Search NASA⌕ Search

SEARCH · Search NASA

Results for “synthetic cells”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 217 records · Page 12
All sourcesNASA NTRSDOE OSTI
DOE OSTI2025

Improving durability and performance of solid oxide electrolyzers by controlling surface composition on oxygen electrodes

Solid oxide electrolysis cell (SOEC) is a promising technology for high-efficiency energy conversion, enabling the production of hydrogen, syngas, synthetic fuels, and various commodity chemicals. Unlike traditional thermochemical processes, SOECs operate at elevated temperatures (600-850°C), benefiting from favorable thermodynamics and reaction kinetics. This makes them highly energy efficient compared to alkaline or polymer electrolyte membrane (PEM) electrolysis technologies. However, despite these advantages, SOECs face significant challenges related to performance degradation over time. A primary issue is the degradation of the oxygen electrode due to strontium (Sr) segregation and impurity poisoning from chromium (Cr) and sulfur (S). This is because the pathway to deposition of Cr and S include the reaction of Cr and S with the segregated SrO at the surface. Sr segregation leads to the formation of insulating compounds such as SrCrO4 and SrSO4, which block active sites, reduce oxygen exchange rates, and compromise the electrode's electrochemical stability. The degradation mechanisms involve complex interactions between the electrode material's surface chemistry, microstructure, and the operating environment. Sr segregation is particularly problematic because it facilitates the deposition of Cr and S impurities, exacerbating performance losses. Addressing these issues is critical to enhancing the durability and economic viability of SOEC technology. The primary goal of this project is to improve the durability and performance of SOECs by controlling the surface composition of the oxygen electrode. This is achieved by suppressing Sr segregation, thereby mitigating impurity poisoning pathways. The project aims to enhance the oxygen exchange rate, improve cell stability, and extend the operational lifespan of SOECs without necessitating major changes to electrode chemistry or stack components.

30 DIRECT ENERGY CONVERSION↗
DOE OSTI2024

Producing multiple chemicals through biological upcycling of waste poly(ethylene terephthalate)

Poly(ethylene terephthalate) (PET) waste is of low degradability in nature, and its mismanagement threatens numerous ecosystems. To combat the accumulation of waste PET in the biosphere, PET bio-upcycling, which integrates chemical pretreatment to produce PET-derived monomers with their microbial conversion into value-added products, has shown promise. The recently discovered Rhodococcus jostii strain PET (RPET) can metabolically degrade terephthalic acid (TPA) and ethylene glycol (EG) as sole carbon sources, and it has been developed into a microbial chassis for PET upcycling. However, the scarcity of synthetic biology tools, specifically designed for the non-model microbe RPET, limits the development of a microbial cell factory for expanding the repertoire of bioproducts from post-consumer PET. Herein, we describe the development of potent genetic tools for RPET, including (1) two inducible and titratable expression systems for tunable gene expression and (2) Serine Integrase-based Recombinational Tools (SIRT) for genome editing. Using these tools, we systematically engineer the RPET strain to ultimately establish microbial supply chains for producing multiple chemicals, including lycopene, lipids, and succinate, from post-consumer PET waste bottles, achieving the highest titer of lycopene ever reported thus far in RPET (i.e., 22.6 mg/L of lycopene, approximately 10,000-fold higher than that of the wild-type strain). Furthermore, this work highlights the great potential of plastic upcycling as a generalizable means of sustainable production of diverse chemicals.

36 MATERIALS SCIENCE↗
DOE OSTI2025

Demonstration of MgCr 2– x Mn x O 4 Spinel Oxide Cathodes in High-Voltage Mg Batteries

Solid-solution oxide spinels with high redox voltages and facile Mg 2+ mobility have been identified as promising candidates for practical, high-voltage cathodes in Mg batteries. In this work, we discuss the development of MgCr 2-x Mn x O 4 [x = 0.5, 1, 1.2] solid-solution spinel oxides as a cathode material and their electrochemical performance paired with an Mg anode in a full cell. This work presents the first demonstration of full cells with these materials. Mg-Cr-Mn spinel oxides with varying Cr and Mn contents were synthesized using alternative synthetic routes for optimal electrochemical performance. High-resolution synchrotron powder X-ray diffraction (PXRD), solid-state nuclear magnetic resonance (NMR) spectroscopy, and electron microscopy showed that these different synthetic routes resulted in changes in structures and particle morphologies, which in turn affect the electrochemical performance. Particularly, the urea coprecipitation synthetic route resulted in high-surface-area particles that enabled lower overpotentials and increased discharge capacity. The high surface area also resulted in expedited structural degradation caused by the irreversible migration of Mg 2+ into normally vacant 16c sites in the spinel lattice. This structural degradation was lessened by using a hydrosauna-urea synthesis method, which decreased the Mg/Mn inversion ratio while retaining high-surface-area particles with good cycling performance. Furthermore, our findings highlight the necessity for high surface area or nanostructured spinel oxide cathodes with minimized Mg-Mn inversion to enable spinel oxide cathodes in Mg full cells.

Mg anode↗
DOE OSTI2020

Post-Synthetic Reduction of Pectin Methylesterification Causes Morphological Abnormalities and Alterations to Stress Response in Arabidopsis thaliana

Pectin is a critical component of the plant cell wall, supporting wall biomechanics and contributing to cell wall signaling in response to stress. The plant cell carefully regulates pectin methylesterification with endogenous pectin methylesterases (PMEs) and their inhibitors (PMEIs) to promote growth and protect against pathogens. We expressed Aspergillus nidulans pectin methylesterase (AnPME) in Arabidopsis thaliana plants to determine the impacts of methylesterification status on pectin function. Plants expressing AnPME had a roughly 50% reduction in methylester content compared with control plants. AnPME plants displayed a severe dwarf phenotype, including small, bushy rosettes and shorter roots. This phenotype was caused by a reduction in cell elongation. Cell wall composition was altered in AnPME plants, with significantly more arabinose and significantly less galacturonic acid, suggesting that plants actively monitor and compensate for altered pectin content. Cell walls of AnPME plants were more readily degraded by polygalacturonase (PG) alone but were less susceptible to treatment with a mixture of PG and PME. AnPME plants were insensitive to osmotic stress, and their susceptibility to Botrytis cinerea was comparable to wild type plants despite their compromised cell walls. This is likely due to upregulated expression of defense response genes observed in AnPME plants. These results demonstrate the importance of pectin in both normal growth and development, and in response to biotic and abiotic stresses.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Microbial biofilms as living photoconductors due to ultrafast electron transfer in cytochrome OmcS nanowires

Light-induced microbial electron transfer has potential for efficient production of value-added chemicals, biofuels and biodegradable materials owing to diversified metabolic pathways. However, most microbes lack photoactive proteins and require synthetic photosensitizers that suffer from photocorrosion, photodegradation, cytotoxicity, and generation of photoexcited radicals that are harmful to cells, thus severely limiting the catalytic performance. Therefore, there is a pressing need for biocompatible photoconductive materials for efficient electronic interface between microbes and electrodes. Here we show that living biofilms of Geobacter sulfurreducens use nanowires of cytochrome OmcS as intrinsic photoconductors. Photoconductive atomic force microscopy shows up to 100-fold increase in photocurrent in purified individual nanowires. Photocurrents respond rapidly (<100 ms) to the excitation and persist reversibly for hours. Femtosecond transient absorption spectroscopy and quantum dynamics simulations reveal ultrafast (~200 fs) electron transfer between nanowire hemes upon photoexcitation, enhancing carrier density and mobility. Our work reveals a new class of natural photoconductors for whole-cell catalysis.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2021

Membrane fusion and drug delivery with carbon nanotube porins

Significance The plasma membrane protects cell content from the outer environment. Overcoming this obstacle and delivering drugs efficiently into cells still remain a major hurdle for modern pharmacology and medicine. We developed and demonstrated a simple nanomaterial platform—a dimer of small-diameter carbon nanotube porins (CNTPs)—which functions as a potent membrane fusogen. Molecular simulations revealed a distinct fusion mechanism. CNTP-studded vesicles loaded with a chemotherapeutic agent, doxorubicin, delivered the drug to cancer cells, killing a majority of them. Our work provides new opportunities for understanding membrane fusion mechanisms, designing synthetic fusogens, and developing simple and efficient drug carriers for delivery of therapeutics and vaccines.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2020

Structure and Behavior of the Ni End-Member Schreibersite Ni 3 P under Compression to 50 GPa

To better understand the potential presence of light element alloys of Fe and Ni in the Earth’s interior, the crystal structure and compressional behavior of the Ni-P binary compound, schreibersite (Ni 3 P), have been investigated using synchrotron X-ray diffraction experiments. Both powder and two single-crystal samples of synthetic Ni 3 P (in different orientations with respect to the loading axis of the diamond anvil cell) were compressed up to approximately 50 GPa at ambient temperature. The compressional data obtained for Ni3P were fitted with a 3rd order Birch–Murnaghan equation of state. All data indicated that the c/a ratio of unit cell parameters remained approximately constant up to about 30 GPa but then increased progressively with pressure, exhibiting a second slight discontinuity at approximately 40 GPa. The changes in unit cell parameters at ~30 GPa and ~40 GPa suggested discontinuous changes in magnetic ordering. Moreover, the threshold of these subtle discontinuities is sensitive to the stress state and orientation of the crystal in the diamond anvil cell. This study is the first report on the compressional behavior of both powder and single-crystal schreibersite at high-pressure (up to 50 GPa). It offers insights into the effects of Ni 3 P components on the compressional behavior of the Earth’s core.

36 MATERIALS SCIENCE↗
DOE OSTI2024

Achieving a Net-Zero Future: The Role of Nuclear Energy

Governments and private industry around the world have established aggressive goals to achieve net-zero emissions for the power, industrial, and transportation sectors by 2050. These aggressive goals demand immediate action if we are to be successful, and they require us to think more holistically about our clean energy options. Programs within the U.S. Department of Energy (DOE) are addressing these holistic solutions. Traditionally, electricity generation and management are considered independently from meeting energy demands for industry and transportation. As we seek to eliminate emissions across all energy use sectors we need to reassess how energy demands are met. When we consider overall energy use, only one-third is in the form of electricity. Additional energy demands are in the form of heat or steam for industrial processes, in addition to direct fuel use for transportation. These sectors are much harder to abate, and electrification may not be the best option. Reducing environmental emissions at an affordable cost, while maintaining grid reliability and resilience, will require us to leverage all of the clean energy resources available. The DOE Office of Nuclear Energy (DOE-NE) program on Integrated Energy Systems (IES) is led by researchers at Idaho National Laboratory (INL), and work is conducted in partnership with an array of other DOE laboratories, industry, and academia. The primary focus of IES research is to assess the technical and economic potential of nuclear-driven IES to enhance the flexibility and utilization of nuclear reactors working alongside renewable generators to meet an array of energy demands—thereby maximizing the utilization of clean energy resources across all energy sectors. Various energy applications and product streams beyond electricity are being evaluated, ranging from generation of potable water to production of hydrogen, fertilizers, synthetic fuels, and various chemicals. The DOE-NE program additionally partners with the Hydrogen and Fuel Cell Technologies Office under the DOE Office of Energy Efficiency and Renewable Energy to jointly fund the development of analysis tools, technologies, and nuclear-integrated hydrogen demonstration projects. This presentation will highlight the wide array of R&D being conducted across multiple DOE-funded programs to develop and deploy nuclear-based IES that will be key to achieving our net-zero goals. By working with key collaborators in the nuclear industry, analytical studies are now becoming a reality in demonstration projects.

08 HYDROGEN↗
DOE OSTI2023

Redox-enabled electronic interrogation and feedback control of hierarchical and networked biological systems

Abstract Microelectronic devices can directly communicate with biology, as electronic information can be transmitted via redox reactions within biological systems. By engineering biology’s native redox networks, we enable electronic interrogation and control of biological systems at several hierarchical levels: proteins, cells, and cell consortia. First, electro-biofabrication facilitates on-device biological component assembly. Then, electrode-actuated redox data transmission and redox-linked synthetic biology allows programming of enzyme activity and closed-loop electrogenetic control of cellular function. Specifically, horseradish peroxidase is assembled onto interdigitated electrodes where electrode-generated hydrogen peroxide controls its activity. E. coli ’s stress response regulon, oxyRS , is rewired to enable algorithm-based feedback control of gene expression, including an eCRISPR module that switches cell-cell quorum sensing communication from one autoinducer to another—creating an electronically controlled ‘bilingual’ cell. Then, these disparate redox-guided devices are wirelessly connected, enabling real-time communication and user-based control. We suggest these methodologies will help us to better understand and develop sophisticated control for biology.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Analysis of cell-based diffusion acceleration for the slice balance approach

In this work, we perform analysis on the use of cell-based diffusion acceleration methodologies to accelerate the convergence of transport solutions discretized with the slice balance approach (SBA) on unstructured polygonal grids.We investigated both linear diffusion synthetic acceleration (DSA) and non linear diffusion acceleration (NDA), including its partial-current variant (pNDA). DSA and NDA were both shown to diverge for intermediate ranges of mesh optical thicknesses. However, pNDA and Krylov methods like GMRES and Broyden stabilized the acceleration schemes, including problems with degenerate cells formed by mesh refinement. (author)

42 ENGINEERING↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Isobutanol production freed from biological limits using synthetic biochemistry

Cost competitive conversion of biomass-derived sugars into biofuel will require high yields, high volumetric productivities and high titers. Suitable production parameters are hard to achieve in cell-based systems because of the need to maintain life processes. As a result, next-generation biofuel production in engineered microbes has yet to match the stringent cost targets set by petroleum fuels. Removing the constraints imposed by having to maintain cell viability might facilitate improved production metrics. Here, we report a cell-free system in a bioreactor with continuous product removal that produces isobutanol from glucose at a maximum productivity of 4 g L –1 h –1 , a titer of 275 g L –1 and 95% yield over the course of nearly 5 days. These production metrics exceed even the highly developed ethanol fermentation process. Our results suggest that moving beyond cells has the potential to expand what is possible for bio-based chemical production.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2024

Image registration for in situ X-ray nano-imaging of a composite battery cathode with deformation

The structural and chemical evolution of battery electrodes at the nanoscale plays an important role in affecting the cell performance. Nano-resolution X-ray microscopy has been demonstrated as a powerful technique for characterizing the evolution of battery electrodes under operating conditions with sensitivity to their morphology, compositional distribution and redox heterogeneity. In real-world batteries, the electrode could deform upon battery operation, causing challenges for the image registration which is necessary for several experimental modalities, e.g. XANES imaging. To address this challenge, this work develops a deep-learning-based method for automatic particle identification and tracking. This approach was not only able to facilitate image registration with good robustness but also allowed quantification of the degree of sample deformation. The effectiveness of the method was first demonstrated using synthetic datasets with known ground truth. The method was then applied to an experimental dataset collected on an operating lithium battery cell, revealing a high degree of intra- and interparticle chemical complexity in operating batteries.

25 ENERGY STORAGE↗
DOE OSTI2023

Molecular homing and retention of muscle membrane stabilizing copolymers by non-invasive optical imaging in vivo

First-in-class membrane stabilizer Poloxamer 188 (P188) has been shown to confer membrane protection in an extensive range of clinical conditions; however, elements of the systemic distribution and localization of P188 at the organ, tissue, and muscle fiber levels in vivo have not yet been elucidated. Here we used non-invasive fluorescence imaging to directly visualize and track the distribution and localization of P188 in vivo. The results demonstrated that the Alx647 probe did not alter the fundamental properties of P188 to protect biological membranes. Distribution kinetics in mdx mice demonstrated that Alx647 did not interface with muscle membranes and had fast clearance kinetics. In contrast, the distribution kinetics for P188-Alx647 was significantly slower, indicating a dramatic depot and retention effect of P188. Results further demonstrated the significant retention of P188-Alx647 in the skeletal muscle of mdx mice, showing a significant genotype effect with a higher fluorescence signal in the mdx muscles over BL10 mice. High-resolution optical imaging provided direct evidence of P188 surrounding the sarcolemma of skeletal and cardiac muscle cells. Taken together, these findings provide direct evidence of muscle-disease-dependent molecular homing and retention of synthetic copolymers in striated muscles thereby facilitating advanced studies of copolymer-membrane association in health and disease.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2021

Repulsive expansion dynamics in colony growth and gene expression

Spatial expansion of a population of cells can arise from growth of microorganisms, plant cells, and mammalian cells. It underlies normal or dysfunctional tissue development, and it can be exploited as the foundation for programming spatial patterns. This expansion is often driven by continuous growth and division of cells within a colony, which in turn pushes the peripheral cells outward. This process generates a repulsion velocity field at each location within the colony. Here we show that this process can be approximated as coarse-grained repulsive-expansion kinetics. This framework enables accurate and efficient simulation of growth and gene expression dynamics in radially symmetric colonies with homogenous z-directional distribution. It is robust even if cells are not spherical and vary in size. The simplicity of the resulting mathematical framework also greatly facilitates generation of mechanistic insights.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Assessment of Potential Future Demands for Hydrogen in the United States

H2@Scale is a U.S. Department of Energy (DOE) initiative that brings together stakeholders to advance the affordable production, transport, storage, and utilization of hydrogen (H2) as an energy carrier to increase revenue opportunities in multiple energy sectors. The focus of the current work is to characterize the growth potential of diverse hydrogen industries in the United States, given research and development (R&D) advancements in hydrogen technologies. Current and emerging hydrogen production technologies utilize diverse energy sources, including natural gas (NG) reforming, as well as renewable and nuclear power for low-temperature and high-temperature water splitting. The produced hydrogen also enables emerging domestic industries that value conventional and renewable hydrogen as an energy carrier for intermediate and end use. The success of H2@Scale (Figure ES.1) depends not only on hydrogen demand from growing existing markets such as petroleum refining and ammonia (NH 3 ) production, but also on the development of new markets such as metals refining, synthetic fuel (synfuel) and chemical production, biofuels, light-duty (LD) and heavy-duty (HD) hydrogen fuel cell (FC) electric vehicles (FCEVs), and injection into NG pipelines, all of which can significantly increase hydrogen demand relative to current levels of approximately10 million metric tons [MMT] annually. This study focused primarily on five demand sectors — synfuels, upgrading of oil/biomass, NH 3 /fertilizer, metals refining, and hydrogen vehicles (transportation) — along with gas infrastructure. For each sector, a hydrogen demand potential was quantified, along with a “threshold price.” The hydrogen demand potential reflects a practical amount of hydrogen that could be used in that sector, barring economic considerations. The threshold price reflects the price at which the consumer would utilize hydrogen in lieu of an alternative that could supply the same performance.

08 HYDROGEN↗
DOE OSTI2026

Optical interference for the guidance of cryogenic focused ion beam milling beyond the axial diffraction limit

Cryogenic focused ion beam (Cryo-FIB) milling has become a standard step in the cryogenic electron tomography (Cryo-ET) workflow and is required to thin cells to electron-semitransparency. However, this destructive process removes the vast majority of the cellular material and raises a critical question: what thin section should be preserved for Cryo-ET analysis? Using a tri-coincident cryogenic FIB-SEM-LM system, we identify an interferometric optical response that can be used for targeting lamella production to fluorescently labeled structures with accuracy beyond the diffraction limit. Here we demonstrate this approach using synthetic samples of fluorescent beads embedded in micron-scale droplets of amorphous ice. We then apply the approach to capture virions inside host cells. Successful targeting is confirmed by Cryo-ET revealing clusters of virions in intracellular vesicles. The method does not require any fluorescent fiducials or axial registration and can be performed on any fluorescently labeled structure that is visible in widefield fluorescence microscopy.

Cryoelectron microscopy↗
DOE OSTI2023

Perspectives for self-driving labs in synthetic biology

Self-driving labs (SDLs) combine fully automated experiments and data collection with artificial intelligence (AI) and control algorithms that decide not only the set of parameters for the next experiment, but also potentially which scientific hypotheses to test. Taken to their ultimate expression, SDLs could usher a new paradigm of scientific research, where the world is probed, interpreted, and explained by machines for human benefit. Whereas there are functioning SDLs in the fields of chemistry and materials science, we contend that synthetic biology provides a unique opportunity since the genome provides a single, easily accessible, target for affecting the incredibly wide repertoire of biological cell behavior. Since they can provide large amounts of high-quality data, SDLs can be a platform for AI to develop approaches to systematically convert data into scientific knowledge systems. These knowledge systems can be used both to understand the biological world and to design bioengineered systems to fit a desired specification (inverse design). However, the level of investment required for the creation of biological SDLs is only warranted if directed towards solving difficult and enabling biological questions. Here, we discuss challenges and opportunities in creating SDLs for synthetic biology.

59 BASIC BIOLOGICAL SCIENCES↗