Search NASA⌕ Search

SEARCH · Search NASA

Results for “SPECIFICITY”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 217 records · Page 12
All sourcesNASA NTRSDOE OSTI
NASA NTRS1972

Social impact evaluation : Some implications of the specific decisional context approach for anticipatory project assessment with special reference to available alternatives and to techniques of evaluating the social impacts of the anticipated effects of such alternatives

The implications are explored of the specific decision context approach to anticipatory project assessment. More specifically, it is hypothesized that with respect to any given effect of a proposed project or action (mobility, job opportunities, air pollution, population distribution, etc.) such effect will likely differ in probability and/or magnitude from one decisional context to another; that the social desirability or undesirability of a given effect is a function (will differ with) each specific decisional context; that therefore the social impact of such effect will in all likelihood differ with each specific decisional context; and that the social significance of even the dame social impact of a given effect will vary from one decisional context to another when such social impact interacts with (competes with or reinforces) the social impacts of other effects. It also follows from this analysis that the respective roles of scientific method (demonstrable data) and adversarial system will not only differ with each specific decisional context but with each alternative course of action available to the decisional entity in each specific context.

Mayo, L. H.↗
NASA NTRS1983

The Hierarchical Specification and Mechanical Verification of the SIFT Design

The formal specification and proof methodology employed to demonstrate that the SIFT computer system meets its requirements are described. The hierarchy of design specifications is shown, from very abstract descriptions of system function down to the implementation. The most abstract design specifications are simple and easy to understand, almost all details of the realization were abstracted out, and are used to ensure that the system functions reliably and as intended. A succession of lower level specifications refines these specifications into more detailed, and more complex, views of the system design, culminating in the Pascal implementation. The section describes the rigorous mechanical proof that the abstract specifications are satisfied by the actual implementation.

Source record↗
NASA NTRS1991

Report on the formal specification and partial verification of the VIPER microprocessor

The VIPER microprocessor chip is partitioned into four levels of abstractions. At the highest level, VIPER is described with decreasingly abstract sets of functions in LCF-LSM. At the lowest level are the gate-level models in proprietary CAD languages. The block-level and gate-level specifications are also given in the ELLA simulation language. Among VIPER's deficiencies are the fact that there is no notion of external events in the top-level specification, and it is impossible to use the top-level specifications to prove abstract properties of programs running on VIPER computers. There is no complete proof that the gate-level specifications implement the top-level specifications. Cohn's proof that the major-state machine correctly implements the top-level specifications has no formal connection with any of the other proof attempts. None of the latter address resetting the machine, memory timeout, forced error, or single step modes.

Brock, Bishop↗
NASA NTRS2012

mREST Interface Specification

mREST is an implementation of the REST architecture specific to the management and sharing of data in a system of logical elements. The purpose of this document is to clearly define the mREST interface protocol. The interface protocol covers all of the interaction between mREST clients and mREST servers. System-level requirements are not specifically addressed. In an mREST system, there are typically some backend interfaces between a Logical System Element (LSE) and the associated hardware/software system. For example, a network camera LSE would have a backend interface to the camera itself. These interfaces are specific to each type of LSE and are not covered in this document. There are also frontend interfaces that may exist in certain mREST manager applications. For example, an electronic procedure execution application may have a specialized interface for configuring the procedures. This interface would be application specific and outside of this document scope. mREST is intended to be a generic protocol which can be used in a wide variety of applications. A few scenarios are discussed to provide additional clarity but, in general, application-specific implementations of mREST are not specifically addressed. In short, this document is intended to provide all of the information necessary for an application developer to create mREST interface agents. This includes both mREST clients (mREST manager applications) and mREST servers (logical system elements, or LSEs).

McCartney, Patrick↗
DOE OSTI2018

Assessment and Use of State-Specific Factors in the Implementation of Safeguards

The use of safeguards-relevant features and characteristics of a State in the implementation of safeguards has been a long-standing practice of the International Atomic Energy Agency (IAEA). These ‘State-specific factors’ can affect the development of State-level safeguards approaches and the planning, conduct and evaluation of safeguards activities. The IAEA has identified six State-specific factors for systematic consideration and use in the application of the State-level concept. These factors are: (i) the type of safeguards agreement in force for the State and the nature of the safeguards conclusion drawn by the IAEA; (ii) the nuclear fuel cycle and related technical capabilities of the State; (iii) the technical capabilities of the State or regional system of accounting for and control of nuclear material; (iv) the ability of the IAEA to implement certain safeguards measures in the State; (v) the nature and scope of cooperation between the State and the IAEA in the implementation of safeguards; and (vi) the IAEA’s experience in implementing safeguards in the State. State-specific factors are not to be used for rating or grading a State’s safeguards credentials but to identify issues that could affect the effectiveness or efficiency of safeguards implementation for the State. IAEA reports and presentations on the State-level concept have described these factors and have given examples of information that could be considered in assessing each factor. This paper expands upon the IAEA examples and makes recommendations as to how State-specific factors could be assessed by the IAEA and how these factors might affect safeguards implementation. Although quantitative metrics were considered for assessing the State-specific factors, it was determined that the general State characteristics comprising the factors cannot be meaningfully quantified; however, performance indicators can be developed for some elements comprising some factors. The paper thus discusses ‘considerations’ that the IAEA should assess with respect to the State-specific factors (iii), (v), and (vi) and how those considerations could affect safeguards implementation.

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2019

PNNL Report: New Study Validates Color-Rendition Specification Criteria Based on TM-30

Pacific Northwest National Laboratory (PNNL) has released the results of a study – published in Lighting Research & Technology – that validates color-preference specification criteria based on ANSI/IES TM-30-18. The result provides additional data to support TM-30 Annex E (in press), which will include tiers of recommended specification criteria for different goals (color preference, color vividness, and color fidelity), among other information related to color rendition specification. Standardized methods for evaluating the color rendition of light sources have progressed rapidly in the past five years, beginning with the publication of IES TM-30-15, followed by the adoption of CIE 224:2017, and culminating with the issuance of ANSI/IES TM-30-18 (which revised TM-30-15, made it a national standard, and unified the calculation framework of CIE 224 and IES TM-30). Importantly, none of these documents provided guidance on how to specify color rendition using the included measures; that is, no value or combination of values was identified that leads to any desired quality of the light. Dozens of experiments over the past 60 years have examined subjective evaluations of color quality—such as preference, naturalness, or vividness—although the focus has traditionally been on developing a single-number color quality metric rather than specification criteria. Further, many of these pre-LED and pre-TM-30 studies were limited in their ability to vary the lighting characteristics, preventing them from generating a complete and accurate picture of what influences color rendering quality in architectural spaces. A renewed emphasis in this area of research over the past four years has yielded a growing consensus about how measures of color fidelity (Rf), gamut area (Rg), and red chroma (Rcs,h1) can be used in combination to effectively describe several important perceptual attributes. In the new study, which was the third in a series conducted at PNNL, 90 lighting conditions with systematically varied color rendition and chromaticity were evaluated by 25 participants, who provided ratings for normalness, saturation, preference, and acceptability. The lighting conditions were specifically designed to test the bounds of previously proposed color preference criteria, while simultaneously verifying the applicability of the criteria across different values of CCT and Duv. In line with the preceding work, there were substantial differences in ratings based on color rendition, but minimal differences based on chromaticity. The tested criteria performed well, although after the experiment, some small adjustments in lower limits provided more effective divisions between tiers of performance. The adjusted criteria are: • Level 1: Rf = 78, Rg = 95, -1% = Rcs,h1 = 15% • Level 2: Rf = 74, Rg = 92, -7% = Rcs,h1 = 19% • Level 3: Rf = 70, Rg = 89, -12% = Rcs,h1 = 23%. These criteria were concurrently checked against the results from other, independent experiments, and will be included in ANSI/IES TM-30 Annex E as the specifications for color preference. The new criteria will be a valuable tool for improving lighting quality and balancing the tradeoff between color rendition and energy efficiency.

Royer, Michael P.↗
DOE OSTI2019

Selection and characterization of FcεRI phospho-ITAM specific antibodies

Post-translational modifications, such as the phosphorylation of tyrosines, are often the initiation step for intracellular signaling cascades. Pan-reactive antibodies against modified amino acids (e.g., anti-phosphotyrosine), which are often used to assay these changes, require isolation of the specific protein prior to analysis and do not identify the specific residue that has been modified (in the case that multiple amino acids have been modified). Phosphorylation state-specific antibodies (PSSAs) developed to recognize post-translational modifications within a specific amino acid sequence can be used to study the timeline of modifications during a signal cascade. We utilized the FcεRI receptor as a model system to develop and characterize high-affinity PSSAs using phage and yeast display technologies. We determined three β-subunit antibodies that recognized: 1) phosphorylation of tyrosines Y 218 or Y 224 ; 2) phosphorylation of the Y 228 tyrosine; and 3) phosphorylation of all three tyrosines. We used these antibodies to study the receptor activation timeline of FcεR1 in rat basophilic leukemia cells (RBL-2H3) upon stimulation with DNP 24 -BSA. We also selected an antibody recognizing the N-terminal phosphorylation site of the γ-subunit (Y 65 ) of the receptor and applied this antibody to evaluate receptor activation. Recognition patterns of these antibodies show different timelines for phosphorylation of tyrosines in both β and γ subunits. Our methodology provides a strategy to select antibodies specific to post-translational modifications and provides new reagents to study mast cell activation by the high-affinity IgE receptor, FcεRI.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

3D Printed eutectic aluminum alloy has facility for site-specific properties

Additive manufacturing (AM) has the ability to print structures with site-specific properties. Existing AM approaches for site-specific properties are, however, based on complex processing-microstructure relationships in conventional alloys that were not designed for this purpose. Here, in this work, we report a straightforward approach for achieving site-specific properties that takes advantage of eutectic solidification characteristics. We demonstrate that the yield strength of a eutectic Al-Cu-Ce-Zr alloy can be tuned by varying the laser scan speed in concert with hatch spacing in laser powder bed fusion AM. A faster speed increases solidification rate resulting in finer eutectic spacing and higher strength. The hatch spacing is reduced at faster speeds to ensure overlap between melt pools which become smaller with increasing scan speed. The yield strength and its anisotropy relative to build direction are further tunable with a heat treatment. The scan speed-eutectic spacing-strength relationship is successfully applied to print a complex pattern of site-specific hardness in the alloy. The generalized principle of using AM for a eutectic alloy to create site-specific properties and anisotropy in properties is demonstrated.

36 MATERIALS SCIENCE↗
DOE OSTI2026

Novel Cell-Type-Specific Drought-Responsive Proteins in Root Tips of Field-Grown Perennial Switchgrass

The root-tip region of plants, including the root cap, forms the most basal terminal of the root and exhibits a high degree of cellular complexity in terms of morphology, cytological function, and interaction with environmental cues in the soil. Cells in this region follow a developmental trajectory, transitioning from stem cells to meristematic cells, and ultimately to fully differentiated cell types. However, our understanding of root-tip cell-type specific proteomic responses to abiotic stresses, such as drought, particularly under field conditions, remains limited. This study aimed to identify spatially resolved, cell type-specific proteomes in switchgrass (Panicum virgatum) root tips under drought stress. Root tips were collected from seven-year-old, field-grown switchgrass ‘Alamo’ plants excavated under both well-watered and long-term drought conditions. Cell type-specific proteins were identified using laser capture microdissection (LCM) coupled with nanoPOTS (Nanodroplet Processing in One Pot for Trace Samples) and nano-LC-MS proteomics analysis. Five distinct cell types were targeted: (1) cells in the quiescent center and stem cell niche (QuC), (2) protodermal epidermal cells (PEC) in the meristematic zone, (3) epidermal cells in the transition and elongation zones above the root cap (Epi), (4) peripheral root cap cells (PRC), forming 2–3 layers below the PEC and 1–2 layers above the root border cells, and (5) columella root cap cells (Col) comprising of the columella initials and a single underlying layer of cells undergoing active growth. Principal component analysis (PCA) revealed clear separation among the five targeted cell types, confirming distinct proteomic profiles. Proteins predominantly enriched in each cell type were linked to distinct cellular functions, with QuC cells showing involvement in chromosomal behavior, DNA replication, and mitosis—key processes for stem cell niche regulation. Drought stress resulted in alterations of proteostasis, as evidenced by significant decreases in ribosomal proteins and increases in protein synthesis inhibitors. Moreover, drought stress induced unique cell-type–specific proteins involved in phytohormone biosynthesis and signaling pathways, including auxin, cytokinin, and jasmonic acid. In particular, QuC cells were more highly enriched in proteins associated with DNA repair and mitotic processes. Metabolic pathways related to amino acids, carbohydrates, and lipids were differentially affected in a cell-type–dependent manner, whereas general stress-responsive proteins exhibited consistent changes across all five cell types. Overall, this study provides unique spatially resolved, cell-type-specific proteomic profiles in root tips, representing a significant advancement in our understanding of the cellular mechanisms underlying plant responses to drought stress in natural field conditions.

perennial grass↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Design Basis Document / Owner’s Technical Specification for Nitrate Salt Systems in CSP Projects (Final Technical Report)

The number of commercial coal, gas, and nuclear projects built over the past 100 years number in the thousands. As such, there is a large database, available to a wide range of commercial engineering contractors, on proven designs. In essence, unsuccessful designs have, through generations of iterations, been identified and then deleted from further consideration. In contrast, the number of commercial parabolic trough projects using nitrate salt for the thermal storage media is perhaps 60. Further, the number of commercial central receiver projects using nitrate salt as the working fluid is on the order of 20, including estimates for China. Given the relative immaturity of salt technology, and commercial pressures to successfully bid new solar projects into a mature electricity market, solar projects often promise more than has been delivered. The Design Basis Document / Owner’s Technical Specification is a first step in the iteration process. The report describes the successful features of commercial projects, outlines a range equipment and system failures in projects that didn’t operate as intended, and provides a draft set of design changes intended to correct the known problems. The product of the study is 3 volumes of technical material; one volume is on parabolic trough technologies; a second is on central receiver technologies, and the third is on potential design changes to parabolic trough and central receiver projects. The 3 volumes, which total some 590 pages, can be found at https://www.solardynllc.com/csp-plant-technologies. One of the principal topics in the report is the use of functional or prescriptive specifications. Functional specifications describe what the equipment needs to do, consistent with the minimum legal requirements of the local jurisdictions. The details of how this is to be accomplished is developed by the engineering contractor. Prescriptive specifications, which are developed by the Owner, prescribe to the engineering contractor how the functional requirements are to be met. This arrangement ensures that the favorable experience from a previous project is repeated. One example is the design code for the hot salt tank in central receiver projects. The closest design basis is API Standard 650 Welded Steel Tanks for Oil Storage. However, the maximum design temperature in API 650 is 260 °C. As such, solar projects have typically adopted a hybrid Code approach, in which allowable material stresses are taken from ASME Section II Materials. Further, since the tanks experience daily changes in temperature and in (static) pressure, and since portions of the tank can operate at stresses beyond the elastic range, the low cycle fatigue life of the tank is conducted using the rules of Section VIII Division 2. However, in a recent study by NREL, the principal damage mechanism was identified as creep rather than fatigue. Further, design stresses permitted under Section VIII Division 2, corresponding to a fatigue life of 30 years, result in projected creep lifetimes of only 2 to 5 years. An alternate design approach, prescribed by the Owner, would be based on Code sections intended for high temperature service in the creep regime. A candidate is Section III Division 5. Granted, this is a nuclear code section, and it’s use would not likely be mandated by local jurisdictions. However, the effects of creep have been deemed to be of sufficient importance that one nuclear project developer, and one central receiver project developer, have stipulated in the tank design specification that the equipment be designed to the requirements of Section III Division 5.

14 SOLAR ENERGY↗
DOE OSTI2022

Removal of Non-Specifically Bound Proteins Using Rayleigh Waves Generated on ST-Quartz Substrates

Label-free biosensors are plagued by the issue of non-specific protein binding which negatively affects sensing parameters such as sensitivity, selectivity, and limit-of-detection. In the current work, we explore the possibility of using the Rayleigh waves in ST-Quartz devices to efficiently remove non-specifically bound proteins via acoustic streaming. A coupled-field finite element (FE) fluid structure interaction (FSI) model of a surface acoustic wave (SAW) device based on ST-Quartz substrate in contact with a liquid loading was first used to predict trends in forces related to SAW-induced acoustic streaming. Based on model predictions, it is found that the computed SAW body force is sufficient to overcome adhesive forces between particles and a surface while lift and drag forces prevent reattachment for a range of SAW frequencies. We further performed experiments to validate the model predictions and observe that the excitation of Rayleigh SAWs removed non-specifically bound (NSB) antigens and antibodies from sensing and non-sensing regions, while rinsing and blocking agents were ineffective. An amplified RF signal applied to the device input disrupted the specific interactions between antigens and their capture antibody as well. ST-quartz allows propagation of Rayleigh and leaky SH-SAW waves in orthogonal directions. Thus, the results reported here could allow integration of three important biosensor functions on a single chip, i.e., removal of non-specific binding, mixing, and sensing in the liquid phase.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2018

Initial Site-Specific Studies for Removing SNF from Six Shutdown Sites - 18042

The US Department of Energy (DOE) is exploring options for developing a large-scale transportation system for the safe transport of spent nuclear fuel (SNF) and high-level radioactive waste to future storage or disposal facilities. This complex, large-scale transportation system will involve coordinated, integrated activities. Interfaces with various transportation and non-transportation activities must be defined, and systems must be developed to ensure successful integration when the system becomes operational. To provide an understanding of the tasks and interfaces required for the complete de-inventory of particular sites where SNF is stored, DOE solicited bids from integrating contractors to develop initial site-specific de-inventory reports. The reports were developed for several nuclear power plant sites selected to represent a range of geographic locations, existing on-site SNF storage systems, and expected transportation modal options. Each report is presented in a self-contained narrative describing a potential campaign for removing all SNF and greater-than-class-C low-level radioactive waste (GTCC waste) from each specified site. Each study narrative includes site information; an analysis of the near-site transportation infrastructure; a concept of operations for the de-inventory; an estimated budget and schedule for the duration of operations; and a safety and security plan with site-specific considerations, emergency response considerations, and recommendations for the next steps DOE could take to de-inventory the site. The reports provide cost estimates for analytical purposes only; they do not attempt to specify the party or parties responsible for the costs. These reports present a first look at how an integrating contractor might recommend removing SNF from particular sites. They are written from the perspective of the contractor and do not represent DOE's plans. At this writing, six sites have been studied: - Connecticut Yankee, - Big Rock Point, - Humboldt Bay, - Maine Yankee, - Trojan, - Kewaunee. DOE may develop de-inventory reports for all reactor sites, with an initial focus on shutdown reactor sites. The order in which sites have been selected for study should not be considered an indicator of the order used by DOE to remove SNF from the sites. Since the SNF's destination is not important for the purpose of this work, DOE tasked the contractor with planning transportation of the SNF from the site to a generic railroad location in the approximate geographical center of the United States. These reports represent an initial study of the specific sites. Per the terms of the contract, the contractor was not permitted to engage in dialogue with power plant site personnel; near-site railroad personnel; or any local, state, or regional stakeholders about the studies. DOE provided site-specific data. The contractor was tasked to rely on past corporate experience, data available from DOE, and publicly available data when making site-specific recommendations for removing all SNF from each site. (authors)

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2023

SPC-2772 Rev 2 General Build to Print Fabrication Specification for Nuclear Use Items

This specification is for use with Safety Significant structures, systems, and components. The scope is for build to print fabrication including, but not limited to, machining, forming, welding, cutting, assembling, etc. Specific scope and associated requirements will be identified in drawings and/or additional procurement documents. ASME B31 fabrication is not included in the scope of this specification. Any conflict between this specification and referenced Codes and Standards, or any supplementary specifications in the procurement documents requires written clarification from the Contractor prior to proceeding with any work. Any deviation from the procurement documents requires approval by the Contractor with the change request process.

21 - SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLAN↗
DOE OSTI2024

SPC-70843 Rev 0 MARVEL Control Drum Actuator Fabrication Specification

Idaho National Laboratory (INL) is developing a microreactor to produce electrical power utilizing a small nuclear core and Stirling engines under the Microreactor Application Research Validation and Evaluation (MARVEL) program. This procurement specification defines the requirements for fabrication of components that make up the control drum (CD) actuators. This specification outlines the requirements for fabrication, acknowledging that specific elements will integrate into final assemblies, while others will be delivered as standalone components. The Subcontractor is not responsible for the CD actuator’s final assembly. Any conflict between this specification and referenced Codes and Standards, or any supplementary specifications in the procurement documents requires written clarification from the Contractor prior to proceeding with any work. Any deviation from the procurement documents requires approval by the Contractor with the change request process.

21 - SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLAN↗
DOE OSTI2023

A promising intersection of excited‐state‐specific methods from quantum chemistry and quantum Monte Carlo

Abstract We present a discussion of recent progress in excited‐state‐specific quantum chemistry and quantum Monte Carlo alongside a demonstration of how a combination of methods from these two fields can offer reliably accurate excited state predictions across singly excited, doubly excited, and charge transfer states. Both of these fields have seen important advances supporting excited state simulation in recent years, including the introduction of more effective excited‐state‐specific optimization methods, improved handling of complicated wave function forms, and ways of explicitly balancing the quality of wave functions for ground and excited states. To emphasize the promise that exists at this intersection, we provide demonstrations using a combination of excited‐state‐specific complete active space self‐consistent field theory, selected configuration interaction, and state‐specific variance minimization. These demonstrations show that combining excited‐state‐specific quantum chemistry and variational Monte Carlo can be more reliably accurate than either equation of motion coupled cluster theory or multi‐reference perturbation theory, and that it can offer new clarity in cases where existing high‐level methods do not agree. This article is categorized under: Electronic Structure Theory > Ab Initio Electronic Structure Methods Software > Quantum Chemistry

Otis, Leon↗
DOE OSTI2017

The Effect of Salts in Promoting Specific and Competitive Interactions between Zinc Finger Proteins and Metals

Specific protein–metal interactions (PMIs) fulfill essential functions in cells and organic bodies, and activation of these functions in vivo are mostly modulated by the complex environmental factors, including pH value, small biomolecules, and salts. Specifically, the role of salts in promoting specific PMIs and their competition among various metals has remained untapped mainly due to the difficulty to distinguish nonspecific PMIs from specific PMIs by classic spectroscopic techniques. Herein, we report Hofmeister salts differentially promote the specific PMIs by combining nanoelectrospray ionization mass spectrometry and spectroscopic techniques (fluorescence measurement and circular dichroism). Furthermore, to explore the influence of salts in competitive binding between metalloproteins and various metals, we designed a series of competitive experiments and applied to a well-defined model system, the competitive binding of zinc (II) and arsenic (III) to holo-promyelocytic leukemia protein (PML). These experiments not only provided new insights at the molecular scale as complementary to previous NMR and spectroscopic results, but also deduced the relative binding ability between zinc finger proteins and metals at the molecular scale, which avoids the mass spectrometric titration-based determination of binding constants that is frequently affected and often degraded by variable solution conditions including salt contents. .

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2022

Investigation of Remanufacturing Methods Utilizing Mechanically-Generated and Gas-Atomized Feedstock Production for Directed Energy Deposition Processing Through Specific Energy Consumption Modeling

The goal of this work was to assess the energy consumption of a novel remanufacturing method that utilizes mechanically-generated feedstock for directed energy deposition. Gas-atomization is the state-of-the-art production process for directed energy deposition feedstock, and for this work was incorporated into a remanufacturing process path to provide a comparison method. Specific energy consumption models of remanufacturing utilizing both of these proposed process paths were developed and applied to a case study to investigate energy saving opportunities for future manufacturing paradigms. The energy modelling was done in three stages. First, the mechanically-generated feedstock production energy consumption model was generated from experimental observation. Second, the gas-atomized feedstock production energy consumption model was generated from a combination of experimental observation, reported estimates from the manufacturer, and data found in the literature. Lastly, the energy consumption model of directed energy deposition was derived from experimental observation and compares favorably with reported estimates in the literature. With the models, the specific energy consumption in the two process paths were compared and their application was demonstrated by estimating the energy consumption to remanufacture a bracket. The two feedstock production methods had similar specific energy consumptions. The specific energy consumption of the directed energy deposition process was the greatest component in the respective remanufacturing paths by an order of magnitude; increasing deposition rate is the most important factor for lowering the overall specific energy consumption. The analyzed remanufacturing technologies were estimated to consume less energy than replacement when repairing up to approximately 15% of the original part’s mass.

42 ENGINEERING↗