Search NASA⌕ Search

SEARCH · Search NASA

Results for “sequence design”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 253 records · Page 14
All sourcesNASA NTRSDOE OSTI
DOE OSTI2022

Geobacter sp. Strain IAE Dihaloeliminates 1,1,2-Trichloroethane and 1,2-Dichloroethane

We report that chlorinated ethanes, including 1,2-dichloroethane (1,2-DCA) and 1,1,2-trichloroethane (1,1,2-TCA), are widespread groundwater contaminants. Enrichment cultures XR DCA and XR TCA derived from river sediment dihaloeliminated 1,2-DCA to ethene and 1,1,2-TCA to vinyl chloride (VC), respectively. The XR TCA culture subsequently converted VC to ethene via hydrogenolysis. Microbial community profiling demonstrated the enrichment of Geobacter 16S rRNA gene sequences in both the XR DCA and XR TCA cultures, and Dehalococcoides mccartyi (Dhc) sequences were only detected in the ethene-producing XR TCA culture. The presence of a novel Geobacter population, designated as Geobacter sp. strain IAE, was identified by the 16S rRNA gene-targeted polymerase chain reaction and Sanger sequencing. Time-resolved population dynamics attributed the dihaloelimination activity to strain IAE, which attained the growth yields of 0.93 ± 0.06 x 10 7 and 1.18 ± 0.14 x 10 7 cells per μmol Cl -1 released with 1,2-DCA and 1,1,2-TCA as electron acceptors, respectively. In contrast, Dhc growth only occurred during VC-to-ethene hydrogenolysis. Our findings discover a Geobacter sp. strain capable of respiring multiple chlorinated ethanes and demonstrate the involvement of a broader diversity of organohalide-respiring bacteria in the detoxification of 1,2-DCA and 1,1,2-TCA.

1,1,2-trichloroethane↗
DOE OSTI2024

Recommendations for Uniform Variant Calling of SARS-CoV-2 Genome Sequence across Bioinformatic Workflows

Genomic sequencing of clinical samples to identify emerging variants of SARS-CoV-2 has been a key public health tool for curbing the spread of the virus. As a result, an unprecedented number of SARS-CoV-2 genomes were sequenced during the COVID-19 pandemic, which allowed for rapid identification of genetic variants, enabling the timely design and testing of therapies and deployment of new vaccine formulations to combat the new variants. However, despite the technological advances of deep sequencing, the analysis of the raw sequence data generated globally is neither standardized nor consistent, leading to vastly disparate sequences that may impact identification of variants. Here, we show that for both Illumina and Oxford Nanopore sequencing platforms, downstream bioinformatic protocols used by industry, government, and academic groups resulted in different virus sequences from same sample. These bioinformatic workflows produced consensus genomes with differences in single nucleotide polymorphisms, inclusion and exclusion of insertions, and/or deletions, despite using the same raw sequence as input datasets. Here, we compared and characterized such discrepancies and propose a specific suite of parameters and protocols that should be adopted across the field. Consistent results from bioinformatic workflows are fundamental to SARS-CoV-2 and future pathogen surveillance efforts, including pandemic preparation, to allow for a data-driven and timely public health response.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2024

VIBES: a workflow for annotating and visualizing viral sequences integrated into bacterial genomes

Abstract Bacteriophages are viruses that infect bacteria. Many bacteriophages integrate their genomes into the bacterial chromosome and become prophages. Prophages may substantially burden or benefit host bacteria fitness, acting in some cases as parasites and in others as mutualists. Some prophages have been demonstrated to increase host virulence. The increasing ease of bacterial genome sequencing provides an opportunity to deeply explore prophage prevalence and insertion sites. Here we present VIBES (Viral Integrations in Bacterial genomES), a workflow intended to automate prophage annotation in complete bacterial genome sequences. VIBES provides additional context to prophage annotations by annotating bacterial genes and viral proteins in user-provided bacterial and viral genomes. The VIBES pipeline is implemented as a Nextflow-driven workflow, providing a simple, unified interface for execution on local, cluster and cloud computing environments. For each step of the pipeline, a container including all necessary software dependencies is provided. VIBES produces results in simple tab-separated format and generates intuitive and interactive visualizations for data exploration. Despite VIBES’s primary emphasis on prophage annotation, its generic alignment-based design allows it to be deployed as a general-purpose sequence similarity search manager. We demonstrate the utility of the VIBES prophage annotation workflow by searching for 178 Pf phage genomes across 1072 Pseudomonas spp. genomes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Optimizing Cell-based Antimicrobials through Pooled Genomic Libraries

DNA synthesis and assembly technologies ushered in through synthetic biology have great promise for biomanufacturing, bioremediation, and the development of living therapeutics. Unfortunately, predicting sequence to function relationships, including for biosynthetic pathways expressed in a new host organism, is difficult and often requires many iterative cycles of design, construction, and testing. We are working to develop data-driven approaches to identify the genetic determinants of growth defects and productivity for the expression of a cell-based antimicrobial. We assayed the growth, pigment production, and antimicrobial activity of a collection of over 10,000 genetic mutants of the violacein biosynthetic pathway and sequenced the genetic variation of these mutants. Through this project, we have developed an innovative codebase to automate the determination of pigmentation and antimicrobial clearing diameter for tens of thousands of genetic mutants cultivated on agar dishes. Further, we have written DNA sequence analysis code to demultiplex & provide consensus sequences from high-throughput PacBio long-read circular consensus sequencing (CCS) datasets. From this foundation, we plan to map DNA sequence to function to predict an optimal genetic design to maximize antimicrobial activity while minimizing deleterious growth effects. The workflows and algorithms developed through this project can be broadly applied to other engineered functions in microbes, uncovering sequence to function relationships for complex phenotypes where function impacts fitness.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Control over Conformational Landscapes of Polypeptoids by Monomer Sequence Patterning

The ability to program chain conformation and structure through control over the monomer sequence of synthetic polymers has broad implications for next-generation material design. While related problems of protein-folding and de novo design have generated accurate predictions of 3D folded chain structures, generalization to synthetic polymers remains intractable due to the requirement of large structural databases and the intrinsically disordered nature of polymer building blocks. In this work, polypeptoids, a class of peptidomimetic synthetic polymers, are utilized to build a general workflow for the study of relationships between monomer sequence and dynamic 3D chain structure in solution. Furthermore, this work demonstrates how control over the monomer sequence can alter the conformational landscape of synthetic polymers to deviate dramatically from classical chain statistics. Specifically, the distribution of end-to-end distances, as measured by double electron-electron resonance spectroscopy in dilute solvent, is systematically skewed towards shorter distances with an increasing number of hydrophobes and further refined by hydrophobe arrangement in amphiphilic polypeptoid chains.

36 MATERIALS SCIENCE↗
DOE OSTI2023

Preliminary Design of Critical Experiments Involving Commercially Available B 4 C Neutron Absorber Plates with Low-Enriched UO 2 Fuel

The International Criticality Safety Benchmark Evaluation Project (ICSBEP) is an initiative to provide high-quality benchmark data in a standardized format for criticality safety analysts to use to validate calculational tools and nuclear data. In the last released 2022 version, the ICSBEP handbook contains over 5,000 critical experiment descriptions, results, and associated models. This paper describes the critical configurations proposed and calculations performed as part of the conceptual design phase of Integral Experiment Request (IER) 554 (IER-554). The goal of IER-554 is to add to the benchmark experiments available to the criticality safety community by designing critical experiments that can analyze how adding commercially available Boralcan plates to an assembly of low-enriched UO2 fuel rods affects the effective neutron multiplication factor (k eff ). Boralcan, a neutron absorber product developed by Rio Tinto, is made of B4C in an Al 1100 matrix and is commonly used for criticality suppression in fuel storage pools. In the current version of the ICSBEP handbook, only a few dated critical experiments involve B4C materials, and none involve Boralcan in a thin plate shape. The experiments designed as part of IER-554 are intended to be performed at the Sandia Pulsed Reactor Facility/Critical Experiments (SPRF/CX) apparatus at Sandia National Laboratories. SPRF/CX is a well-characterized assembly considered trustworthy by the benchmarking community because of the numerous high-quality evaluations with very low experimental uncertainties included in the ICSBEP handbook. Figure 1 illustrates the assembly for a particular configuration from LCT-078, one of the published benchmarks in the ICSBEP handbook. The experiments will be moderated and reflected by light water at ambient atmospheric pressure. Before the plates are inserted in the critical assembly, they will be characterized with x-ray computed tomography (XCT) to identify the sizes and distribution of the B 4 C powder particles inside the plates. The preliminary design calculations were performed with SCALE 6.3.0 using the KENO V.a sequence for the criticality calculations, the CE-TSUNAMI-3D sequence for the sensitivity and uncertainty studies, and the ENDF/B-VII.1 Continuous Energy cross section library. All the calculation results presented have 10 pcm statistical uncertainties. A set of critical experiments with Boralcan plates could increase the confidence of the criticality safety community in its modeling methods when using this type of neutron absorber material. Experiments would also help validate k eff calculations, and the industry could use these validations to change the B loading credit limits from the US Nuclear Regulatory Commission standard review plan for dry cask storage of spent nuclear fuel. This paper summarizes only part of the analysis documented in the preliminary design report.

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗
DOE OSTI2024

Structure–Function Insights into Thermoresponsive Copolymers as Lanthanide Precipitants

The synthetic toolbox for stimuli-responsive polymers has broadened to include many tunable variables, making these materials applicable in diverse technologies. However, unraveling the key composition–structure–function relationships to facilitate ground-up design remains a challenge due to the inherent dispersity in sequence and conformations for synthetic polymers. We here present a systematic study of these relationships using a model system of copolymers with a thermoresponsive (N-isopropylacrylamide) backbone in addition to metal-chelating (acrylic acid) and hydrophobic structural comonomers and evaluate their efficiency at isolating technologically critical lanthanide ions. The efficiency of lanthanide ion extraction by precipitation was quantitated with a metallochromic dye to reveal trends relating copolymer hydrophobicity to improved separations. Further, we examined the role of different hydrophobic comonomers in dictating the solution-phase conformation of the polymer in the presence and absence of lanthanide ions, and we correlated key features of the hydrophobic comonomer to extraction efficiency. Lastly, we identified how the local proximity of thermoresponsive, chelating, and hydrophobic subunits facilitates metal extraction by manipulating the copolymer sequence with multiblock polymerization. Through mechanistic analysis, we propose a binding-then-assembly process through which metal ions are coprecipitated with macromolecular chelators.

Copolymers↗
DOE OSTI2020

Hybrid deep learning architecture for general disruption prediction across tokamaks

In this paper, we present a new deep learning disruption prediction algorithm based on important findings from explorative data analysis which effectively allows knowledge transfer from existing devices to new ones, thereby predicting disruptions using very limited disruptive data from the new devices. Here, the explorative data analysis conducted via unsupervised clustering techniques confirms that time-sequence data are much better separators of disruptive and non-disruptive behavior than the instantaneous plasma state data with further advantageous implications for a sequence-based predictor. Based on such important findings, we have designed a new algorithm for multi-machine disruption prediction that achieves high predictive accuracy on the C-Mod (AUC=0.801), DIII-D (AUC=0.947) and EAST (AUC=0.973) tokamaks with limited hyperparameter tuning. Through numerical experiments, we show that boosted accuracy (AUC=0.959) is achieved on EAST predictions by including in the training only 20 disruptive discharges, thousands of non-disruptive discharges from EAST, and combining this with more than a thousand discharges from DIII-D and C-Mod. The improvement of predictive ability obtained by combining disruptive data from other devices is found to be true for all permutations of the three devices. Furthermore, by comparing the predictive performance of each individual numerical experiment, we find that non-disruptive data are machine-specific while disruptive data from multiple devices contain device-independent knowledge that can be used to inform predictions for disruptions occurring on a new device.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2024

Genomes OnLine Database (GOLD) v.10: new features and updates

The Genomes OnLine Database (GOLD; https://gold.jgi.doe.gov/) at the Department of Energy Joint Genome Institute is a comprehensive online metadata repository designed to catalog and manage information related to (meta)genomic sequence projects. GOLD provides a centralized platform where researchers can access a wide array of metadata from its four organization levels namely Study, Organism/Biosample, Sequencing Project and Analysis Project. GOLD continues to serve as a valuable resource and has seen significant growth and expansion since its inception in 1997. With its expanded role as a collaborative platform, it not only actively imports data from other primary repositories like National Center for Biotechnology Information but also supports contributions from researchers worldwide. This collaborative approach has enriched the database with diverse datasets, creating a more integrated resource to enhance scientific insights. As genomic research becomes increasingly integral to various scientific disciplines, more researchers and institutions are turning to GOLD for their metadata needs. To meet this growing demand, GOLD has expanded by adding diverse metadata fields, intuitive features, advanced search capabilities and enhanced data visualization tools, making it easier for users to find and interpret relevant information. This manuscript provides an update and highlights the new features introduced over the last 2 years.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Multi-species outbreak of SARS-CoV-2 Delta variant in a zoological institution, with the detection in two new families of carnivores

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has a worldwide distribution in humans and many other mammalian species. In late September 2021, 12 animals maintained by the Chicago Zoological Society's Brookfield Zoo were observed with variable clinical signs. The Delta variant of SARS-CoV-2 was detected in faeces and nasal swabs by qRT-PCR, including the first detection in animals from the families Procyonidae and Viverridae. Test positivity rate was 12.5% for 35 animals tested. All animals had been vaccinated with at least one dose of a recombinant vaccine designed for animals and all recovered with variable supportive treatment. Sequence analysis showed that six zoo animal strains were closely correlated with 18 human SARS-CoV-2 strains, suggestive of potential human-to-animal transmission events. This report documents the expanding host range of COVID-19 during the ongoing pandemic.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

V-HAMSTeR v1.0.0

V-HAMSTeR is a bioinformatics software tool designed to predict the hosts of viruses directly from genomic sequences. It can be used by researchers to predict animal, prokaryotic, plant, protist or fungal viral hosts including viruses that may be fragmented or discovered in environmental metagenomic datasets. Features & Uses: The software employs a novel dual-stream deep learning architecture that dynamically fuses implicit sequence embeddings from a genomic foundation model with 13 explicit, handcrafted biological features (e.g., coding density and strand switch rates). To ensure maximum reliability, V=HAMSTeR deploys a 5-fold deep ensemble calibrated via Joint Temperature Scaling, providing users with statistically rigorous confidence probabilities. It also features an automated sequence chunking and mean-pooling module to seamlessly process variable-length contigs. Advantages Over Similar Technologies: Existing tools (e.g., IPEV, RNAVirHost) typically rely on either basic k-mers or isolated neural networks. V-HAMSTeR's hybrid architecture captures both broad genomic context and specific biological motifs that standalone foundation models often miss. Furthermore, unlike competitor tools that struggle with incomplete data or exhibit extreme overconfidence, V-HAMSTeR is explicitly benchmarked and mathematically calibrated for fragmented assemblies (1kb–10kb). This makes it uniquely robust, accurate, and trustworthy for the messy reality of real-world environmental viromics.

Grigson, Susie [Lawrence Berkeley National Laborat↗
DOE OSTI2021

Hybrid deep learning architecture for general disruption prediction across tokamaks

In this paper, we present a new deep learning disruption prediction algorithm based on important findings from explorative data analysis which effectively allows knowledge transfer from existing devices to new ones, thereby predicting disruptions using very limited disruptive data from the new devices. The explorative data analysis conducted via unsupervised clustering techniques confirms that time-sequence data are much better separators of disruptive and non-disruptive behavior than the instantaneous plasma state data with further advantageous implications for a sequence-based predictor. Based on such important findings, we have designed a new algorithm for multi-machine disruption prediction that achieves high predictive accuracy on the C-Mod (AUC=0.801), DIII-D (AUC=0.947) and EAST (AUC=0.973). tokamaks with limited hyperparameter tuning. Through numerical experiments, we show that boosted accuracy (AUC=0.959) is achieved on EAST predictions by including in the training only 20 disruptive discharges, thousands of non-disruptive discharges from EAST, and combining this with more than a thousand discharges from DIII-D and C-Mod. The improvement of predictive ability obtained by combining disruptive data from other devices is found to be true for all permutations of the three devices. Furthermore, by comparing the predictive performance of each individual numerical experiment, we find that non-disruptive data are machine-specific while disruptive data from multiple devices contain device-independent knowledge that can be used to inform predictions for disruptions occurring on a new device.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2020

Genetic circuit design automation for yeast

Cells can be programmed to monitor and react to their environment using genetic circuits. Design automation software maps a desired circuit function to a DNA sequence, a process that requires units of gene regulation (gates) that are simple to connect and behave predictably. This poses a challenge for eukaryotes due to their complex mechanisms of transcription and translation. To this end, we have developed gates for yeast (Saccharomyces cerevisiae) that are connected using RNA polymerase flux as the signal carrier and are insulated from each other and host regulation. They are based on minimal constitutive promoters (~120 base pairs), for which rules are developed to insert operators for DNA-binding proteins. Using this approach, in this work we constructed nine NOT/NOR gates with nearly identical response functions and 400-fold dynamic range. In circuits, they are transcriptionally insulated from each other by placing ribozymes downstream of terminators to block nuclear export of messenger RNAs resulting from RNA polymerase readthrough. Based on these gates, Cello 2.0 was used to build circuits with up to 11 regulatory proteins. A simple dynamic model predicts the circuit response over days. Genetic circuit design automation for eukaryotes simplifies the construction of regulatory networks as part of cellular engineering projects, whether it be to stage processes during bioproduction, serve as environmental sentinels or guide living therapeutics.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Scalable freeform optimization of wide-aperture 3D metalenses by zoned discrete axisymmetry

We introduce a novel framework for design and optimization of 3D freeform metalenses that attains nearly linear scaling of computational cost with diameter, by breaking the lens into a sequence of radial “zones” with 𝑛-fold discrete axisymmetry, where 𝑛 increases with radius. This allows vastly more design freedom than imposing continuous axisymmetry, while avoiding the compromises of the locally periodic approximation (LPA) or scalar diffraction theory. Using a GPU-accelerated finite-difference time-domain (FDTD) solver in cylindrical coordinates, we perform full-wave simulation and topology optimization within each supra-wavelength zone. We validate our approach by designing millimeter and centimeter-scale, poly-achromatic, 3D freeform metalenses which outperform the state of the art. By demonstrating the scalability and resulting optical performance enabled by our “zoned discrete axisymmetry” (ZDA) and supra-wavelength domain decomposition, we highlight the potential of our framework to advance large-scale meta-optics and next-generation photonic technologies.

Sun, Mengdi [Wesleyan University]↗
DOE OSTI2021

Escaping the fate of Sisyphus: assessing resistome hybridization baits for antimicrobial resistance gene capture

Finding, characterizing and monitoring reservoirs for antimicrobial resistance (AMR) is vital to protecting public health. Hybridization capture baits are an accurate, sensitive and cost-effective technique used to enrich and characterize DNA sequences of interest, including antimicrobial resistance genes (ARGs), in complex environmental samples. We demonstrate the continued utility of a set of 19 933 hybridization capture baits designed from the Comprehensive Antibiotic Resistance Database (CARD)v1.1.2 and Pathogenicity Island Database (PAIDB)v2.0, targeting 3565 unique nucleotide sequences that confer resistance. We demonstrate the efficiency of our bait set on a custom-made resistance mock community and complex environmental samples to increase the proportion of on-target reads as much as >200-fold. However, keeping pace with newly discovered ARGs poses a challenge when studying AMR, because novel ARGs are continually being identified and would not be included in bait sets designed prior to discovery. Here we provide imperative information on how our bait set performs against CARDv3.3.1, as well as a generalizable approach for deciding when and how to update hybridization capture bait sets. This research encapsulates the full life cycle of baits for hybridization capture of the resistome from design and validation (both in silico and in vitro) to utilization and forecasting updates and retirement.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Optimal Control of the Energy-Saving Hybrid Hydraulic-Electric Architecture (HHEA) for Off-Highway Mobile Machines

Most off-highway constructions and agriculture equipment use hydraulics, which has unmatched power density, for power transmission and throttling as a means for control. A novel hybrid hydraulic-electric architecture (HHEA) has recently been proposed to improve efficiency for high-power machines that would have been cost-prohibitive to electrify directly. HHEA uses a set of common pressure rails (CPRs) to transmit the majority of power hydraulically and small electric motor drives to modulate that power and to achieve precise control. This article proposes a computationally efficient Lagrange multiplier method (LMM) for computing the optimal sequence of pressure rail selections to minimize energy use. This is needed to evaluate HHEA's energy-saving potential and for iterative architecture design and sizing. An interesting complication is that the cost function is not fully defined until the candidate control sequence is fully specified. This issue is dealt with by decomposing the original problem into a set of sub-problems with additional constraints that can be solved efficiently. Computational effort can be further reduced if actuators are optimized individually instead of together. However, additional steps are required to prevent the constraint functions from becoming discontinuous with respect to the Lagrange multipliers, which is necessary for meeting the constraints. Lastly, a case study of a construction machine demonstrates the efficacy of the method and shows that the HHEA reduces energy consumption by 68%-73% compared to the baseline load-sensing architecture.

Lagrange multiplier↗
DOE OSTI2023

A standardized quantitative analysis strategy for stable isotope probing metagenomics

ABSTRACT Stable isotope probing (SIP) facilitates culture-independent identification of active microbial populations within complex ecosystems through isotopic enrichment of nucleic acids. Many DNA-SIP studies rely on 16S rRNA gene sequences to identify active taxa, but connecting these sequences to specific bacterial genomes is often challenging. Here, we describe a standardized laboratory and analysis framework to quantify isotopic enrichment on a per-genome basis using shotgun metagenomics instead of 16S rRNA gene sequencing. To develop this framework, we explored various sample processing and analysis approaches using a designed microbiome where the identity of labeled genomes and their level of isotopic enrichment were experimentally controlled. With this ground truth dataset, we empirically assessed the accuracy of different analytical models for identifying active taxa and examined how sequencing depth impacts the detection of isotopically labeled genomes. We also demonstrate that using synthetic DNA internal standards to measure absolute genome abundances in SIP density fractions improves estimates of isotopic enrichment. In addition, our study illustrates the utility of internal standards to reveal anomalies in sample handling that could negatively impact SIP metagenomic analyses if left undetected. Finally, we present SIPmg , an R package to facilitate the estimation of absolute abundances and perform statistical analyses for identifying labeled genomes within SIP metagenomic data. This experimentally validated analysis framework strengthens the foundation of DNA-SIP metagenomics as a tool for accurately measuring the in situ activity of environmental microbial populations and assessing their genomic potential. IMPORTANCE Answering the questions, “who is eating what?” and “who is active?” within complex microbial communities is paramount for our ability to model, predict, and modulate microbiomes for improved human and planetary health. These questions can be pursued using stable isotope probing to track the incorporation of labeled compounds into cellular DNA during microbial growth. However, with traditional stable isotope methods, it is challenging to establish links between an active microorganism’s taxonomic identity and genome composition while providing quantitative estimates of the microorganism’s isotope incorporation rate. Here, we report an experimental and analytical workflow that lays the foundation for improved detection of metabolically active microorganisms and better quantitative estimates of genome-resolved isotope incorporation, which can be used to further refine ecosystem-scale models for carbon and nutrient fluxes within microbiomes.

54 ENVIRONMENTAL SCIENCES↗