Search NASA⌕ Search

SEARCH · Search NASA

Results for “Transient Expression”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 271 records · Page 15
All sourcesNASA NTRSDOE OSTI
DOE OSTI2025

Additional considerations in analytical solution for time-dependent heat conduction in a three-dimensional multilayer sphere

This work presents an analytical method to solve the heat conduction equation in three dimensions for problems consisting of multilayer concentric spheres. The method can be used to treat time-varying heat conduction problems where the heat source that drives the transient is time-invariant. Equally applicable to all Poisson-type problems with concentric spherical geometry, the method consists of representing the solution as a summation of weighted eigenfunctions. The weights for each eigenfunction are computed algebraically. Previous work has already established the core constituents of the methodology. The current work augments the existing methods by including consideration of nonzero interface resistance between layers and explicit discussion on the boundary condition homogenization required to treat inhomogeneous problems. Also, two demonstration problems are presented. One demonstration problem is based on the method of manufactured solutions and therefore allows for comparison with exact expressions for the solution temperature distribution. The second, more complex, demonstration problem relies on the finite element method for comparisons. The expected convergence behavior is observed for both demonstration problems.

97 - MATHEMATICS AND COMPUTING↗
DOE OSTI2022

Modeling Down Syndrome Myeloid Leukemia by Sequential Introduction of GATA1 and STAG2 Mutations in Induced Pluripotent Stem Cells with Trisomy 21

Children with Down syndrome (DS) have a high risk for acute myeloid leukemia (DS-ML). Genomic characterization of DS-ML blasts showed the presence of unique mutations in GATA1, an essential hematopoietic transcription factor, leading to the production of a truncated from of GATA1 (GATA1s). GATA1s, together with trisomy 21, is sufficient to develop a pre-leukemic condition called transient abnormal myelopoiesis (TAM). Approximately 30% of these cases progress into DS-ML by acquisition of additional somatic mutations in a stepwise manner. We previously developed a model for TAM by introducing disease-specific GATA1 mutation in trisomy 21-induced pluripotent stem cells (iPSCs), leading to the production of N-terminally truncated short form of GATA1 (GATA1s). In this model, we used CRISPR/Cas9 to introduce a co-operating mutation in STAG2, a member of the cohesin complex recurrently mutated in DS-ML but not in TAM. Hematopoietic differentiation of GATA1 STAG2 double-mutant iPSC lines confirmed GATA1s expression and the loss of functional STAG2 protein, leading to enhanced production of immature megakaryocytic population compared to GATA1 mutant alone. Megakaryocyte-specific lineage expansion of the double-mutant HSPCs exhibited close resemblance to the DS-ML immunophenotype. Transcriptome analysis showed that GATA1 mutation resulted in downregulation of megakaryocytic and erythrocytic differentiation pathways and interferon α/β signaling, along with an upregulation of pathways promoting myeloid differentiation such as toll-like receptor cascade. The co-occurrence of STAG2 knockout partially reverted the expression of genes involved in myeloid differentiation, likely leading to enhanced self-renewal and promoting leukemogenesis. In conclusion, we developed a DS-ML model via hematopoietic differentiation of gene-targeted iPSCs bearing trisomy 21.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS2002

Coordinate late expression of trefoil peptide genes (pS2/TFF1 and ITF/TFF3) in human breast, colon, and gastric tumor cells exposed to X-rays

The trefoil factors (TFFs) are pleiotropic factors involved in organization and homeostasis of the gastrointestinal tract, estrogen responsiveness, inflammatory disorders, and carcinogenesis. In an earlier study using cDNA array technologies to identify new genes expressed in irradiated cell survivors, we isolated a cDNA clone corresponding to the reported human TFF1 gene (E. K. Balcer-Kubiczek et al., Int. J. Radiat. Biol., 75: 529-541, 1999). To determine whether expression of other TFFs is altered by ionizing radiation, we quantified changes in expression of TFF3 as well as TFF1 in RNA samples obtained from irradiated and control human tumor breast, colon, and gastric tumor cells and examined expression kinetics up to 2 weeks after irradiation. X-ray-induced TFF1 and TFF3 expression profiles were compared with those induced by hydrogen peroxide (H2O2) or 17beta-estradiol (ES). The results revealed that TFF1 and TFF3 mRNA are coinduced by X-irradiation in a subset of the lines, but substantial heterogeneity in their responses was observed in cells derived from a single cell type. TFF1 and TFF3 transcriptional response to X-irradiation differed from that to H2O2 or ES in the timing of their induction as well as tissue-type dependence, i.e., their induction pattern after X-irradiation was late and sustained, whereas their induction by H2O2 or ES was early and transient. TFF1 mRNA, protein production in the cytoplasm, and secretion in the culture supernatant were coordinately regulated after X-irradiation. There was no requirement for TP53 in this induction. These results demonstrate the existence of a novel class of radiation-responsive genes that might be involved in bystander effects.

Non-NASA Center↗
DOE OSTI2024

Reductive Dynamic and Static Excited State Quenching of a Homoleptic Ruthenium Complex Bearing Aldehyde Groups

A new homoleptic Ru polypyridyl complex bearing two aldehyde groups on each bipyridine ligand, [Ru(dab) 3 ](PF 6 ) 2 , where dab is 4,4′-dicarbaldehyde-2,2′-bipyridine, was synthesized, characterized, and utilized for iodide photo-oxidation studies. In acetonitrile (CH 3 CN) solution, the complex displayed an intense metal-to-ligand charge transfer (MLCT) absorbance maximum at 475 nm (ε = 22,000 M –1 cm –1 ) and an infrared (IR) band at 1712 cm –1 assigned to the pendent aldehyde groups. Visible light excitation in air-saturated solution resulted in room temperature photoluminescence (PL) with a maximum at 675 nm, a quantum yield, ϕ PL = 0.048, and an excited state lifetime, τ ο = 440 ns, from which radiative and nonradiative relaxation rate constants were extracted, k r = 9.1 × 10 4 s –1 and knr = 1.8 × 10 6 s –1 . Pulsed visible light excitation yielded transient UV–vis and IR absorption spectra consistent with an MLCT excited state; relaxation occurred with the maintenance of two isosbestic points in the visible region, and a lifetime that agreed with that measured by time-resolved PL. Cyclic voltammetry studies in a CH 3 CN solution with 0.1 M TBAPF 6 electrolyte revealed a quasi-reversible oxidation, E°(Ru III/II ) = +1.25 V vs. Fc +/0 , and three sequential one-electron reductions at −1.10, −1.25, and −1.54 V vs. Fc +/0 . Here, an excited state reduction potential of E°(Ru *2+/+ ) = +0.89 V vs. Fc +/0 was estimated with the Rehm–Weller expression. Titration of tetrabutylammonium iodide, TBAI, into a CD 3 CN solution of [Ru(dab) 3 ](PF 6 ) 2 resulted in significant shifts in the aldehyde H atom and 3,3′-biypridyl resonances that were analyzed with a 1:1 equilibrium model, from which K eq = 460 M –1 was extracted, increasing to 5800 M –1 when the solvent was changed to acetone-d 6 . Iodide titrations resulted in a significant quenching of the [Ru(dab) 3 ] *2+ lifetime and quantum yield in both CH 3 CN and acetone solvents. In CH 3 CN, the quenching was mainly dynamic and well described by the Stern–Volmer model, from which a quenching rate constant, k q , of 4.5 × 10 10 M –1 s –1 and an equilibrium constant, K eq , of 8.3 × 10 3 M –1 were obtained. In acetone, the static quenching pathway by iodide was greatly enhanced, with a K eq of 1.2 × 10 4 M –1 and a higher k q of 9.2 × 10 10 M –1 s –1 .

Aldehydes↗
DOE OSTI2024

Non-equilibrium rate theory for polariton relaxation dynamics

We derive an analytic expression of the non-equilibrium Fermi’s golden rule (NE-FGR) expression for a Holstein–Tavis–Cumming Hamiltonian, a universal model for many molecules collectively coupled to the optical cavity. These NE-FGR expressions capture the full-time-dependent behavior of the rate constant for transitions from polariton states to dark states. The rate is shown to be reduced to the well-known frequency domain-based equilibrium Fermi’s golden rule (E-FGR) expression in the equilibrium and collective limit and is shown to retain the same scaling with the number of sites in non-equilibrium and non-collective cases. We use these NE-FGR to perform population dynamics with a time-non-local and time-local quantum master equation and obtain accurate population dynamics from the initially occupied upper or lower polariton states. Furthermore, NE-FGR significantly improves the accuracy of the population dynamics when starting from the lower polariton compared to the E-FGR theory, highlighting the importance of the non-Markovian behavior and the short-time transient behavior in the transition rate constant.

Chemical dynamics↗
DOE OSTI2025

Bipolar transport in diamond under photo-excitation: Evidence of free charge scattering by excitons

The fundamental characteristics of the Coulomb e-h interactions in ultra-pure diamond are investigated through time-resolved photoconductivity measurements in homogeneously photoexcited samples with ohmic-like low resistive B + sandwich contacts. Here, we demonstrate that, in the electric field, the bipolar charge mobility exhibits drastic reduction for photo-injected densities of 10 14 ‐10 16 cm ‐3 that cannot be explained only by mutual scattering between free e-h particles. This phenomenon is clarified by adding scattering caused by excitons whose density grows in the photo-exited system. The comparison of drift mobilities at 300 K in diamond obtained in this study and in pure Si and Ge obtained from literature, where exciton scattering is insignificant, is presented. We derive the empirical expression for the density dependences of bipolar mobility for the electric fields up to 1 kV/cm that could be useful for the development of diamond electronic devices.

Bipolar drift↗
DOE OSTI2023

Atp7b-dependent choroid plexus dysfunction causes transient copper deficit and metabolic changes in the developing mouse brain

Copper (Cu) has a multifaceted role in brain development, function, and metabolism. Two homologous Cu transporters, Atp7a (Menkes disease protein) and Atp7b (Wilson disease protein), maintain Cu homeostasis in the tissue. Atp7a mediates Cu entry into the brain and activates Cu-dependent enzymes, whereas the role of Atp7b is less clear. We show that during postnatal development Atp7b is necessary for normal morphology and function of choroid plexus (ChPl). Inactivation of Atp7b causes reorganization of ChPl’ cytoskeleton and cell-cell contacts, loss of Slc31a1 from the apical membrane, and a decrease in the length and number of microvilli and cilia. In ChPl lacking Atp7b, Atp7a is upregulated but remains intracellular, which limits Cu transport into the brain and results in significant Cu deficit, which is reversed only in older animals. Cu deficiency is associated with down-regulation of Atp7a in locus coeruleus and catecholamine imbalance, despite normal expression of dopamine-β-hydroxylase. In addition, there are notable changes in the brain lipidome, which can be attributed to inhibition of diacylglyceride-to-phosphatidylethanolamine conversion. These results identify the new role for Atp7b in developing brain and identify metabolic changes that could be exacerbated by Cu chelation therapy.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS1991

Hot-spot tectonics of Eistla Regio, Venus: Results from Magellan images and Pioneer Venus gravity

Eistla Regio (ER) is a broad, low, discontinuous topographic rise striking roughly EW at low northern latitudes of Venus. Some 2000 x 7000 km in dimensions, it is the third largest rise in planform on Venus after Aphrodite Terra and Beta Phoebe Regiones. These rises are the key physiographic elements in a hot spot model of global tectonics including transient plume behavior. Since ER is the first such rise viewed by Magellan and the latitude is very favorable for Pioneer Venus gravity studies, some of the predictions of a time dependent hot spot model are tested. Western ER is defined as the rise including Gula and Sif Mons and central ER as that including Sappho Patera. Superior conjunction prevented Magellan from returning data on eastern ER (Pavlova) during the first mapping cycle. It is concluded that the western and central portions of ER, while part of the same broad topographic rise and tectonic framework, have distinctly different surface ages and gravity signatures. The western rise, including Gula and Sif Mons, is the expression of deep seated uplift with volcanism limited to the individual large shields. The eastern portion has been widely resurfaced more recently by thermal anomalies in the mantle.

Grimm, Robert E.↗
NASA NTRS2005

The Effect of Impacts on the Martian Climate

Evidence for the presence of liquid water early in Mars history continues to accumulate. The most recent evidence for liquid water being pervasive early in Mars history is the discoveries of sulfate and gypsum layers by the Mars Exploration Rovers and Mars Express. However, the presence of liquid water at the surface very early in Mars history presents a conundrum. The early sun was most likely approximately 75% fainter than it is today. About 65-70 degrees of greenhouse warming is needed to bring surface temperatures to the melting point of water. To date climate models have not been able to produce a continuously warm and wet early Mars. This may be a good thing as there is morphological and mineralogical evidence that the warm and wet period had to be relatively short and episodic. The rates of erosion appear to correlate with the rate at which Mars was impacted thus an alternate possibility is transient warm and wet conditions initiated by large impacts. It is widely accepted that even relatively small impacts (approximately 10 km) have altered the past climate of Earth to such an extent as to cause mass extinctions. Mars has been impacted with a similar distribution of objects. The impact record at Mars is preserved in the abundance of observable craters on it surface. Impact induced climate change must have occurred on Mars.

Colaprete, A.↗
NASA NTRS1980

Light flash phenomena induced by HzE particles

Astronauts and Apollo and Skylab missions have reported observing a variety of visual phenomena when their eyes are closed and adapted to darkness. These phenomena have been collectively labelled as light flashes. Visual phenomena which are similar in appearance to those observed in space have been demonstrated at the number of accelerator facilities by expressing the eyes of human subjects to beams of various types of radiation. In some laboratory experiments Cerenkov radiation was found to be the basis for the flashes observed while in other experiments Cerenkov radiation could apparently be ruled out. Experiments that differentiate between Cerenkov radiation and other possible mechanisms for inducing visual phenomena was then compared. The phenomena obtained in the presence and absence of Cerenkov radiation were designed and conducted. A new mechanism proposed to explain the visual phenomena observed by Skylab astronauts as they passed through the South Atlantic Anomaly, namely nuclear interactions in and near the sensitive layer of the retina, is covered. Also some studies to search for similar transient effects of space radiation on sensors and microcomputer memories are described.

Mcnulty, P. J.↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Combining genome-wide association studies and expression quantitative trait nucleotide mapping with molecular and genetic validations to identify transcriptional networks regulating drought tolerance in Populus

Objectives: (i). To deploy a large-scale experimental drought trial for up to 1000 unique genotypes of Populus equipping the sites with controlled irrigation and drought treatments that are fully automated and monitored. FULLY COMPLETED (ii) To test the hypothesis that a suite of traits identified for drought tolerance in P. nigra can be measured in drought and control treatments in the wide germplasm collection of P. trichocarpa. FULLY COMPLETED (iii) To use established and novel GWAS model approaches to identify gene loci linked to drought tolerance traits on interest in P. trichocarpa. FULLY COMPLETED (iv) To undertake comparative analysis of GWAS results for drought tolerance traits in P. nigra and P. trichocarpa. PARTIALLY COMPLETED – remains active (v) Using RNAseq in P. trichocarpa, in droughted and control treatments to identify cis- and trans-regulated eQTN. FULLY COMPLETED (vi) Validate up to 50 cis-QTNs, from network hubs using transient protoplast assays. FULLY COMPLETED (vii) To establish Agrobacterium-based gene editing protocols in Populus. FULLY COMPLETED (viii) To utilize early leads from previous research to investigate at least 6 candidate genes for drought tolerance in Populus. FULLY COMPLETED (ix) To validate up to 20 candidate genes for drought tolerance in P. trichocarpa refined from the long-list tested in the transient assays for cis-acting hub gene targets. PARTIALLY COMPLETED- remains active.

60 APPLIED LIFE SCIENCES↗
NASA NTRS1987

Gyroresonant pitch angle scattering by coherent and incoherent whistler mode waves in the magnetosphere

A test particle approach is used to compare gyroresonant pitch angle scattering of energetic electrons by coherent versus incoherent whistler mode waves, for the case in which the coherent wave amplitude is below the nonlinear phase trapping threshold. Wave packets of 400 ms duration propagating along the magnetic field at L = 4 within the plasmasphere are considered, and the wave-induced pitch angle scattering along the propagation path from one hemisphere to the other and the resulting precipitation flux are computed. An incoherent wave spectrum is simulated by random modulation of the wave frequency at intervals of 1 ms, thereby generating signals with nearly constant power spectral density over a bandwidth of 2 kHz centered at 5.5 kHz. The associated pitch angle scattering is compared with that of a monochromatic 5.5-kHz signal of 400 ms duration. Results of the test particle analysis are compared with those expected on the basis of a classical diffusion treatment, and an expression is derived for an effective “diffusion” coefficient for pitch angle scattering by coherent waves. The trajectory followed by a particle when interacting with incoherent waves essentially represents a random walk in velocity space, while for coherent waves the pitch angle of the particle varies in a well-defined manner. In spite of the fact that individual particle scatterings are typically larger for coherent waves, the peak precipitation fluxes induced by incoherent waves are found to be approximately the same as those for coherent waves having the same total power. This results from the fact that incoherent waves interact with particles over a wider range of energies. As a consequence, the energy spectrum and the temporal extent of transient precipitation pulses due to incoherent wave packets are broader than those for equivalent coherent ones.

Umran S Inan↗
NASA NTRS2001

Space flight affects magnocellular supraoptic neurons of young prepuberal rats: transient and permanent effects

Effects of microgravity on postural control and volume of extracellular fluids as well as stress associated with space flight may affect the function of hypothalamic neurosecretory neurons. Since environmental modifications in young animals may result in permanent alterations in neuroendocrine function, the present study was designed to determine the effect of a space flight on oxytocinergic and vasopressinergic magnocellular hypothalamic neurons of prepuberal rats. Fifteen-day-old Sprague-Dawley female rats were flown aboard the Space Shuttle Columbia (STS-90, Neurolab mission, experiment 150) for 16 days. Age-matched litters remained on the ground in cages similar to those of the flight animals. Six animals from each group were killed on the day of landing and eight animals from each group were maintained under standard vivarium conditions and killed 18 weeks after landing. Several signs of enhanced transcriptional and biosynthetic activity were observed in magnocellular supraoptic neurons of flight animals on the day of landing compared to control animals. These include increased c-Fos expression, larger nucleoli and cytoplasm, and higher volume occupied in the neuronal perikaryon by mitochondriae, endoplasmic reticulum, Golgi apparatus, lysosomes and cytoplasmic inclusions known as nematosomes. In contrast, the volume occupied by neurosecretory vesicles in the supraoptic neuronal perikarya was significantly decreased in flight rats. This decrease was associated with a significant decrease in oxytocin and vasopressin immunoreactive levels, suggestive of an increased hormonal release. Vasopressin levels, cytoplasmic volume and c-Fos expression returned to control levels by 18 weeks after landing. These reversible effects were probably associated to osmotic stimuli resulting from modifications in the volume and distribution of extracellular fluids and plasma during flight and landing. However, oxytocin levels were still reduced at 18 weeks after landing in flight animals compared to controls. This indicates that space flight during prepuberal age may induce irreversible modifications in the regulation of oxytocinergic neurons, which in turn may result in permanent endocrine and behavioral impairments.

NASA Experiment Number 9301150↗
DOE OSTI2022

Kinetic Model for Moisture-Controlled CO 2 Sorption

The understanding of the sorption/desorption kinetics is essential for practical applications of moisture-controlled CO 2 sorption. We introduce an analytic model of the kinetics of moisture-controlled CO 2 sorption and its interpretation in two limiting cases. In one case, chemical reaction kinetics on pore surfaces dominates, in the other case, diffusive transport through the sorbent defines the kinetics. Here, we show that reaction kinetics, which is dominant in the first case, can be expressed as a linear combination of 1st and 2nd order kinetics in agreement with the static isotherm equation derived and validated in a previous paper. The interior transport kinetics can be described by non-linear diffusion equations. By combining all carbon species into a single equation, we can eliminate — in certain limits — the source terms associated with chemical reactions. In this case, the governing equation is ∂θ/∂t = –∇ · (–D eff ∇ θ ). For a sorbent in a form of a flat sheet or a membrane, one can maintain the same functional form of a diffusion equation by introducing a generalized effective diffusivity D M that combines contributions from both surface chemical reaction kinetics and interior diffusive transport kinetics. Experimental data of transient CO 2 flux in a preconditioned commercial anion exchange membrane fit well to the 1st order model as long as very dry states are avoided, validating the theory. The observed DM for a preconditioned commercial anion exchange membrane ranges from 6.6× 10 -14 to 7.1× 10 -14 m 2 s -1 at 35°C. These small values compared to typical ionic diffusivities imply a very slow kinetics, which will be the largest issue that needs to be addressed for practical application. The collected transient CO 2 flux data are used to predict the magnitude of a continuous CO 2 pumping flux in an active membrane that transports CO 2 against a CO 2 concentration gradient. The pumped CO 2 flux is supported by water flux due to a water concentration gradient.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
NASA NTRS2000

Prostaglandin E2-induced up-regulation of c-fos messenger ribonucleic acid is primarily mediated by 3',5'-cyclic adenosine monophosphate in MC3T3-E1 osteoblasts

The mechanism by which the proto-oncogene, c-fos, is up-regulated in response to PGE2 in the mouse osteoblastic (MC3T3-E1) cell line was investigated using RT-PCR. c-fos messenger RNA up-regulation by dmPGE2 is rapid, starting 10 min post stimulation, and transient. The specific protein kinase A (PKA) inhibitor, H89, inhibited c-fos induction. Moreover, down-regulation of protein kinase C (PKC) activity by chronic TPA treatment had no effect on the induction of c-fos by dmPGE2. We conclude that up-regulation of c-fos by dmPGE2 is primarily dependent on PKA in MC3T3-E1 osteoblasts. In S49 lymphoma wild-type but not S49 cyc- cells, which are deficient in cAMP signaling, dmPGE2 up-regulates c-fos and increases cell growth compared with unstimulated cells. Thus in S49 lymphoma cells, c-fos induction by PGE2 is also dependent on cAMP signaling. The minimal c-fos promoter region required for dmPGE2-induced expression was identified by transfecting c-fos promoter deletion constructs coupled to the chloramphenicol acetyltransferase (CAT) reporter gene into Vero cells. Transfection of a plasmid containing 99 bp c-fos proximal promoter was sufficient to direct c-fos/CAT expression following stimulation with dmPGE2. Because induction of c-fos is mediated by cAMP, these data are consistent with activation of c-fos via the CRE/ATF cis element.

NASA Discipline Cell Biology↗
DOE OSTI2021

Analysis and design of DC-link capacitor in cascaded H-bridge multilevel active front-end converter

Medium-voltage grid-tied systems often use a cascaded H-bridge multi-level active front-end. In this converter, dc link bus capacitors play an important role in stabilizing the converter and enabling both active and reactive power injections. The present work provides analytical expressions for the capacitor current, which are essential for optimizing system design (especially capacitor size vs. lifetime). Then, the expression is incorporated into the grid connected bidirectional power system model. Consequently, this work contributes to the guiding principles to choose accurate dc link capacitor ratings against grid-side power delivery requirements. DC-link capacitors come with an expiration date which is dependent on the operating power and voltage values. Lack of information about the lifetime of the dc-link capacitor creates uncertainty in the duration of online operation of the converter, thus increasing the probability of a contingency outage. The lifetime of the capacitor can range from only a few seconds of online operation of the station due to under-sizing, to a compromised quality of power flowing through other solid state devices which may not have been designed for the transients that are caused by over-sizing of the dc-link capacitor. A better estimate of the lifetime of these capacitors can help maximize usage and maintain scheduled outages more efficiently, without disruption in service.

24 POWER TRANSMISSION AND DISTRIBUTION↗
DOE OSTI2025

Kölliker's Organ Functions as a Developmental Hub in Mouse Cochlea Regulating Spiral Limbus and Tectorial Membrane Development

Kölliker's organ is a transient developmental structure in the mouse cochlea that undergoes significant remodeling postnatally. Utilizing an epithelial-specific conditional deletion mouse model of Prdm16 (marker and regulator of Kölliker's organ), we show that Prdm16 is required for interdental cell development, and thereby the development of the limbal domain of the tectorial membrane and its medial anchorage to the spiral limbus. Additionally, we show that Kölliker's organ is involved in normal tectorial membrane collagen fibril development and maturation. Interestingly, mesenchymal cells of the spiral limbus underneath Prdm16 -deficient Kölliker's organ failed to produce interstitial matrix proteins, resulting in a hypoplastic and truncated spiral limbus, indicating a non-cell autonomous role of Prdm16 in regulating spiral mesenchymal matrix development. Single-cell RNA sequencing identified differentially expressed genes in Prdm16 -deficient Kölliker's organ suggesting a role for connective tissue growth factor (CTGF) downstream Prdm16 in epithelial-mesenchymal signaling involved in spiral limbus matrix deposition. Prdm16 -deficient mice showed a hearing deficit, as indicated by elevated auditory brainstem response thresholds at most frequencies, consistent with the cochlear structural defects. Both sexes were studied. This work establishes Prdm16 as a deafness gene in mice through its role in regulating Kölliker's organ development. Such understanding recognizes Kölliker's organ as a developmental hub regulating multiple surrounding cochlear structures.

Zhang, Hongji↗