Search NASA⌕ Search

SEARCH · Search NASA

Results for “control sequences”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 289 records · Page 16
All sourcesNASA NTRSDOE OSTI
DOE OSTI2022

Using high-throughput amplicon sequencing to determine diet of generalist lady beetles in agricultural landscapes

Determining feeding relationships is central to understanding biological control potential in the field. However, methods to differentiate actual (or realized) feeding relationships from potential feeding relationships is lacking especially for small, generalist predators such as lady beetles. In this study, we used DNA metabarcoding approaches to characterize actual feeding relationships of lady beetles (Coccinellidae) in the field and validated our methods with a lab study. We first asked whether high-throughput amplicon sequencing (HTS) can characterize diets of lady beetles ranging from monotypic diets to diverse diet mixtures in the lab. We then examined whether diet composition and breadth of lady beetles collected from different habitat types in southern WI varied between monocultures of soybean and corn, diverse tallgrass prairie, and urban habitats. Lastly, we asked whether different body or tissue types (partial-body versus whole-body specimens) would change the likelihood of prey detection for both studies. In our controlled lab study, we found that HTS can accurately assess diet composition and diet breadth for lady beetle populations, but at the individual level, HTS has limitation for individuals feeding on more than three species of prey at any given time. In our field study, we documented lower prey richness and diet breadth in corn compared to soybean and grassland, and greater prey DNA in regurgitants than in whole-body specimens. Finally, we found that reduced diet diversity was associated with an increased prevalence of intraguild predation, but that habitat and prey diversity are not necessarily correlated. The prey detection rates (proportion of specimens with prey DNA) in our study were comparable to other studies (55% in the lab study, 33% in field study) and varied with diet composition and habitat type. Furthermore, the relatively low detection rates suggest that many consumer individuals would need to be assayed to fully assess diet diversity, especially in diverse systems.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

Post-Modification of Crystalline Peptoid Nanomembranes with Active Nanoparticles for Efficient Photooxidation of a Mustard Gas Simulant

Peptoids (or poly-N-substituted glycines) hold immense potential for assembling into hierarchically structured functional materials via controlled molecular interactions. To create self-assembled materials with tailored functionalities, peptoid sequences are often conjugated with reactive or recognition motifs to enable applications including specific binding, biomimetic catalysis, and fluorescence imaging. However, the direct integration of bulky functional motifs into peptoid sequences can disrupt assembly processes and structural outcomes. Herein, we present a post-modification strategy for functionalizing pre-formed 2D crystalline assemblies. Through introducing clickable active sites, such as azide, alkyne, or thiol groups into a peptoid sequence, site-specific conjugation is achieved post-assembly via efficient “click”-type reactions. This strategy enables the ordered alignment of functional groups and gold nanoparticles (Au NPs) on the surface of 2D peptoid nanomaterials with controlled density, while preserving their high crystallinity and structural integrity. Furthermore, we demonstrated that nanomembranes functionalized with both Au NPs and porphyrins enhance the efficiency and selectivity of the photooxidation of 2-chloroethyl ethyl sulfide, a simulant of sulfur mustard. This innovative strategy lays the groundwork for advancing peptoid-based functional materials across diverse applications, from catalysis to biomedicine.

Chemistry↗
DOE OSTI2021

A k-mer based approach for classifying viruses without taxonomy identifies viral associations in human autism and plant microbiomes

Viruses are an underrepresented taxa in the study and identification of microbiome constituents; however, they play an essential role in health, microbiome regulation, and transfer of genetic material. Only a few thousand viruses have been isolated, sequenced, and assigned a taxonomy, which limits the ability to identify and quantify viruses in the microbiome. Additionally, the vast diversity of viruses represents a challenge for classification, not only in constructing a viral taxonomy, but also in identifying similarities between a virus’ genotype and its phenotype. However, the diversity of viral sequences can be leveraged to classify their sequences in metagenomic and metatranscriptomic samples, even if they do not have a taxonomy. To identify and quantify viruses in transcriptomic and genomic samples, we developed a dynamic programming algorithm for creating a classification tree out of 715,672 metagenome viruses. To create the classification tree, we clustered proportional similarity scores generated from the k-mer profiles of each of the metagenome viruses to create a database of metagenomic viruses. The resulting Kraken2 database of the metagenomic viruses can be found here: https://www.osti.gov/biblio/1615774 and is compatible with Kraken2. We then integrated the viral classification database with databases created with genomes from NCBI for use with ParaKraken (a parallelized version of Kraken provided in Supplemental Zip 1), a metagenomic/transcriptomic classifier. To illustrate the breadth of our utility for classifying metagenome viruses, we analyzed data from a plant metagenome study identifying genotypic and compartment specific differences between two Populus genotypes in three different compartments. We also identified a significant increase in abundance of eight viral sequences in post mortem brains in a human metatranscriptome study comparing Autism Spectrum Disorder patients and controls. We also show the potential accuracy for classifying viruses by utilizing both the JGI and NCBI viral databases to identify the uniqueness of viral sequences. Finally, we validate the accuracy of viral classification with NCBI databases containing viruses with taxonomy to identify pathogenic viruses in known COVID-19 and cassava brown streak virus infection samples. Our method represents the compulsory first step in better understanding the role of viruses in the microbiome by allowing for a more complete identification of sequences without taxonomy. Better classification of viruses will improve identifying associations between viruses and their hosts as well as viruses and other microbiome members. Despite the lack of taxonomy, this database of metagenomic viruses can be used with any tool that utilizes a taxonomy, such as Kraken, for accurate classification of viruses.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

Automated Signal Timing Plan Reconstruction Using High-Resolution Event-Based Controller Data for Digital Twins

Transportation digital twins are essential tools for evaluating emerging technologies such as connected and automated vehicles, adaptive traffic signal control, and mobility optimization strategies. Realistic digital twins require accurate emulation of real-world signal controllers and detailed signal timing plans. However, signal timing plans are often unavailable or difficult to access, forcing researchers and modelers to rely on assumed fixed timings or halt their analysis. To overcome this challenge, we present a method that directly estimates signal timing plan parameters using high-resolution, event-based data from traffic signal controllers. The proposed method extracts key parameters, including cycle length, offset, phase sequence, coordinated phases, phase-specific minimum and maximum green durations, vehicle extensions, and splits under coordination. A rule-based deterministic signal timing reconstruction algorithm based on traffic signal operation rules, such as those outlined in the Signal Timing Manual, is developed and validated. We evaluate this method, which uses high-resolution controller event logs and verified signal timing plans, on 94 signalized intersections in Nashville, Tennessee, demonstrating their ability to generate accurate, simulation-ready signal timing plans for tools such as SUMO and Vissim.

Saroj, Abhilasha [ORNL] (ORCID:0000000191178063)↗
DOE OSTI2020

Discovery of Self-Assembling π-Conjugated Peptides by Active Learning-Directed Coarse-Grained Molecular Simulation

Electronically active organic molecules have demonstrated great promise as novel soft materials for energy harvesting and transport. Self-assembled nanoaggregates formed from π-conjugated oligopeptides composed of an aromatic core flanked by oligopeptide wings offer emergent optoelectronic properties within a water-soluble and biocompatible substrate. Nanoaggregate properties can be controlled by tuning core chemistry and peptide composition, but the sequence–structure–function relations remain poorly characterized. Here, we employ coarse-grained molecular dynamics simulations within an active learning protocol employing deep representational learning and Bayesian optimization to efficiently identify molecules capable of assembling pseudo-1D nanoaggregates with good stacking of the electronically active π-cores. We consider the DXXX-OPV3-XXXD oligopeptide family, where D is an Asp residue and OPV3 is an oligophenylenevinylene oligomer (1,4-distyrylbenzene), to identify the top performing XXX tripeptides within all 20 3 = 8000 possible sequences. By direct simulation of only 2.3% of this space, we identify molecules predicted to exhibit superior assembly relative to those reported in prior work. Spectral clustering of the top candidates reveals new design rules governing assembly. This work establishes new understanding of DXXX-OPV3-XXXD assembly, identifies promising new candidates for experimental testing, and presents a computational design platform that can be generically extended to other peptide-based and peptide-like systems.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2021

Multiplexed characterization of rationally designed promoter architectures deconstructs combinatorial logic for IPTG-inducible systems

Abstract A crucial step towards engineering biological systems is the ability to precisely tune the genetic response to environmental stimuli. In the case of Escherichia coli inducible promoters, our incomplete understanding of the relationship between sequence composition and gene expression hinders our ability to predictably control transcriptional responses. Here, we profile the expression dynamics of 8269 rationally designed, IPTG-inducible promoters that collectively explore the individual and combinatorial effects of RNA polymerase and LacI repressor binding site strengths. We then fit a statistical mechanics model to measured expression that accurately models gene expression and reveals properties of theoretically optimal inducible promoters. Furthermore, we characterize three alternative promoter architectures and show that repositioning binding sites within promoters influences the types of combinatorial effects observed between promoter elements. In total, this approach enables us to deconstruct relationships between inducible promoter elements and discover practical insights for engineering inducible promoters with desirable characteristics.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

A Novel Authentication Management for the Data Security of Smart Grid

Bidirectional wireless communication is employed in various smart grid components such as smart meters and control and monitoring applications where security is vital. The Trusted Third Party (TTP) and wireless connectivity between the smart meter and the third party in the key management-based encryption techniques for the smart grid are expected to be totally trustworthy and dependable. In a wired/wireless medium, however, a man-in-the-middle may seek to disrupt, monitor and manipulate the network, or simply execute a replay attack, revealing its vulnerability. Recognizing this, this study presents a novel authentication management (model) comprised of two layer security schema. The first layer implements an efficient novel encryption method for secure data exchange between meters and control center with the help of two partially trusted simple servers (constitutes the TTP). In this setting, one server handles the data encryption between the meter and control center/central database, and the other server administers the random sequence of data transmission. The second layer monitors and verifies exchanged data packets among smart meters. It detects abnormal packets from suspicious sources. To implement this node-to-node authentication, One class support vector machine algorithm is proposed which takes advantages of the location information as well as the data transmission history (node identification, packet size, and data transmission frequency). This schema secures data communication, and imposes a comprehensive privacy throughout the system without considerably extending the complexity of the conventional key management scheme.

24 POWER TRANSMISSION AND DISTRIBUTION↗
DOE OSTI2024

Predictive Control to Further Reduce DC-Link Capacitor Current Stress for Segmented Inverter

Two three-phase interleaved inverters have been used in traction drive applications to reduce the current stress in a DC link capacitor bank. In such applications, either carrier-based or space vector modulation is used to select the optimum switching sequences, and the results show 50% less capacitor current than that of a single three-phase inverter. The switching state selection process for this inverter is tedious, and there has been no research to find the optimal switching state. To overcome this challenge, this research employed a simple finite set model predictive control to select the optimum switching sequence for a dual three-phase interleaved topology, called a segmented inverter. The results show that the predictive control algorithm can provide a simple solution and can reduce the current stress by 27% compared with traditional modulation techniques for the segmented inverters.

Ribeiro, Pedro↗
DOE OSTI2022

Time Sequence Machine Learning-Based Data Intrusion Detection for Smart Voltage Source Converter-Enabled Power Grid

Smart inverters of distributed energy resources can enable cloud computing, condition monitoring, result visualization, remote control, and peer-to-peer energy trading in advanced power systems. However, the advent of data injection attacks in the communication architecture can alter measurement characteristics of power grids and have devastating consequences. In this article, we propose a time sequence machine learning-based anomaly detection methodology for detecting cyber intrusion into control signal setpoints and dc voltage signal measurement bias of the voltage source converter (VSC) in wind generators. We first investigated the effects of four types of denial of service, tampering signal, and stealthy-type data intrusion attacks on smart VSCs and overall wind farms. We then proposed a novel time sequence machine learning-based intrusion detection framework that can be implemented to detect different cyberattacks in the VSCs. The performance of the proposed framework has been compared with that of autoencoder and clustering-based intrusion detection framework. The proposed framework was validated by using the IEEE 39 bus power system in the presence of four wind farms in different locations. Using several metrics for intrusion detection performance, we validated the effectiveness of the proposed framework.

42 ENGINEERING↗
DOE OSTI2023

Enhancing strontium clock atom interferometry using quantum optimal control

Strontium clock atom interferometry is a promising new technology, with multiple experiments under development around the world to explore its potential for dark matter and gravitational wave detection. In these detectors, large momentum transfer using sequences of many laser pulses is necessary, and thus high-fidelity pulses are important since small errors become magnified. Quantum optimal control (QOC) is a framework for developing control pulse waveforms that achieve high fidelity and are robust against experimental imperfections. Resonant single-photon transitions using the narrow clock transition of strontium involve significantly different quantum dynamics than more established atom interferometry methods based on far-detuned two-photon Raman or Bragg transitions, which leads to new opportunities and challenges when applying QOC. Here, we study in simulation QOC pulses for strontium clock interferometry and demonstrate their advantage over basic square pulses (primitive pulses) and composite pulses in terms of robustness against multiple noise channels. In conclusion, this could improve the scale of large momentum transfer in Sr clock interferometers, paving the way to achieving these scientific goals.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2020

Lessons Learned from Demolition of Hanford's Plutonium Finishing Plant - 20507

U.S. Department of Energy (DOE) contractor CH2M Hill Plateau Remediation Company (CHPRC), a Jacobs owned company, is making significant progress demolishing the Plutonium Finishing Plant (PFP), which has long been known as one of the most hazardous buildings in the DOE Environmental Management Complex (DOE Complex). The facility is located on the Hanford Site and produced plutonium metal during the Cold War. Production was stopped in 1989, the facility was formally shut down in 1996, and material processing was completed in 2004. After approximately 25 years of demolition preparations, open-air demolition of the main portions of the Hazard Category II nuclear facility began in November 2016. To prepare the PFP for demolition, CHPRC employees performed some of the most hazardous work across the DOE Complex. In addition to extensive demolition preparations, including a wide-reaching communication strategy across the Hanford Site, CHPRC implemented robust controls and monitoring during demolition, and when necessary, adjusted demolition practices and sequence to maintain employee safety and project efficiency. Demolition of the main PFP building began in November 2016. The technical complexity, high hazards and radiological concerns have all led to a difficult demolition environment. Following a spread of contamination at the project site beyond the radiological boundaries in December 2017, work was halted and a recovery plan was generated to allow the demolition work to continue. After the implementation of additional controls and concurrence from regulatory agencies and DOE, the demolition was ready to resume work and reinitiated in August 2018. There are a number of lessons learned from the demolition activities and recovery plan process. This paper allows CHPRC and DoE's Richland Operations Office (RL) to share lessons learned and progress to date with other challenging and hazardous projects across the DOE Complex. Understanding the risk acceptance level is critical to execution of any open-air demolition project and is unique to each facility. Four key lessons learned from this project include: 1) plan execution issues, 2) stakeholder communication issues, 3) watching for summit fever and 4) minimizing exposed contaminated surfaces during demolition. (authors)

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2021

Integrating Transactive Energy into Reliability Evaluation for a Self-healing Distribution System with Microgrid

Non-utility owned distributed energy resources (DERs) are mostly untapped currently, but they can provide many grid services such as voltage regulation and service restoration, if properly controlled, and can improve the distribution systems reliability when coordinated with utility-owned assets such as self-healing control and microgrids. This paper integrates transactive energy control into the distribution system reliability evaluation to quantitatively assess the impact of non-utility owned DERs on reliability improvement. Here, a transactive reactive power control strategy is designed to incentivize the DERs to provide reactive power support for improving voltage profiles thus enabling additional customer load restoration during an outage. Also, an operational sequence to coordinate the non-utility owned DERs with the utility owned self-healing control and utility owned microgrids is designed and integrated into the service restoration process with the operational constraints guaranteed by checking the three-phase unbalanced power flow for post-fault network reconfiguration. The reliability indices are then calculated through a Monte Carlo simulation. The transactive reactive power control strategy is tested on a four-feeder distribution system operated by Duke Energy in the U.S. Results demonstrate that the non-utility owned DERs with the transactive control improve the reliability of both the system and critical loads by more than 30%.

24 POWER TRANSMISSION AND DISTRIBUTION↗
DOE OSTI2026

A Generic and Multifunctional Electromagnetic Transient Model for Grid-Following Inverters

This article presents a generic and multi-functional electromagnetic transient (EMT) dynamic model of grid following (GFL) inverter-based resource (IBR) using the PSCAD software platform. The features of the developed model includes the flexibility in selecting various types and combinations of DC sources covering PV modules, battery modules, ideal DC source module, as well as flexibility in selecting either switched or averaged model of inverter. This model also covers exhaustive lists of controller logic covering open-loop/closed-loop PQ dispatch control, DC voltage and AC terminal voltage control along with the conventional current control designed in dq-domain, ate- domain and positive-negative sequence domain. Moreover, this model is equipped with the flexibility in selecting various types of current limiting schemes that includes saturation-based as well as latching-based current limiter, anti-windup protection. Moreover, the EMT model is agnostic to the MVA rating and is suitable for interfacing transmission systems by being complaint with the IEEE Std. 2800. The generality in the power circuits and the multi-functional options in operation and control of the developed EMT model makes it suitable for both academia and industry to study various power system aspects not limited to but such as fault behavior of GFL IBR and impacts on protection system, transient stability of a system interfaced with large number of GFL IBRs etc.

14 SOLAR ENERGY↗
DOE OSTI2024

A Generic and Multi-Functional Electromagnetic Transient Model for Grid-Following Inverter: Preprint

This article presents a generic and multi-functional electromagnetic transient (EMT) dynamic model of grid following (GFL) inverter-based resource (IBR) using the PSCAD TM software platform. The features of the developed model includes the flexibility in selecting various types and combinations of DC sources covering PV modules, battery modules, ideal DC source module, as well as flexibility in selecting either switched or averaged model of inverter. This model also covers exhaustive lists of controller logic covering open-loop/closed-loop PQ dispatch control, DC voltage and AC terminal voltage control along with the conventional current control designed in dq-domain, aB- domain and positive-negative sequence domain. Moreover, this model is equipped with the flexibility in selecting various types of current limiting schemes that includes saturation-based as well as latching-based current limiter, anti-windup protection. Moreover, the EMT model is agnostic to the MVA rating and is suitable for interfacing transmission systems by being complaint with the IEEE Std. 2800. The generality in the power circuits and the multi-functional options in operation and control of the developed EMT model makes it suitable for both academia and industry to study various power system aspects not limited to but such as fault behavior of GFL IBR and impacts on protection system, transient stability of a system interfaced with large number of GFL IBRs etc.

grid following inverter↗
DOE OSTI2021

Ultrafast valley polarization in bilayer graphene

We study theoretically the interaction of a bilayer graphene with a circularly polarized ultrafast optical pulse of a single oscillation at an oblique incidence. The normal component of the pulse breaks the inversion symmetry of the system and opens up a dynamical bandgap due to which a valley-selective population of the conduction band becomes sensitive to the angle of incident of the pulse. We show that the magnitude of the valley polarization can be controlled by the angle of incidence, the amplitude, and the angle of in-plane polarization of the chiral optical pulse. Subsequently, a sequence of a circularly polarized pulse followed by a linearly polarized femtosecond-long pulse can be used to control and probe the valley polarization created by the preceding pulse. Our protocol provides a favorable platform to design ultrafast all-optical valleytronic information processing.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2024

Exploration of Tertiary Structure in Sequence-Defined Polymers Using Molecular Dynamics Simulations

Peptoids are a class of sequence-defined biomimetic polymers with peptide-like backbones and side chains located on backbone nitrogens rather than alpha carbons. These materials demonstrate a strong ability for precise control of single-chain structure, multiunit self-assembly, and macromolecular assembly through careful tuning of sequence due to the diversity of available side chains, although the driving forces behind these assemblies are often not understood. Prior experimental work has shown that linked 15mer peptoids can mimic the protein helical hairpin structure by leveraging the chirality-inducing nature of bulky side chains and hydrophobicity, but there are still gaps in our understanding of the relationship between sequence, stability, and particular secondary or tertiary structure. Here, we present a molecular dynamics (MD) study on the folding behavior of these polymers into hairpins, discussing the differences in structure from sequences with various characteristics in water and acetonitrile, and then compare the handedness preference of common helical motifs between solvents.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2021

The Transcriptional Response of Soil Bacteria to Long-Term Warming and Short-Term Seasonal Fluctuations in a Terrestrial Forest

Terrestrial ecosystems are an important carbon store, and this carbon is vulnerable to microbial degradation with climate warming. After 30 years of experimental warming, carbon stocks in a temperate mixed deciduous forest were observed to be reduced by 30% in the heated plots relative to the controls. In addition, soil respiration was seasonal, as was the warming treatment effect. We therefore hypothesized that long-term warming will have higher expressions of genes related to carbohydrate and lipid metabolism due to increased utilization of recalcitrant carbon pools compared to controls. Because of the seasonal effect of soil respiration and the warming treatment, we further hypothesized that these patterns will be seasonal. We used RNA sequencing to show how the microbial community responds to long-term warming (~30 years) in Harvard Forest, MA. Total RNA was extracted from mineral and organic soil types from two treatment plots (+5°C heated and ambient control), at two time points (June and October) and sequenced using Illumina NextSeq technology. Treatment had a larger effect size on KEGG annotated transcripts than on CAZymes, while soil types more strongly affected CAZymes than KEGG annotated transcripts, though effect sizes overall were small. Although, warming showed a small effect on overall CAZymes expression, several carbohydrate-associated enzymes showed increased expression in heated soils (~68% of all differentially expressed transcripts). Further, exploratory analysis using an unconstrained method showed increased abundances of enzymes related to polysaccharide and lipid metabolism and decomposition in heated soils. Compared to long-term warming, we detected a relatively small effect of seasonal variation on community gene expression. Together, these results indicate that the higher carbohydrate degrading potential of bacteria in heated plots can possibly accelerate a self-reinforcing carbon cycle-temperature feedback in a warming climate.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗