, P. nigra, and their hybrids) is the main poplar cultivars in China. It offers interesting options of large-scale biomass production for bioenergy due to its rapid growth and high yield. Poplar wood properties were associated with chemical components and physical structures during wood formation. In this study, five poplar cultivars, P. euramericana ‘Zhonglin46’ (Pe1), P. euramericana ‘Guariento’ (Pe2), P. nigra ‘N179’ (Pn1), P. deltoides ‘Danhong’ (Pd1), and P. deltoides ‘Nanyang’ (Pd2), were used to explore the molecular mechanism of xylem development. We analyzed the structural differences of developing xylem in the five cultivars and profiled the transcriptome-wide gene expression patterns through RNA sequencing. The cross sections of the developing xylem showed that the cell wall thickness of developed fiber in Pd1 was thickest and the number of xylem vessels of Pn1 was the least. A total of 10,331 differentially expressed genes were identified among 10 pairwise comparisons of the five cultivars, most of them were related to programmed cell death and secondary cell wall thickening. K-means cluster analysis and Gene Ontology enrichment analysis showed that the genes highly expressed in Pd1 were related to nucleotide decomposition, metabolic process, transferase, and microtubule cytoskeleton; whereas the genes highly expressed in Pn1 were involved in cell wall macromolecule decomposition and polysaccharide binding processes. Based on a weighted gene co-expression network analysis, a large number of candidate regulators for xylem development were identified. And their potential regulatory roles to cell wall biosynthesis genes were validated by a transient overexpression system. This study provides a set of promising candidate regulators for genetic engineering to improve feedstock and enhance biofuel conversion in the bioenergy crop Populus.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

A multi-omic survey of black cottonwood tissues highlights coordinated transcriptomic and metabolomic mechanisms for plant adaptation to phosphorus deficiency

Phosphorus (P) deficiency in plants creates a variety of metabolic perturbations that decrease photosynthesis and growth. Phosphorus deficiency is especially challenging for the production of bioenergy feedstock plantation species, such as poplars (Populus spp.), where fertilization may not be practically or economically feasible. While the phenotypic effects of P deficiency are well known, the molecular mechanisms underlying whole-plant and tissue-specific responses to P deficiency, and in particular the responses of commercially valuable hardwoods, are less studied. We used a multi-tissue and multi-omics approach using transcriptomic, proteomic, and metabolomic analyses of the leaves and roots of black cottonwood (Populus trichocarpa) seedlings grown under P-deficient (5 µM P) and replete (100 µM P) conditions to assess this knowledge gap and to identify potential gene targets for selection for P efficiency. In comparison to seedlings grown at 100 µM P, P-deficient seedlings exhibited reduced dry biomass, altered chlorophyll fluorescence, and reduced tissue P concentrations. In line with these observations, growth, C metabolism, and photosynthesis pathways were downregulated in the transcriptome of the P-deficient plants. Additionally, we found evidence of strong lipid remodeling in the leaves. Metabolomic data showed that the roots of P-deficient plants had a greater relative abundance of phosphate ion, which may reflect extensive degradation of P-rich metabolites in plants exposed to long-term P-deficiency. With the notable exception of the KEGG pathway for Starch and Sucrose Metabolism (map00500), the responses of the transcriptome and the metabolome to P deficiency were consistent with one another. No significant changes in the proteome were detected in response to P deficiency. Collectively, our multi-omic and multi-tissue approach enabled the identification of important metabolic and regulatory pathways regulated across tissues at the molecular level that will be important avenues to further evaluate for P efficiency. These included stress-mediating systems associated with reactive oxygen species maintenance, lipid remodeling within tissues, and systems involved in P scavenging from the rhizosphere.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Eucalyptus grandis $\mathrm{AUX/INDOLE}$-3-$\mathrm{ACETIC}$ $\mathrm{ACID}$ 13 (EgrIAA13) is a novel transcriptional regulator of xylogenesis

Auxin is a crucial phytohormone regulating multiple aspects of plant growth and differentiation, including regulation of vascular cambium activity, xylogenesis and its responsiveness towards gravitropic stress. Although the regulation of these biological processes greatly depends on auxin and regulators of the auxin signalling pathway, many of their specific functions remain unclear. Therefore, the present study aims to functionally characterise Eucalyptus grandis AUX/INDOLE-3-ACETIC ACID 13 (EgrIAA13), a member of the auxin signalling pathway. In Eucalyptus and Populus, EgrIAA13 and its orthologs are preferentially expressed in the xylogenic tissues and downregulated in tension wood. Therefore, to further investigate EgrIAA13 and its function during xylogenesis, we conducted subcellular localisation and Induced Somatic Sector Analysis experiments using overexpression and RNAi knockdown constructs of EgrIAA13 to create transgenic tissue sectors on growing stems of Eucalyptus and Populus. Since Aux/IAAs interact with Auxin Responsive Factors (ARFs), in silico predictions of IAA13-ARF interactions were explored and experimentally validated via yeast-2-hybrid experiments. Our results demonstrate that EgrIAA13 localises to the nucleus and that downregulation of EgrIAA13 impedes Eucalyptus xylem fibre and vessel development. We also observed that EgrIAA13 interacts with Eucalyptus ARF2, ARF5, ARF6 and ARF19A. Based on these results, we conclude that EgrIAA13 is a regulator of Eucalyptus xylogenesis and postulate that the observed phenotypes are likely to result from alterations in the auxin-responsive transcriptome via IAA13-ARF modules such as EgrIAA13-EgrARF5. Our results provide the first insights into the regulatory role of EgrIAA13 during xylogenesis.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

An orphan gene BOOSTER enhances photosynthetic efficiency and plant productivity

Organelle-to-nucleus DNA transfer is an ongoing process playing an important role in the evolution of eukaryotic life. Here, genome-wide association studies (GWAS) of non-photochemical quenching parameters in 743 Populus trichocarpa accessions identified a nuclear-encoded genomic region associated with variation in photosynthesis under fluctuating light. The identified gene, BOOSTER (BSTR), comprises three exons, two with apparent endophytic origin and the third containing a large fragment of plastid-encoded Rubisco large subunit. Higher expression of BSTR facilitated anterograde signaling between nucleus and plastid, which corresponded to enhanced expression of Rubisco, increased photosynthesis, and up to 35% greater plant height and 88% biomass in poplar accessions under field conditions. Overexpression of BSTR in Populus tremula × P. alba achieved up to a 200% in plant height. Similarly, Arabidopsis plants heterologously expressing BSTR gained up to 200% in biomass and up to 50% increase in seed.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2020

The mutualism effector MiSSP7 of Laccaria bicolor alters the interactions between the poplar JAZ6 protein and its associated proteins

Despite the pivotal role of jasmonic acid in the outcome of plant-microorganism interactions, JA-signaling components in roots of perennial trees like western balsam poplar (Populus trichocarpa) are poorly characterized. Here we decipher the poplar-root JA-perception complex centered on PtJAZ6, a co-repressor of JA-signaling targeted by the effector protein MiSSP7 from the ectomycorrhizal basidiomycete Laccaria bicolor during symbiotic development. Through protein–protein interaction studies in yeast we determined the poplar root proteins interacting with PtJAZ6. Moreover, we assessed via yeast triple-hybrid how the mutualistic effector MiSSP7 reshapes the association between PtJAZ6 and its partner proteins. In the absence of the symbiotic effector, PtJAZ6 interacts with the transcription factors PtMYC2s and PtJAM1.1. In addition, PtJAZ6 interacts with it-self and with other Populus JAZ proteins. Finally, MiSSP7 strengthens the binding of PtJAZ6 to PtMYC2.1 and antagonizes PtJAZ6 homo-/heterodimerization. We conclude that a symbiotic effector secreted by a mutualistic fungus may promote the symbiotic interaction through altered dynamics of a JA-signaling-associated protein–protein interaction network, maintaining the repression of PtMYC2.1-regulated genes.

59 BASIC BIOLOGICAL SCIENCES↗