SEARCH · Search NASA

Results for “induced”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 271 records · Page 15

All sources NASA NTRS DOE OSTI

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2023

Strain-switchable field-induced superconductivity

Field-induced superconductivity is a rare phenomenon where an applied magnetic field enhances or induces superconductivity. Here, we use applied stress as a control switch between a field-tunable superconducting state and a robust non–field-tunable state. This marks the first demonstration of a strain-tunable superconducting spin valve with infinite magnetoresistance. We combine tunable uniaxial stress and applied magnetic field on the ferromagnetic superconductor Eu(Fe 0.88 Co 0.12 ) 2 As 2 to shift the field-induced zero-resistance temperature between 4 K and a record-high value of 10 K. We use x-ray diffraction and spectroscopy measurements under stress and field to reveal that strain tuning of the nematic order and field tuning of the ferromagnetism act as independent control parameters of the superconductivity. Combining comprehensive measurements with DFT calculations, we propose that field-induced superconductivity arises from a novel mechanism, namely, the uniquely dominant effect of the Eu dipolar field when the exchange field splitting is nearly zero.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗

DOE OSTI2024

MIP-4 is Induced by Bleomycin and Stimulates Cell Migration Partially via Nir-1 Receptor

Background. CC-chemokine ligand 18 also known as MIP-4 is a chemokine with roles in inflammation and immune responses. It has been shown that MIP-4 is involved in the development of several diseases including lung fibrosis and cancer. How exactly MIP-4 is regulated and exerts its role in lung fibrosis remains unclear. Therefore, in the present study, we examined how MIP-4 is regulated and whether it acts via its potential receptor Nir-1. Materials and Methods. A549 cells were grown and maintained in DMEM : F12 (1 : 1) and supplemented with 10% FBS and 1000 U of penicillin/streptomycin and maintained as recommended by the manufacturer (ATCC). Cell migration and invasion, immunohistochemistry (IHC), Western blot, qPCR, and siRNA Nir-1 were used to determine MIP-4 regulation and its role in cell migration. Results. Cell migration was increased following stimulation of cells with recombinant (r) MIP-4 and bleomycin (BLM), whereas quenching rMIP-4 with its antibody (Ab) or addition of the Ab to BLM or H 2 O 2 diminished rMIP-4-induced cell migration. Along with cell migration, rMIP-4, BLM, and H 2 O 2 induced the formation of actin filaments dynamic structures whereas costimulation with MIP-4 Ab limited BLM- and H 2 O 2 -induced effects. MIP-4 mRNA and protein were increased by BLM and H 2 O 2 , and the addition of its Ab significantly reduced treatments effect. Experiments with siRNA investigating whether Nir-1 is a potential MIR-4 receptor indicated that the inhibition of Nir-1 decreased cell migration/invasion but did not totally inhibit rMIP-4-induced cell migration. Conclusion. Therefore, our data indicate that MIP-4 is regulated by BLM and H 2 O 2 and costimulation with its Ab limits the effects on MIP-4 and that the Nir-1 receptor partially mediates MIP-4’s effects on increased cell migration. These data also evidenced that MIP-4 is regulated by fibrotic and oxidative stimuli and that quenching MIP-4 with its Ab or therapeutically targeting the Nir-1 receptor may partially limit MIP-4 effects under fibrotic or oxidative stimulation.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗

DOE OSTI2023

Stronger Tropical Cyclone–Induced Ocean Cooling in Near-Coastal Regions Compared to the Open Ocean

Abstract Tropical cyclones (TC) often induce strong mixing in the upper ocean that generates a trail of cooler sea surface temperature (Twake) in their wakes. The Twake can affect TC intensity, so its prediction is important, especially in coastal regions where TCs can make landfall. Coastal Twakes are often more complex than those in the open ocean due to the influences of coastline geometry, highly variable water depth, continental runoff, and shelf processes. Using observational data since 2002, here we show a significantly stronger global mean Twake in coastal regions compared to offshore regions. Temperature stratification is the main driver of stronger coastal Twakes in the North Atlantic and east Pacific. In the northwest Pacific and north Indian Ocean, the differences between coastal and offshore Twakes are smaller due to compensation between TC forcings and ocean stratification. The north Indian Ocean is unique in the Northern Hemisphere because salinity stratification plays a major role on the spatial distribution of Twake. In the South Pacific Ocean, TC intensity and translation speed are crucial for explaining coastal–offshore Twake differences, while ocean stratification and mixed layer depth are more important for the coastal–offshore Twake differences in the south Indian Ocean. These findings suggest that coastal–offshore differences in ocean stratification need to be properly represented in models in order to capture changes in TC-induced ocean cooling as storms approach landfall. Significance Statement Landfalling tropical cyclones (TCs) often cause considerable damage in coastal regions with dense human populations. Understanding TC–ocean interaction and how it differs between coastal and offshore regions can help predict TC intensity prior to landfall. Sea surface cooling after TC passage is an important proxy for TC–ocean interaction. A global evaluation of coastal TC-induced cooling has not been conducted. Using data covering two decades, we show significantly stronger TC-induced surface cooling in coastal regions compared to offshore regions at the global scale and in all basins except the northwest Pacific and north Indian Ocean. The difference is driven mainly by upper-ocean conditions in the North Atlantic, east Pacific, and south Indian Ocean, and by TC characteristics in the South Pacific.

54 ENVIRONMENTAL SCIENCES↗

DOE OSTI2024

Effects of fire and fire-induced changes in soil properties on post-burn soil respiration

Boreal forests cover vast areas of land in the northern hemisphere and store large amounts of carbon (C) both aboveground and belowground. Wildfires, which are a primary ecosystem disturbance of boreal forests, affect soil C via combustion and transformation of organic matter during the fire itself and via changes in plant growth and microbial activity post-fire. Wildfire regimes in many areas of the boreal forests of North America are shifting towards more frequent and severe fires driven by changing climate. As wildfire regimes shift and the effects of fire on belowground microbial community composition are becoming clearer, there is a need to link fire-induced changes in soil properties to changes in microbial functions, such as respiration, in order to better predict the impact of future fires on C cycling. We used laboratory burns to simulate boreal crown fires on both organic-rich and sandy soil cores collected from Wood Buffalo National Park, Alberta, Canada, to measure the effects of burning on soil properties including pH, total C, and total nitrogen (N). We used 70-day soil incubations and two-pool exponential decay models to characterize the impacts of burning and its resulting changes in soil properties on soil respiration. Laboratory burns successfully captured a range of soil temperatures that were realistic for natural wildfire events. We found that burning increased pH and caused small decreases in C:N in organic soil. Overall, respiration per gram total (post-burn) C in burned soil cores was 16% lower than in corresponding unburned control cores, indicating that soil C lost during a burn may be partially offset by burn-induced decreases in respiration rates. Simultaneously, burning altered how remaining C cycled, causing an increase in the proportion of C represented in the modeled slow-cycling vs. fast-cycling C pool as well as an increase in fast-cycling C decomposition rates. Together, our findings imply that C storage in boreal forests following wildfires will be driven by the combination of C losses during the fire itself as well as fire-induced changes to the soil C pool that modulate post-fire respiration rates. Moving forward, we will pair these results with soil microbial community data to understand how fire-induced changes in microbial community composition may influence respiration.

54 ENVIRONMENTAL SCIENCES↗

DOE OSTI2020

The role of irradiation on deformation-induced martensitic phase transformations in face-centered cubic alloys

Localized deformation, including that by the deformation-induced shearing martensitic phase transformation, is responsible for hardening and embrittlement in irradiated face-centered cubic alloys. These localized deformation processes can have profound consequences on the mechanical integrity of common structural metals used in extreme radiation environments such as nuclear reactors. This article aims to review and understand exactly how irradiation affects the martensitic phase transformation in face-centered cubic alloys, with an emphasis on austenitic stainless steel, given its ubiquity in the archival literature. The influence of irradiation on stacking fault energy and subsequent implications on the phase transformation are discussed. Mechanisms by which irradiation-induced microstructures enhance the phase transformation are also described, including the surface energy contribution of irradiation-induced cavities (i.e., voids and bubbles) toward the critical martensite nucleation energy, and partial dislocation–cavity interactions. In conclusion, a deformation mechanism map illustrates how irradiation-induced cavities can modulate the martensitic transformation pathway.

36 MATERIALS SCIENCE↗

DOE OSTI2023

Flow Induced Vibration Studies in Pressurized Helium Gas Cooling Channels

Production of metastable Technetium-99 (Tc-99m), a radioactive tracer that emits gamma rays, is vital to the medical imaging community. Tc-99m is extracted from the decay of Molybdenum-99 (Mo-99) which has a half-life of about 2-3 days. The work presented in this report is part of the NNSA’s mission to produce Mo-99 commercially, within the US, without the use of highly enriched uranium (HEU) in support of nonproliferation and global security. Los Alamos National Laboratory (LANL) is working with NorthStar Medical Radioisotopes (NMR) on their efforts to produce Mo-99 through the irradiation of Mo-100 targets using an electron beam. The NMR target comprises a stack of approximately 60-70 Mo-100 disks with diameter 24 mm and thickness 0.74 mm held in stainless steel laminations, each separated using 0.25 mm thick stainless steel spacers. The symmetric target stack is housed in an Inconel vessel with two Inconel windows on either side. Two electron accelerators are used to produce 40 MeV, 3.16 µA electron beams each that penetrate the Inconel windows and irradiate the Mo-100 disks. Approximately 90% of the total 250 kW beam power is deposited in the NMR target during the irradiation process. During irradiation, pressurized helium gas flows through 0.25 mm thin gaps between the disks cooling the beam window, target disks, disk laminations and spacers. Both NMR and LANL have found during cold testing of the target system (no heat deposition) that the Mo-100 disks undergo significant mass loss and disk breakage due to vibrations induced by the flowing helium gas. The mass loss is not only undesirable due to monetary loss from reduced final quantities of Mo-99, but also due to the hazards associated with radioactive material trapped in the cooling lines and particle filters. The effect of flow rate and target geometry on the flow induced vibrations need to be quantified, and recommendations provided to minimize this mass loss. This work describes LANL’s experimental characterization of the flow induced vibrations and disk mass loss in a reduced scale set-up containing 10 Mo-100 disks. We use high speed imaging, displacement measurements and microphone measurements combined with signal processing to estimate the vibration frequency of each disk. The effect of disk thickness, target fit and duration of testing on the mass loss is described. We find that in the current configuration of NMR targets, the vibrations and mass loss on the first disk are minimized, while those in the adjacent disks are highest. The microphone and high-speed image data show that increased flow rates and increased duration of testing increases vibration frequency and mass loss. The mass loss is due to both disk rotation and back and forth motion. There are visible wear marks on the disks with the highest mass loss. We also note that the current NMR window gap reduces flow induced vibrations compared to the previous smaller gaps. Longer duration testing will provide more data and verification for the findings presented in this report. The work will be continued in FY 24.

43 PARTICLE ACCELERATORS↗

DOE OSTI2021

Determination of Thermal Expansion, Defect Formation Energy, and Defect-Induced Strain of α-U Via ab Initio Molecular Dynamics

Uranium (U) is often alloyed with molybdenum (Mo) or zirconium (Zr) in order to stabilize its high-temperature body-centered cubic phase for use in nuclear reactors. However, in all metallic fuel forms, the α phase of U remains in some fraction. This phase decomposition due to temperature or compositional variance can play an outsized role on fuel performance and microstructural evolution. Relatively little is known about fundamental point defect properties in α -U at non-zero temperatures, from either computational or experimental studies. This work performs the first thorough evaluation of the α phase of U via ab initio molecular dynamics (AIMD). A number of thermophysical properties are calculated as a function of temperature, including equilibrium lattice parameters, thermal expansion, and heat capacity. These results indicate a two-region behavior, with the transition at 400 K. The thermal expansion/contraction in the a / b direction occurs rapidly from 100 up to 400 K, after which a more linear and gradual change in the lattice constant takes place. The volumetric expansion matches experiments quantitatively, but the individual lattice constant expansion only matches experiments qualitatively. Point defect formation energies and induced lattice strains are also determined as a function of temperature, providing insight on defect populations and the fundamentals of irradiation growth in α -U. Interstitials induce significantly more strain than vacancies, and the nature of that strain is highly dependent on the individual lattice directions. The direction of point defect-induced lattice strain is contrary to the irradiation growth behavior of α -U. This work shows that isolated point defects cannot be the primary driving force responsible for the significant irradiation-induced growth of α -U observed experimentally.

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗

DOE OSTI2023

Early life stress induces irritable bowel syndrome from childhood to adulthood in mice

Background Irritable bowel syndrome (IBS) is one of the most common functional gastrointestinal disorder. Traditionally, early life stress (ELS) is predisposed to IBS in adult. However, whether ELS induces IBS in early life remains unclear. Methods Separated cohort studies were conducted in neonatal male pups of C57BL/6 mice by maternal separation (MS) model. MS and non-separation mice were scheduled to be evaluated for prime IBS-phenotypes, including visceral hypersensitivity, intestinal motility, intestinal permeability, and anxiety-like behavior. Ileal contents and fecal samples were collected and analyzed by 16S rRNA gene sequencing and bacterial community analyses. Subcellular structures of intestinal epithelial, such as epithelial tight junctions and mitochondria, were observed under transmission electron microscopy. Results MS induced visceral hypersensitivity and decreased total intestinal transit time from childhood to adulthood. In addition, MS induced intestinal hyperpermeability and anxiety-like behavior from adolescence to adulthood. Besides, MS affected intestinal microbial composition from childhood to adulthood. Moreover, MS disrupted intestinal mitochondrial structure from childhood to adulthood. Conclusion The study showed for the first time that MS induced IBS from early life to adulthood in mice. The disrupted intestinal mitochondrial structure and the significant dysbiosis of intestinal microbiota in early life may contribute to the initiation and progress of IBS from early life to adulthood.

Tao, Enfu↗

DOE OSTI2024

Overexpression of the Mas1 gene mitigated LPS-induced inflammatory injury in mammary epithelial cells by inhibiting the NF-κB/MAPKs signaling pathways

Breast infection is the primary etiology of mastitis in dairy cows, leading to a reduction in the quality of dairy products and resulting in substantial economic losses for animal husbandry. Although antibiotic treatment can eliminate the pathogenic microorganisms that induce mastitis, it cannot repair the inflammatory damage of mammary epithelial cells and blood milk barrier. Mas1 is a G protein-coupled receptor, and its role in lipopolysaccharide (LPS) -induced inflammatory injury to mammary epithelial cells has not been studied. LPS treatment of EpH4 EV cells led to a significant downregulation of Mas1 transcript levels, which attracted our great interest, suggesting that Mas1 may be an important target for the treatment of mastitis. Therefore, this study intends to verify the role of Mas1 in the inflammatory injury of EpH4 EV cells by gene overexpression technology and gene silencing technology. The findings demonstrated that the overexpression of the Mas1 gene effectively reversed the activation of the nuclear factor-κB/mitogen-activated protein kinase (NF-κB/MAPK) signaling pathways induced by LPS, while also suppressing the upregulation of pro-inflammatory mediators. Furthermore, overexpression of the Mas1 gene reversed the downregulation of zonula occludens 1 (ZO-1), Occludin, and Claudin-3 caused by LPS, suggesting that Mas1 could promote to repair the blood-milk barrier. However, the silencing of the Mas1 gene using siRNA resulted in a contrasting effect. These results indicated that Mas1 alleviated the inflammatory injury of mammary epithelial cells induced by LPS.

Yan, Shuping↗

DOE OSTI2022

Mechanisms of Mitigating Chloride-Induced Stress Corrosion Cracking of Austenitic Steels by Laser Shock Peening

This study investigates the effect of laser shock peening (LSP) on the chloride-induced stress corrosion cracking (SCC) of 304 austenitic steels. LSP can induce a high compressive residual stress to a depth of 700 µm and plastic deformation structures of dislocations, deformation twins, and stacking faults. Constant-load SCC tests in MgCl2 solution suggested that LSP can retard the crack initiation and slow the crack growth. LSP-treated subsurface layers experience ductile fracture while the central regions exhibit intergranular SCC. The LSP-induced deformation structures may impede dislocation slips, while the LSP-induced compressive residual stress can lessen the stress intensity factor of crack tips and decrease the local stress for film rupture.

Materials Science↗

DOE OSTI2020

Methods of designing programmable inducible promoters

Described herein is a method for identifying synthetic inducible promoters that have specified induction and/or repression for DNA binding proteins such as an allosteric transcription factor and an inducer molecule. The method includes an in vitro selection from an unselected polynucleotide library comprising a plurality of random degeneracies, and an in vivo selection to produce an induced promoter library. Produced is an induction table, which allows the selection of a promoter with specific induction and/or repression properties. Also included are biosensors containing the synthetic inducible promoters.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗

DOE OSTI2021

Experimental Investigation of Polymer Induced Fouling of Heater Tubes in the First-Ever Polymer Flood Pilot on Alaska North Slope

Mineral fouling in heat exchangers has been extensively investigated by researchers in recent times. The oil and gas industry has a long history of fouling issues in production systems as a result of produced fluids treatment. Due to decline in production rates in oilfields new technologies are being developed and field tested in pilots. Polymer flooding is one such technology that involves addition of polymers to injection fluids to enhance oil production. A polymer flood pilot has been set up in the Schrader Bluff viscous oil reservoir at Milne Point field on the Alaska North Slope (ANS). The results from the pilot are encouraging, however a major concern of the operator is the influence of polymer on the production system after breakthrough, especially the fouling in heat exchangers. This study investigates the propensity of polymer fouling on the heater tubes as a function of different variables, with the ultimate goal of determining safe and efficient operating conditions. This work applies a multi-experimental approach to study the severity of polymer-induced fouling in both dynamic and static states of produced fluids as well as studying the stability of polymer solutions at different temperatures. A unique experimental setup was designed and developed in-house to simulate the fouling process on the heating tube. The influence of heating tube skin temperature, tube material, and polymer concentration on fouling tendency was investigated. Each test was run five times with the same tube, and in each run, the freshly prepared synthetic brine and polymer solution was heated from 77°F to 122°F to mimic field-operating conditions. The heating time and fouling amount were recorded for each run. Dynamic Scale Loop (DSL) tests were conducted to study fouling due to polymer at different temperatures (165°F to 350°F) in a dynamic state of fluid flow where the fluids mimic the residence time of fluids in the heat exchanger on the field pilot. Cloud point measurement has also been conducted to find the critical temperature at which the polymer in solution becomes unstable and precipitates out. The morphology and composition of the deposit samples were analyzed by environmental scanning electron microscopy (ESEM) and X-ray diffraction (XRD), respectively. It was found that the presence of polymer in produced fluids would aggravate the fouling issues on both carbon steel and stainless-steel surfaces at all tested skin temperatures. Only higher skin temperatures of 250°F and 350°F could cause polymer-induced fouling issues on the copper tube surface, and the fouling tendency increased with polymer concentration. At the lower skin temperatures of 165°F, no polymer-induced fouling was identified on the copper tube. A critical temperature that is related to the cloud point of the polymer solution was believed to exist, below which polymer-induced fouling would not occur, and only mineral scale was deposited but above which the polymer would aggravate the fouling issue. The cloud point of the tested polymer solution was determined to be between 220°F and 230°F. In the DSL tests it was found that at higher skin temperatures of 250°F and 350°F tube blocking was observed in the DSL tests whereas the tests at 165°F and 200°F did not show any tube blocking in the same time period. These experiments also manifested the influence of cloud point of the solution as deposit rate increased significantly in both carbon steel and stainless-steel tubes when the skin temperature was higher than the solution cloud point. The results of this study have provided guidance to the operator for the field-operations.

Dhaliwal, Anshul↗

DOE OSTI2024

The Role of Radiation-Induced Non-Equilibrium Plutonium Oxidation States in Solution

Plutonium plays a key role in global actinide research and nuclear fuel cycle technologies, and yet, our fundamental understanding of its inherent radiation-induced chemical behavior is limited. These radiation-induced processes cannot simply be switched off, as they are as fundamentally inherent to plutonium as the impact of relativistic effects on its f-electrons. In less chemically complex actinide systems, such as aqueous solutions of neptunium and americium, both steady-state and transient radiolysis products play a significant role in the redox cycling of their oxidation states, which ultimately impacts their chemistry and transport. However, plutonium's multiple, coexisting, and chemically active oxidation states, which comprise of bare ions and dioxo cations, provide additional redox pathways that complicate the aforementioned radiation-induced competition kinetics. Mechanistically understanding the response of these multiple oxidation states, both equilibrium and non-equilibrium, to intense ionizing radiation fields is essential for predicting the behavior of plutonium under a host of conditions that support technological innovation in global nuclear energy and non-proliferation efforts. Here, advances in radiation-induced plutonium solution chemistry will be presented, including new results from time-resolved electron pulse and steady-state gamma and alpha irradiations.

38 RADIATION CHEMISTRY, RADIOCHEMISTRY, AND NUCLEA↗

DOE OSTI2024

Elucidating the Radiation-Induced Redox Chemistry of Plutonium Under Used Nuclear Fuel Reprocessing Conditions

Plutonium plays a critical role in the development of sustainable nuclear fuel cycles, and yet, our fundamental understanding of this element’s inherent radiation-induced redox chemistry and associated impacts on nuclear fuel cycle technologies is limited. Unanticipated changes in oxidation state distribution can influence the speciation and transport of plutonium in a given process. Control of these parameters is especially important for used nuclear fuel reprocessing technologies, wherein the separation and recovery of plutonium is typically achieved by the selective formation, maintenance, and complexation of specific oxidation states. Furthermore, plutonium’s inherent radiation-induced redox chemistry has the capacity to influence the radiolytic behavior of its complexes, the longevity of which are critical in the design of efficient and cost-effective advanced reprocessing technologies. These radiation-induced processes are unavoidable under fuel cycle conditions owing to the inherency of ionizing radiation fields to the decay of plutonium’s isotopes and to the various other radioisotopes generated by nuclear fission and neutron-capture process and the subsequent radioactive decay of their products. As such, mechanistically understanding the response of plutonium’s multiple oxidation states to multi-component ionizing radiation fields is essential for predicting the behavior of this critical element under used nuclear fuel reprocessing conditions. Here, through a combination of time-resolved (electron pulse) and steady-state (alpha and gamma) irradiation experiments complemented by quantitative, multiscale modeling calculations, we present advances in our understanding of radiation-induced plutonium redox chemistry!

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗

DOE OSTI2024

Predicting Radiation-Induced Plutonium Redox Chemistry using Multi-scale Modeling Methods

Over the the last 70 years plutonium (Pu) has been integral in the development of several technologies that have changed the world, yet our fundamental understanding of its chemistry is still far from complete. This is a testament to this element’s unique and complex properties, such as its ability to coexist as multiple oxidation states in aqueous solution. Careful manipulation of plutonium oxidation states is essential in the study and utilization of its rich chemistry. To achieve this level of control, a comprehensive mechanistic understanding of radiation-induced plutonium redox chemistry is critical due to the unavoidable exposure of plutonium to ionizing radiation fields, both inherent and from in-process applications. For this reason, we have developed an experimentally evaluated multi-scale computer model for the prediction of gamma radiation-induced Pu(IV) redox chemistry in concentrated nitric acid solutions (1.0, 3.0, and 6.0 M). Under these acidic, aqueous solution conditions, cobalt-60 gamma irradiation afforded negligible net change in the steady-state oxidation state distribution of Pu(IV). Multi-scale calculations, which are in excellent agreement with experimental data, indicate that this observation is due to radiation-induced redox cycling between Pu(IV) and Pu(III), as achieved by the reduction of Pu(IV) by radiolytic nitrous acid and hydrogen peroxide, and the oxidation of Pu(III) by nitrate and hydroxyl radicals. These radiation-induced redox processes are augmented by plutonium’s inherent disproportionation reactions.

38 RADIATION CHEMISTRY, RADIOCHEMISTRY, AND NUCLEA↗

DOE OSTI2024

Radiation-Induced Plutonium Redox Chemistry

Plutonium plays a key role in global actinide research and nuclear fuel cycle technologies, and yet, our fundamental understanding of its inherent radiation-induced chemical behavior is limited. These radiation-induced processes cannot simply be switched off, as they are as fundamentally inherent to plutonium as the impact of relativistic effects on its f-electrons. In less chemically complex actinide systems, such as aqueous solutions of neptunium and americium, , radiolysis products play a significant role in the redox cycling of their oxidation states. However, plutonium's multiple, coexisting, and chemically active oxidation states, which comprise of bare ions and dioxo cations, provide additional redox pathways that complicate radiation-induced processes. Oxidation state control is critical for the manipulation of plutonium, especially in used nuclear fuel reprocessing technologies, where oxidation specific states are successfully extracted, and others rejected. Consequently, mechanistically understanding the behavior of plutonium’s multiple oxidation states in the presence of intense ionizing radiation fields is essential for predicting the behavior of this element under multiple conditions that support the development and innovation of nuclear fuel cycle technologies. Here, we present recent advances in our understanding of plutonium radiation chemistry, including the first-ever multiscale model for predicting gamma radiation-induced plutonium redox chemistry, and new chemical kinetics for the reaction of plutonium and its complexes of tributyl phosphate (TBP), N,N-di-(2-ethylhexyl)butyramide (DEHBA), and N,N-di-(2-ethylhexyl)isobutyramide (DEHiBA) with transients radiolysis products, a measured using electron pulse radiolysis.

38 RADIATION CHEMISTRY, RADIOCHEMISTRY, AND NUCLEA↗

DOE OSTI2024

Photo- and Electro-Induced Hadron Production from Nuclei at Jefferson Laboratory

Understanding many-body knockout processes is crucial for nuclear physics, particularly in photo- and electro-induced reactions. In turn, understanding two- and three-body forces, including higher-order forces, is vital for a complete understanding of atoms. We present photo-induced many-proton knockout processes, with multiplicities from 1 to 6, using 12C, CH2, and C4H9OH targets in the g9a FROST dataset. Our analysis covers photon energies from 600 to 4500 MeV, significantly expanding current world data. Comparing our experimental data to the state-of-the-art GiBUU model offers a new challenge in the model’s theoretical description of many-body processes. GiBUU reasonably describes the data at lower photon energies but struggles at higher energies and missing masses, likely due to missing processes, such as initial 3-pion photoproduction. Our results will inform future developments in describing proton knockout processes, indicating GiBUU’s overall reasonable description of many-proton knockout data up to around 2.2 GeV. We also assess various electro-induced reactions using 2D, 12C, and 40Ar targets in the RGM dataset. Our results, obtained at electron beam energies of 2, 4, and 6 GeV, are compared in detail to GENIE and GiBUU, two widely used theory models in neutrino oscillation experiments. Discrepancies between model predictions and experimental data underscore the need for refining the two theoretical models. Despite discrepancies, GiBUU provides a more accurate modelling of electro-induced reactions, especially for 40Ar - crucial for future neutrino oscillation facilities such as DUNE. Understanding the fundamental nuclear physics involved in neutrino-nuclei interactions is essential for reducing the systematic uncertainties in extracting neutrino oscillation parameters. Many-body processes significantly contribute to the background processes observed in neutrino-nuclei interactions, hence the results from both analyses are crucial for developing the theoretical framework for the underlying nuclear physics.

Williams, Rhidian↗