Search NASA⌕ Search

SEARCH · Search NASA

Results for “gene expression analysis”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 307 records · Page 17
All sourcesNASA NTRSDOE OSTI
DOE OSTI2024

Nutri‐cereal tissue‐specific transcriptome atlas during development: Functional integration of gene expression to identify mineral uptake pathways in little millet ( Panicum sumatrense )

SUMMARY Little millet (Panicum sumatrenseRoth ex Roem. & Schult.) is an essential minor millet of southeast Asia and Africa's temperate and subtropical regions. The plant is stress‐tolerant, has a short life cycle, and has a mineral‐rich nutritional profile associated with unique health benefits. We report the developmental gene expression atlas of little millet (genotype JK‐8) from ten tissues representing different stages of its life cycle, starting from seed germination and vegetative growth to panicle maturation. The developmental transcriptome atlas led to the identification of 342 827 transcripts. The BUSCO analysis and comparison with the transcriptomes of related species confirm that this study presents high‐quality, in‐depth coverage of the little millet transcriptome. In addition, the eFP browser generated here has a user‐friendly interface, allowing interactive visualizations of tissue‐specific gene expression. Using these data, we identified transcripts, the orthologs of which inArabidopsisand rice are involved in nutrient acquisition, transport, and response pathways. The comparative analysis of the expression levels of these transcripts holds great potential for enhancing the mineral content in crops, particularly zinc and iron, to address the issue of “hidden hunger” and to attain nutritional security, making it a valuable asset for translational research.

Plant Sciences↗
DOE OSTI2024

Signature analysis of high-throughput transcriptomics screening data for mechanistic inference and chemical grouping

Abstract High-throughput transcriptomics (HTTr) uses gene expression profiling to characterize the biological activity of chemicals in in vitro cell-based test systems. As an extension of a previous study testing 44 chemicals, HTTr was used to screen an additional 1,751 unique chemicals from the EPA’s ToxCast collection in MCF7 cells using 8 concentrations and an exposure duration of 6 h. We hypothesized that concentration-response modeling of signature scores could be used to identify putative molecular targets and cluster chemicals with similar bioactivity. Clustering and enrichment analyses were conducted based on signature catalog annotations and ToxPrint chemotypes to facilitate molecular target prediction and grouping of chemicals with similar bioactivity profiles. Enrichment analysis based on signature catalog annotation identified known mechanisms of action (MeOAs) associated with well-studied chemicals and generated putative MeOAs for other active chemicals. Chemicals with predicted MeOAs included those targeting estrogen receptor (ER), glucocorticoid receptor (GR), retinoic acid receptor (RAR), the NRF2/KEAP/ARE pathway, AP-1 activation, and others. Using reference chemicals for ER modulation, the study demonstrated that HTTr in MCF7 cells was able to stratify chemicals in terms of agonist potency, distinguish ER agonists from antagonists, and cluster chemicals with similar activities as predicted by the ToxCast ER Pathway model. Uniform manifold approximation and projection (UMAP) embedding of signature-level results identified novel ER modulators with no ToxCast ER Pathway model predictions. Finally, UMAP combined with ToxPrint chemotype enrichment was used to explore the biological activity of structurally related chemicals. The study demonstrates that HTTr can be used to inform chemical risk assessment by determining in vitro points of departure, predicting chemicals’ MeOA and grouping chemicals with similar bioactivity profiles.

Toxicology↗
DOE OSTI2024

Peeling back the many layers of competitive exclusion

Baby chicks administered a fecal transplant from adult chickens are resistant to Salmonella colonization by competitive exclusion. A two-pronged approach was used to investigate the mechanism of this process. First, Salmonella response to an exclusive (Salmonella competitive exclusion product, Aviguard ® ) or permissive microbial community (chicken cecal contents from colonized birds containing 7.85 Log 10 Salmonella genomes/gram) was assessed ex vivo using a S. typhimurium reporter strain with fluorescent YFP and CFP gene fusions to rrn and hilA operon, respectively. Second, cecal transcriptome analysis was used to assess the cecal communities’ response to Salmonella in chickens with low (≤5.85 Log 10 genomes/g) or high (≥6.00 Log 10 genomes/g) Salmonella colonization. The ex vivo experiment revealed a reduction in Salmonella growth and hilA expression following co-culture with the exclusive community. The exclusive community also repressed Salmonella’s SPI-1 virulence genes and LPS modification, while the anti-virulence/inflammatory gene avrA was upregulated. Salmonella transcriptome analysis revealed significant metabolic disparities in Salmonella grown with the two different communities. Propanediol utilization and vitamin B12 synthesis were central to Salmonella metabolism co-cultured with either community, and mutations in propanediol and vitamin B12 metabolism altered Salmonella growth in the exclusive community. There were significant differences in the cecal community’s stress response to Salmonella colonization. Cecal community transcripts indicated that antimicrobials were central to the type of stress response detected in the low Salmonella abundance community, suggesting antagonism involved in Salmonella exclusion. This study indicates complex community interactions that modulate Salmonella metabolism and pathogenic behavior and reduce growth through antagonism may be key to exclusion.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Effects of ingested nanocellulose on intestinal microbiota and homeostasis in Wistar Han rats

Micron scale crystalline and fibrillar cellulose materials are “generally regarded as safe” (GRAS) as binders and thickeners in food products. Yet, partly due to a lack of relevant toxicological data, nanocellulose (NC) materials, which have unique properties that can be exploited to improve food quality and safety, have yet to receive FDA approval as food ingredients. Results of in vitro and in vivo toxicological studies of ingested NC, detailed in a recent companion report, revealed minimal acute in vitro cytotoxicity, and no toxicity in a subacute rat gavage model, suggesting that NC materials are non-hazardous. However, ingested materials may also modulate gut microbial populations, or alter aspects of intestinal function not evaluated in standard totoxicity testing, which could have important health implications. Here, we report the results of studies of the effects of ingested cellulose nanofibrils (CNF) on the fecal microbiome and metabolome, intestinal (ileal) epithelial cell mRNA expression of cell junction genes, and ileal cytokine production. Feces, plasma, and ileum samples were collected from Wistar Han rats before and after five weeks of biweekly gavages of water or cream, with or without 1% w/w CNF. Analysis of fecal microbial populations revealed that CNF caused changes in both genus and species diversity, with specific effects on species that produce short chain fatty acids, and that have been associated with increased IgA production and elevation of insulin levels. Fecal metabolomic analysis revealed relatively few effects of CNF, with significant changes in the levels of only ten metabolites out of 366 measured. Exposure to CNF also caused differential regulation of mRNA expression of several genes involved in epithelial cell junctions, and increased production of cytokines that both promote and inhibit proliferation of CD8 T cells. These perturbations in intestinal homeostasis contrast somewhat with the absence of in vitro and in vivo toxicity observed previously but would appear to represent minor effects. Additionally, the gut microbiome is highly sensitive to ingested substances, and such disturbances of the intestinal microbial ecosystem do not necessarily represent or predict meaningful pathology. Further studies, including chronic feeding studies, are needed to assess the real health implications, if any, of these changes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Metabolic engineering of low-pH-tolerant non-model yeast, Issatchenkia orientalis , for production of citramalate

Methyl methacrylate (MMA) is an important petrochemical with many applications. However, its manufacture has a large environmental footprint. Combined biological and chemical synthesis (semisynthesis) may be a promising alternative to reduce both cost and environmental impact, but strains that can produce the MMA precursor (citramalate) at low pH are required. A non-conventional yeast, Issatchenkia orientalis, may prove ideal, as it can survive extremely low pH. Here, we demonstrate the engineering of I. orientalis for citramalate pro- duction. Using sequence similarity network analysis and subsequent DNA synthesis, we selected a more active citramalate synthase gene (cimA) variant for expression in I. orientalis. We then adapted a piggyBac transposon system for I. orientalis that allowed us to simultaneously explore the effects of different cimA gene copy numbers and integration locations. A batch fermentation showed the genome-integrated-cimA strains produced 2.0 g/L citramalate in 48 h and a yield of up to 7% mol citramalate/mol consumed glucose. These results demonstrate the potential of I. orientalis as a chassis for citramalate production.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Data for Metabolic Engineering of Low-pH-Tolerant Non-Model Yeast, Issatchenkia orientalis , for Production of Citramalate

Methyl methacrylate (MMA) is an important petrochemical with many applications. However, its manufacture has a large environmental footprint. Combined biological and chemical synthesis (semisynthesis) may be a promising alternative to reduce both cost and environmental impact, but strains that can produce the MMA precursor (citramalate) at low pH are required. A non-conventional yeast, Issatchenkia orientalis , may prove ideal, as it can survive extremely low pH. Here, we demonstrate the engineering of I. orientalis for citramalate production. Using sequence similarity network analysis and subsequent DNA synthesis, we selected a more active citramalate synthase gene (cimA) variant for expression in I. orientalis . We then adapted a piggyBac transposon system for I. orientalis that allowed us to simultaneously explore the effects of different cimA gene copy numbers and integration locations. A batch fermentation showed the genome-integrated-cimA strains produced 2.0 g/L citramalate in 48 h and a yield of up to 7% mol citramalate/mol consumed glucose. These results demonstrate the potential of I. orientalis as a chassis for citramalate production.

Conversion↗
DOE OSTI2025

Cohort-based pan-cancer analysis and experimental studies reveal ISG15 gene as a novel biomarker for prognosis and immunotherapy efficacy prediction

Abstract ISG15, an interferon-stimulated ubiquitin-like protein, plays a multifaceted role in tumorigenesis and immune regulation. This study comprehensively evaluates ISG15 as a prognostic biomarker and predictor of immunotherapy response through pan-cancer bioinformatics analysis and experimental validation. By integrating multiomics data from TCGA, GEO, and clinical cohorts, we found that ISG15 is significantly overexpressed in multiple cancers and generally correlates with poor prognosis. Elevated ISG15 expression is associated with increased immune checkpoint gene expression, particularly PD-L1, and immune infiltration, notably M2-like tumor-associated macrophages. Immunohistochemistry and multiplexed immunofluorescence confirmed a strong positive correlation between ISG15, PD-L1, and M2-TAM infiltration in lung and gastric cancer samples. Functional analysis at the single-cell level revealed significant associations between ISG15 and tumor proliferation, angiogenesis, and immune suppression. Immunotherapy cohort analysis demonstrated that tumors with high ISG15 expression responded favorably to PD-L1 inhibitors but exhibited resistance to CTLA-4 blockade, findings further validated in lung cancer patients receiving anti-PD-1 therapy. These results suggest that ISG15 is a promising biomarker for prognosis and immunotherapy response prediction across cancers. Its integration into clinical decision-making may enhance personalized treatment strategies, improve immunotherapy outcomes, and provide new insights into the tumor immune microenvironment, cancer progression, and potential therapeutic targets for future drug development.

Immunology↗
DOE OSTI2025

Addressing genome scale design tradeoffs in Pseudomonas putida for bioconversion of an aromatic carbon source

Genome-scale metabolic models (GSMM) are commonly used to identify gene deletion sets that result in growth coupling and pairing product formation with substrate utilization and can improve strain performance beyond levels typically accessible using traditional strain engineering approaches. However, sustainable feedstocks pose a challenge due to incomplete high-resolution metabolic data for non-canonical carbon sources required to curate GSMM and identify implementable designs. Here we address a four-gene deletion design in the Pseudomonas putida KT2440 strain for the lignin-derived non-sugar carbon source, p-coumarate (p-CA), that proved challenging to implement. We examine the performance of the fully implemented design for p-coumarate to glutamine, a useful biomanufacturing intermediate. In this study glutamine is then converted to indigoidine, an alternative sustainable pigment and a model heterologous product that is commonly used to colorimetrically quantify glutamine concentration. Through proteomics, promoter-variation, and growth characterization of a fully implemented gene deletion design, we provide evidence that aromatic catabolism in the completed design is rate-limited by fumarase hydratase (FUM) enzyme activity in the citrate cycle and requires careful optimization of another fumarate hydratase protein (PP_0897) expression to achieve growth and production. A double sensitivity analysis also confirmed a strict requirement for fumarate hydratase activity in the strain where all genes in the growth coupling design have been implemented. Metabolic cross-feeding experiments were used to examine the impact of complete removal of the fumarase hydratase reaction and revealed an unanticipated nutrient requirement, suggesting additional functions for this enzyme. While a complete implementation of the design was achieved, this study highlights the challenge of completely inactivating metabolic reactions encoded by under-characterized proteins, especially in the context of multi-gene edits.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Genome-Wide Study of Hsp90 Gene Family in Cabbage (Brassica oleracea var. capitata L.) and Their Imperative Roles in Response to Cold Stress

Heat shock protein 90 (Hsp90) plays an important role in plant developmental regulation and defensive reactions. Several plant species have been examined for the Hsp90 family gene. However, the Hsp90 gene family in cabbage has not been well investigated to date. In this study, we have been discovered 12 BoHsp90 genes in cabbage ( Brassica oleracea var. capitata L.). These B. oleracea Hsp90 genes were classified into five groups based on phylogenetic analysis. Among the five groups, group one contains five Hsp90 genes, including BoHsp90-1 , BoHsp90-2 , BoHsp90-6 , BoHsp90-10 , and BoHsp90-12 . Group two contains three Hsp90 genes, including BoHsp90-3 , BoHsp90-4 , and BoHsp90 . Group three only includes one Hsp90 gene, including BoHsp90-9 . Group four were consisting of three Hsp90 genes including BoHsp90-5 , BoHsp90-7 , and BoHsp90-8 , and there is no Hsp90 gene from B. oleracea in the fifth group. Synteny analysis showed that a total of 12 BoHsp90 genes have a collinearity relationship with 5 Arabidopsis genes and 10 Brassica rapa genes. The promoter evaluation revealed that the promoters of B. oleracea Hsp90 genes included environmental stress-related and hormone-responsive cis-elements . RNA-seq data analysis indicates that tissue-specific expression of BoHsp90-9 and BoHsp90-5 were highly expressed in stems, leaves, silique, and flowers. Furthermore, the expression pattern of B. oleracea BoHsp90 exhibited that BoHsp90-2, BoHsp90-3, BoHsp90-7, BoHsp90-9, BoHsp90-10, and BoHsp90-11 were induced under cold stress, which indicates these Hsp90 genes perform a vital role in cold acclimation and supports in the continual of normal growth and development process. The cabbage Hsp90 gene family was found to be differentially expressed in response to cold stress, suggesting that these genes play an important role in cabbage growth and development under cold conditions.

Sajad, Shoukat↗
DOE OSTI2021

Protective effect of SIRT6 on cholesterol crystal-induced endothelial dysfunction via regulating ACE2 expression

Highlights: • ACE2 was involved in CC-induced endothelial dysfunction. • SIRT1 and SIRT6 contributed to regulating the protein expression of ACE2 in CC-stimulated endothelial cells. • SIRT6 regulated ACE2 with intranuclear p-ATF2, but not affecting p-ATF2 expression in the cytoplasm. Sirtuins are a family of highly conserved nicotinamide adenine dinucleotide (NAD{sup +})-dependent enzymes. Among the sirtuins, SIRT1 and SIRT6 participate in the regulation of endothelial functions and play significant roles in the physiological and pathological processes of cardiovascular diseases (CVD). Recently, our study found that minute cholesterol crystals (CC) can be endocytosed by endothelial cells and further impair endothelial functions. Since previous studies have reported that angiotensin-converting enzyme (ACE2) involves Angiotensin (Ang) II-induced inflammation in endothelial cells, this study was designed to investigate the role of SIRT1 and SIRT6 in CC-induced variation of ACE2 expression and the related mechanism between SIRT6 and ACE2. We found that ACE2 is involved in CC-induced endothelial dysfunction, which inhibits decreases in nitric oxide (NO) level and endothelial nitric oxide synthase (eNOS) activity and increases in inflammatory factors and adhesion molecules. Besides, SIRT1 and SIRT6 regulated the protein expression of ACE2 in CC-stimulated human umbilical vein endothelial cells (HUVECs). Moreover, bioinformatics analysis from the Enrichr database indicated that activating transcription factor 2 (ATF2), is highly correlated with genes that significantly upregulated after infection with the SIRT6 adenovirus vector. In CC-induced HUVECs, ACE2 expression was up-regulated in cells transfected with ATF2 siRNA. However, further mechanism studies revealed that overexpression of SIRT6 decreases the accumulation of p-ATF2 in the nucleus, but did not affect p-ATF2 expression in the cytoplasm. Taken together, these data indicated that SIRT6 regulates ACE2 might via inhibiting the accumulation of nucleus p-ATF2 in CC-induced endothelial dysfunction.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2020

Comparative Genomic Analysis of Ochratoxin A Biosynthetic Cluster in Producing Fungi: New Evidence of a Cyclase Gene Involvement

The widespread use of Next-Generation Sequencing has opened a new era in the study of biological systems by significantly increasing the catalog of fungal genomes sequences and identifying gene clusters for known secondary metabolites as well as novel cryptic ones. However, most of these clusters still need to be examined in detail to completely understand the pathway steps and the regulation of the biosynthesis of metabolites. Genome sequencing approach led to the identification of the biosynthetic genes cluster of ochratoxin A (OTA) in a number of producing fungal species. Ochratoxin A is a potent pentaketide nephrotoxin produced by Aspergillus and Penicillium species and found as widely contaminant in food, beverages and feed. The increasing availability of several new genome sequences of OTA producer species in JGI Mycocosm and/or GenBank databanks led us to analyze and update the gene cluster structure in 19 Aspergillus and 2 Penicillium OTA producing species, resulting in a well conserved organization of OTA core genes among the species. Furthermore, our comparative genome analyses evidenced the presence of an additional gene, previously undescribed, located between the polyketide and non-ribosomal synthase genes in the cluster of all the species analyzed. The presence of a SnoaL cyclase domain in the sequence of this gene supports its putative role in the polyketide cyclization reaction during the initial steps of the OTA biosynthesis pathway. The phylogenetic analysis showed a clustering of OTA SnoaL domains in accordance with the phylogeny of OTA producing species at species and section levels. The characterization of this new OTA gene, its putative role and its expression evidence in three important representative producing species, are reported here for the first time.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Unraveling the Genetics of Two Key Biomass Traits that Differentiate Upland and Lowland Tetraploid Switchgrass Ecotypes, Colonization by Mycorrhizal Fungi and Frost Tolerance

The overall objectives of the proposal were to dissect the genetics of the ability of switchgrass to interact with arbuscular mycorrhizal fungi (AMF) and to tolerate subzero temperatures, and to investigate the effect of AMF colonization on freezing tolerance and biomass production. In order to achieve this, we generated genetic maps in an F2 mapping population derived from a cross between the lowland genotype AP13 and the upland genotype VS16. In addition to providing a framework for identification of quantitative trait loci (QTL), the genetic maps were used to validate and improve the switchgrass genome assembly. We mapped phenotypic quantitative trait loci (QTL) for AMF colonization and cold tolerance in the F 2 population. We demonstrated that identification of QTL for AMF colonization was achieved only if AMF genus-specific colonization levels were used as phenotypes. No QTL were obtained when the overall level of AMF colonization was used as a trait. We conducted RNASeq on a subset of the F2 progeny following cold acclimation, and developed statistical methods to conduct expression QTL (eQTL) analyses in a polyploid organism. A preliminary analysis of the results identified eQTL for a range of genes that were differentially regulated in the lowland AP13 compared to the upland VS16 under cold acclimation. Once sequencing of the transcriptomes of a temporal replicate of the mapping population that was cold-acclimated using the same conditions has been completed, a final eQTL analysis will be conducted.

09 BIOMASS FUELS↗
DOE OSTI2021

Deinococcus radiodurans UWO298 Dependence on Background Radiation for Optimal Growth

Ionizing radiation is a major environmental variable for cells on Earth, and so organisms have adapted to either prevent or to repair damages caused by it, primarily from the appearance and accumulation of reactive oxygen species (ROS). In this study, we measured the differential gene expression in Deinococcus radiodurans UWO298 cultures deprived of background ionizing radiation (IR) while growing 605 m underground at the Waste Isolation Pilot Plant (WIPP), reducing the dose rate from 72.1 to 0.9 nGy h –1 from control to treatment, respectively. This reduction in IR dose rate delayed the entry into the exponential phase of the IR-shielded cultures, resulting in a lower biomass accumulation for the duration of the experiment. The RNASeq-based transcriptome analysis showed the differential expression of 0.2 and 2.7% of the D. radiodurans genome after 24 and 34 h of growth in liquid culture, respectively. Gene expression regulation after 34 h was characterized by the downregulation of genes involved in folding newly synthesized and denatured/misfolded proteins, in the assimilation of nitrogen for amino acid synthesis and in the control of copper transport and homeostasis to prevent oxidative stress. We also observed the upregulation of genes coding for proteins with transport and cell wall assembly roles. These results show that D. radiodurans is sensitive to the absence of background levels of ionizing radiation and suggest that its transcriptional response is insufficient to maintain optimal growth.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Model of metabolism and gene expression predicts proteome allocation in Pseudomonas putida

Abstract The genome-scale model of metabolism and gene expression (ME-model) forPseudomonas putidaKT2440,iPpu1676-ME, provides a comprehensive representation of biosynthetic costs and proteome allocation. Compared to a metabolic-only model,iPpu1676-ME significantly expands on gene expression, macromolecular assembly, and cofactor utilization, enabling accurate growth predictions without additional constraints. Multi-omics analysis using RNA sequencing and ribosomal profiling data revealed translational prioritization inP. putida, with core pathways, such as nicotinamide biosynthesis and queuosine metabolism, exhibiting higher translational efficiency, while secondary pathways displayed lower priority. Notably, the ME-model significantly outperformed the M-model in alignment with multi-omics data, thereby validating its predictive capacity. Thus,iPpu1676-ME offers valuable insights intoP. putida’s proteome allocation and presents a powerful tool for understanding resource allocation in this industrially relevant microorganism.

Mathematical & Computational Biology↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

raogroupuiuc/rt88_growth

Project: Integrating transcriptomic and metabolomic analysis of the oleaginous yeast Rhodosporidium toruloides IFO0880 during growth under different carbon sources Key points • Gene expression and metabolite concentrations were significantly changed. • Reduced expression of xylulokinase induces a bypass leading to arabitol production. • R. toruloides reprograms its metabolism to allow growth on different substrates.

Deewan, Anshu↗
DOE OSTI2021

Noonan syndrome patient-specific induced cardiomyocyte model carrying SOS1 gene variant c.1654A>G

Noonan syndrome (NS) is a dominant autosomal genetic disorder, associated with mutations in several genes that exhibit multisystem abnormal development including cardiac defects. NS associated with the Son of Sevenless homolog 1 (SOS1) gene mutation attributes to the development of cardiomyopathy and congenital heart defects. Since the treatment option for NS is very limited, an in vitro disease model with SOS1 gene mutation would be beneficial for exploring therapeutic possibilities for NS. We reprogrammed cardiac fibroblasts obtained from a NS patient and normal control skin fibroblasts (C-SF) into induced pluripotent stem cells (iPSCs). We identified NS-iPSCs carry a heterozygous single nucleotide variation in the SOS1 gene at the c.1654A > G. Furthermore, the control and NS-iPSCs were differentiated into induced cardiomyocytes (iCMCs), and the electron microscopic analysis showed that the sarcomeres of the NS-iCMCs were highly disorganized. FACS analysis showed that 47.5% of the NS-iCMCs co-expressed GATA4 and cardiac troponin T proteins, and the mRNA expression levels of many cardiac related genes, studied by qRT-PCR array, were significantly reduced when compared to the control C-iCMCs. We report for the first time that NS-iPSCs carry a single nucleotide variation in the SOS1 gene at the c.1654A>G were showing significantly reduced cardiac genes and proteins expression as well as structurally and functionally compromised when compared to C-iCMCs. These iPSCs and iCMCs can be used as a modeling platform to unravel the pathologic mechanisms and also the development of novel drug for the cardiomyopathy in patients with NS.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2024

Mapping of flumioxazin tolerance in a snap bean diversity panel leads to the discovery of a master genomic region controlling multiple stress resistance genes

Effective weed management tools are crucial for maintaining the profitable production of snap bean (Phaseolus vulgaris L.). Preemergence herbicides help the crop to gain a size advantage over the weeds, but the few preemergence herbicides registered in snap bean have poor waterhemp (Amaranthus tuberculatus) control, a major pest in snap bean production. Waterhemp and other difficult-to-control weeds can be managed by flumioxazin, an herbicide that inhibits protoporphyrinogen oxidase (PPO). However, there is limited knowledge about crop tolerance to this herbicide. We aimed to quantify the degree of snap bean tolerance to flumioxazin and explore the underlying mechanisms. We investigated the genetic basis of herbicide tolerance using genome-wide association mapping approach utilizing field-collected data from a snap bean diversity panel, combined with gene expression data of cultivars with contrasting response. The response to a preemergence application of flumioxazin was measured by assessing plant population density and shoot biomass variables. Snap bean tolerance to flumioxazin is associated with a single genomic location in chromosome 02. Tolerance is influenced by several factors, including those that are indirectly affected by seed size/weight and those that directly impact the herbicide's metabolism and protect the cell from reactive oxygen species-induced damage. Transcriptional profiling and co-expression network analysis identified biological pathways likely involved in flumioxazin tolerance, including oxidoreductase processes and programmed cell death. Transcriptional regulation of genes involved in those processes is possibly orchestrated by a transcription factor located in the region identified in the GWAS analysis. Several entries belonging to the Romano class, including Bush Romano 350, Roma II, and Romano Purpiat presented high levels of tolerance in this study. The alleles identified in the diversity panel that condition snap bean tolerance to flumioxazin shed light on a novel mechanism of herbicide tolerance and can be used in crop improvement.

60 APPLIED LIFE SCIENCES↗