SEARCH · Search NASA
Results for “Gene expression”
Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
The quantitative genetics of gene expression in Mimulus guttatus
Gene expression can be influenced by genetic variants that are closely linked to the expressed gene (cis eQTLs) and variants in other parts of the genome (trans eQTLs). We created a multiparental mapping population by sampling genotypes from a single natural population of Mimulus guttatus and scored gene expression in the leaves of 1,588 plants. We find that nearly every measured gene exhibits cis regulatory variation (91% have FDR < 0.05). cis eQTLs are usually allelic series with three or more functionally distinct alleles. The cis locus explains about two thirds of the standing genetic variance (on average) but varies among genes and tends to be greatest when there is high indel variation in the upstream regulatory region and high nucleotide diversity in the coding sequence. Despite mapping over 10,000 trans eQTL / affected gene pairs, most of the genetic variance generated by trans acting loci remains unexplained. This implies a large reservoir of trans acting genes with subtle or diffuse effects. Mapped trans eQTLs show lower allelic diversity but much higher genetic dominance than cis eQTLs. Several analyses also indicate that trans eQTLs make a substantial contribution to the genetic correlations in expression among different genes. They may thus be essential determinants of “gene expression modules,” which has important implications for the evolution of gene expression and how it is studied by geneticists.
Gene Expression Measurement Module (GEMM) - A Fully Automated, Miniaturized Instrument for Measuring Gene Expression in Space
The capability to measure gene expression on board spacecraft opens the door to a large number of high-value experiments on the influence of the space environment on biological systems. For example, measurements of gene expression will help us to understand adaptation of terrestrial life to conditions beyond the planet of origin, identify deleterious effects of the space environment on a wide range of organisms from microbes to humans, develop effective countermeasures against these effects, and determine the metabolic bases of microbial pathogenicity and drug resistance. These and other applications hold significant potential for discoveries in space biology, biotechnology, and medicine. Supported by funding from the NASA Astrobiology Science and Technology Instrument Development Program, we are developing a fully automated, miniaturized, integrated fluidic system for small spacecraft capable of in-situ measurement of expression of several hundreds of microbial genes from multiple samples. The instrument will be capable of (1) lysing cell walls of bacteria sampled from cultures grown in space, (2) extracting and purifying RNA released from cells, (3) hybridizing the RNA on a microarray and (4) providing readout of the microarray signal, all in a single microfluidics cartridge. The device is suitable for deployment on nanosatellite platforms developed by NASA Ames' Small Spacecraft Division. To meet space and other technical constraints imposed by these platforms, a number of technical innovations are being implemented. The integration and end-to-end technological and biological validation of the instrument are carried out using as a model the photosynthetic bacterium Synechococcus elongatus, known for its remarkable metabolic diversity and resilience to adverse conditions. Each step in the measurement process-lysis, nucleic acid extraction, purification, and hybridization to an array-is assessed through comparison of the results obtained using the instrument with those from standard laboratory protocols. Once developed, the system can be used with minor modifications for multiple experiments on different platforms in space, including extension to higher organisms and microbial monitoring. A proposed version of GEMM that is capable of handling both microbial and tissue samples on the International Space Station will be briefly summarized.
Development of dual‐inducible duet‐expression vectors for tunable gene expression control and CRISPR interference‐based gene repression in Pseudomonas putida KT2440
Summary The development of P. putida as an industrial host requires a sophisticated molecular toolbox for strain improvement, including vectors for gene expression and repression. To augment existing expression plasmids for metabolic engineering, we developed a series of dual‐inducible duet‐expression vectors for P. putida KT2440. A number of inducible promoters (P lac , P tac , P tetR/tetA and P bad ) were used in different combinations to differentially regulate the expression of individual genes. Protein expression was evaluated by measuring the fluorescence of reporter proteins (GFP and RFP). Our experiments demonstrated the use of compatible plasmids, a useful approach to coexpress multiple genes in P. putida KT2440. These duet vectors were modified to generate a fully inducible CRISPR interference system using two catalytically inactive Cas9 variants from S. pasteurianus (dCas9) and S. pyogenes (spdCas9). The utility of developed CRISPRi system(s) was demonstrated by repressing the expression of nine conditionally essential genes, resulting in growth impairment and prolonged lag phase for P. putida KT2440 growth on glucose. Furthermore, the system was shown to be tightly regulated, tunable and to provide a simple way to identify essential genes with an observable phenotype.
Phenotypically anchored transcriptomics across diverse agrichemicals reveals conserved pathways and unique gene expression signatures in zebrafish
Agrichemicals such as herbicides, fungicides, insecticides, and biocides are widely used in agriculture, yet some are associated with adverse effects in humans and the environment. While many of these chemicals have been extensively studied in vitro and are included in the EPA’s ToxCast program, comprehensive in vivo comparisons using RNA sequencing across structurally diverse agrichemicals, in a single screening platform, are lacking. In this study, we examined structurally diverse agrichemicals found in the U.S. Environmental Protection Agency’s (EPA) Toxcast Phase I and II library by statically exposing early life stage zebrafish at 6 h post fertilization (hpf) until 120 hpf at concentrations ranging from 0.25 to 100 µM. Morphological outcomes were assessed at 120 hpf across 10 endpoints, including yolk sac edema, craniofacial malformations, and axis abnormalities. Chemicals that produced robust concentration-response relationships were selected for transcriptomic profiling. For transcriptomic analysis, zebrafish were statically exposed to each chemical and sampled at 48 hpf, prior to the onset of morphological effects observed at 120 hpf. Differential expression analysis identified between 0 and 4,538 differentially expressed genes (DEGs) per chemical, with no clear correlation to morphological severity. Both DEG and co-expression network analyses revealed chemical-specific expression patterns that converged on shared biological pathways, including neurodevelopment and cytoskeletal organization. Key regulatory genes such as mylpfa and krt4 were identified within co-expression modules, suggesting their potential role in conserved toxicity mechanisms. Semantic similarity analysis of enriched gene ontology (GO) terms, when compared to existing datasets, highlighted gaps in the annotation of neurodevelopmental processes, indicating that some in vivo effects may not be fully captured by current curated resources. The results provide new insights into the modes of action of diverse agrichemicals and establish a framework for understanding how agrichemical structure relates to biological function in a vertebrate model.
Statistical methods for identifying differentially expressed genes in RNA-Seq experiments
RNA sequencing (RNA-Seq) is rapidly replacing microarrays for profiling gene expression with much improved accuracy and sensitivity. One of the most common questions in a typical gene profiling experiment is how to identify a set of transcripts that are differentially expressed between different experimental conditions. Some of the statistical methods developed for microarray data analysis can be applied to RNA-Seq data with or without modifications. Recently several additional methods have been developed specifically for RNA-Seq data sets. This review attempts to give an in-depth review of these statistical methods, with the goal of providing a comprehensive guide when choosing appropriate metrics for RNA-Seq statistical analyses.
Cellulose synthase gene expression profiling of Physcomitrella patens
Abstract The cellulose synthase ( CESA ) gene family of seed plants comprises six clades that encode isoforms with conserved expression patterns and distinct functions in cellulose synthesis complex ( CSC ) formation and primary and secondary cell wall synthesis. In mosses, which have rosette CSC s like those of seed plants but lack lignified secondary cell walls, the CESA gene family diversified independently and includes no members of the six functionally distinct seed plant clades. There are seven CESA isoforms encoded in the genome of the moss Physcomitrella patens . However, only Pp CESA 5 has been characterised functionally, and little information is available on the expression of other Pp CESA family members. We have profiled Pp CESA expression through quantitative RT ‐ PCR , analysis of promoter‐reporter lines, and cluster analysis of public microarray data in an effort to identify expression and co‐expression patterns that could help reveal the functions of Pp CESA isoforms in protein complex formation and development of specific tissues. In contrast to the tissue‐specific expression observed for seed plant CESA s, each of the Pp CESA s was broadly expressed throughout most developing tissues. Although a few statistically significant differences in expression of Pp CESA s were noted when some tissues and hormone treatments were compared, no strong co‐expression patterns were observed. Along with CESA phylogenies and lack of single Pp CESA mutant phenotypes reported elsewhere, broad overlapping expression of the Pp CESA s indicates a high degree of inter‐changeability and is consistent with a different pattern of functional specialisation in the evolution of the seed plant and moss CESA families.
Stability-driven nonnegative matrix factorization to interpret spatial gene expression and build local gene networks
Spatial gene expression patterns enable the detection of local covariability and are extremely useful for identifying local gene interactions during normal development. The abundance of spatial expression data in recent years has led to the modeling and analysis of regulatory networks. The inherent complexity of such data makes it a challenge to extract biological information. We developed staNMF, a method that combines a scalable implementation of nonnegative matrix factorization (NMF) with a new stability-driven model selection criterion. When applied to a set of Drosophila early embryonic spatial gene expression images, one of the largest datasets of its kind, staNMF identified 21 principal patterns (PP). Providing a compact yet biologically interpretable representation of Drosophila expression patterns, PP are comparable to a fate map generated experimentally by laser ablation and show exceptional promise as a data-driven alternative to manual annotations. Our analysis mapped genes to cell-fate programs and assigned putative biological roles to uncharacterized genes. Finally, we used the PP to generate local transcription factor regulatory networks. Spatially local correlation networks were constructed for six PP that span along the embryonic anterior-posterior axis. Using a two-tail 5% cutoff on correlation, we reproduced 10 of the 11 links in the well-studied gap gene network. In conclusion, the performance of PP with the Drosophila data suggests that staNMF provides informative decompositions and constitutes a useful computational lens through which to extract biological insight from complex and often noisy gene expression data.
Fluorescence In Situ mRNA Hybridization for Gene Expression Detection in a Wood Decay Fungus
Wood-degrading fungi efficiently decompose wood using a series of steps that are regulated across time and space. RNA sequencing with “bulk” sampling method has indicated processes controlled at the transcription level at different decay stages and locations along hyphal networks. To further understand these regulatory mechanisms, a high-resolution technique for gene expression determination is required. In this work, Fluorescence In Situ Hybridization (FISH) of mRNA was tested and optimized in the ‘brown rot’-type (carbohydrate-selective; lignin-rich residues) model fungus Postia (Rhodonia) placenta to image gene expression at the hyphal scale, <10 micrometers. The mRNA of one housekeeping gene Tef1a and three wood-decaying genes Cel28a, Cel5b and Qrd1 were tested in hyphae grown in liquid nutrients and wood substrate. The 20 bp-long DNA probes were successfully delivered intracellularly to give sufficient hybridization signal for imaging. Ahead of hybridization, permeabilization by lyticase and proteinase K treatments proved to be the critical step to increase probe and mRNA accessibility. Tyramide signal amplification was used after hybridization to enhance signal. This gave qualitative measures of mRNA of the four target genes, which were generally in line with previous expression patterns generated from coarser-scale RNA-seq and qRT-PCR studies. These techniques were not without challenges, and future optimization using multiple probe fragments for each mRNA molecule is proposed.
Concentration-response gene expression analysis in zebrafish reveals phenotypically-anchored transcriptional responses to retene
Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous environmental contaminants and are associated with human disease. Canonically, many PAHs induce toxicity via activation of the aryl hydrocarbon receptor (AHR) pathway. While the interaction between PAHs and the AHR is well-established, understanding which AHR-regulated transcriptional effects directly result in observable phenotypes and which are adaptive or benign is important to better understand PAH toxicity. Retene is a frequently detected PAH in environmental sampling and has been associated with AHR2-dependent developmental toxicity in zebrafish, though its mechanism of toxicity has not been fully elucidated. To interrogate transcriptional changes causally associated with retene toxicity, we conducted whole-animal RNA sequencing at 48 hours post-fertilization after exposure to eight retene concentrations. The concentrations were selected to produce effects ranging from no phenotype to mortality and malformations in 100% of animals at 5 days post-fertilization. We identified a concentration-response relationship between retene teratogenicity and differential gene expression in both number of DEGs and magnitude of expression change. Elevated expression of cyp1a at retene concentrations below the threshold for teratogenicity suggested that while cyp1a expression is a sensitive biomarker of AHR activation, it may be too sensitive to serve as a biomarker of AHR-dependent teratogenicity. Genes differentially expressed at only non-teratogenic concentrations were enriched for transforming growth factor-ß (TGF-ß) signaling pathway disruption while DEGs identified at only teratogenic concentrations were significantly enriched for response to xenobiotic stimulus and reduction-oxidation reaction activity. DEGs which spanned both non-teratogenic and teratogenic concentrations showed similar disrupted biological processes to those unique to teratogenic concentrations, indicating these processes were disrupted at low exposure concentrations. Gene co-expression network analysis identified several gene modules, including those associated with PAHs and AHR2 activation. One, Module 7, was strongly enriched for AHR2-associated genes and contained the strongest responses to retene. Benchmark concentration (BMC) of Module 7 genes identified a median BMC of 7.5 µM, nearly the highest retene concentration with no associated teratogenicity, supporting the hypothesis that Module 7 genes are largely responsible for retene toxicity.
Endoribonuclease-Based Two-Component Repressor Systems for Tight Gene Expression Control in Plants
Tight control and multifactorial regulation of gene expression are important challenges in genetic engineering and are critical for the development of regulatory circuits. Meeting these challenges will facilitate transgene expression regulation and support the fine-tuning of metabolic pathways to avoid the accumulation of undesired intermediates. By employing the endoribonuclease Csy4 and its recognition sequence from Pseudomonas aeruginosa and manipulating 5'UTR of mRNA, we developed a two-component expression-repression system to tightly control synthesis of transgene products. We demonstrated that this regulatory device was functional in monocotyledonous and dicotyledonous plant species, and showed that it can be used to repress transgene expression by > 400-fold and to synchronize transgene repression. In addition to tissue-specific transgene repression, this system offers stimuli-dependent expression control. Using a bioinformatics approach, we identified 54 orthologous systems from various bacteria, and then validated in planta the activity for a few of those systems, demonstrating the potential diversity of such a two-component repressor system.
Characterization of endogenous promoters for control of recombinant gene expression in Acidithiobacillus ferrooxidans : Endogenous Promoters for Use in A. ferrooxidans
Not provided.
Optimising the use of gene expression data to predict plant metabolic pathway memberships
Not provided.
Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar
Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.
Feed status and skin injury modulate immunopathology, global gene expression, and survival in channel catfish during virulent Aeromonas hydrophila infection
Introduction VirulentAeromonas hydrophilais a major pathogen in channel catfish (Ictalurus punctatus), that causes motileAeromonassepticemia and significant economic losses. We investigated the effect of feeding status and skin integrity on the host immune response, disease survival, and gastrointestinal pathology following a vAh challenge. Methods Using a bath immersion model, channel catfish were divided into four treatment groups: fin clipped and fed (FCF), fin clipped but not fed (FCN), not fin clipped but fed (NCF), and not fin clipped nor fed (NCN) alongside non-challenged control groups The FCF and NCF groups were fed 2 h prior to the challenge, but the FCN and NCN groups were not. Survival analysis, histopathological assessment, and RNA sequencing were conducted across groups at different time intervals throughout the vAh challenge. Results Survival rates were lowest in the FCF and FCN groups (30% and 23% survival, respectively), suggesting that both feeding and skin damage contributed to disease severity. Histopathological analyses revealed more severe intestinal and gastric lesions in fed groups, characterized by epithelial necrosis, hemorrhage, and edema. Transcriptomic analysis among the groups identified significant differentially expressed genes associated with inflammation, apoptosis, and metabolic stress, with notable upregulation of interleukin 1-beta (il-1β), and complement C3 (c3). Gene ontology enrichment highlighted distinct immune activation patterns between fed and unfed groups, with enhanced pathogen recognition and pro-inflammatory responses in unfed fish. Discussion These findings suggest feeding prior to infection may exacerbate disease pathology, potentially by creating a physiological state conducive to facilitate pathogen proliferation and dampened early immune responses, whereas short-term fasting appears to promote early immune activation. This study provides novel insights into the complex interplay between feed status, physical injury, and immune response to vAh infection.
Long-Term Effects of Very Low Dose Particle Radiation on Gene Expression in the Heart: Degenerative Disease Risks
Compared to low doses of gamma irradiation (γ-IR), high-charge-and-energy (HZE) particle IR may have different biological response thresholds in cardiac tissue at lower doses, and these effects may be IR type and dose dependent. Three- to four-month-old female CB6F1/Hsd mice were exposed once to one of four different doses of the following types of radiation: γ-IR 137Cs (40-160 cGy, 0.662 MeV), 14Si-IR (4-32 cGy, 260 MeV/n), or 22Ti-IR (3-26 cGy, 1 GeV/n). At 16 months post-exposure, animals were sacrificed and hearts were harvested and archived as part of the NASA Space Radiation Tissue Sharing Forum. These heart tissue samples were used in our study for RNA isolation and microarray hybridization. Functional annotation of twofold up/down differentially expressed genes (DEGs) and bioinformatics analyses revealed the following: (i) there were no clear lower IR thresholds for HZE- or γ-IR; (ii) there were 12 common DEGs across all 3 IR types; (iii) these 12 overlapping genes predicted various degrees of cardiovascular, pulmonary, and metabolic diseases, cancer, and aging; and (iv) these 12 genes revealed an exclusive non-linear DEG pattern in 14Si- and 22Ti-IR-exposed hearts, whereas two-thirds of γ-IR-exposed hearts revealed a linear pattern of DEGs. Thus, our study may provide experimental evidence of excess relative risk (ERR) quantification of low/very low doses of full-body space-type IR-associated degenerative disease development.
Chronic Lunar Dust Exposure on Rat Cornea: Evaluation by Gene Expression Profiling
Lunar dust is capable of entering habitats and vehicle compartments by sticking to spacesuits or other objects that are transferred into the spacecraft from the lunar surface and has been reported to cause irritation upon exposure. During the Apollo missions, crewmembers reported irritation specifically to the skin and eyes after contamination of the lunar and service modules. It has since been hypothesized that ocular irritation and abrasion might occur as a result of such exposure, impairing crew vision. Recent work has shown that both ultrafine and unground lunar dust exhibited minimal irritancy of the ocular surface (i.e., cornea); however, the assessment of the severity of ocular damage resulting from contact of lunar dust particles to the cornea has focused only on macroscopic signs of mechanical irritancy and cytotoxicity. Given the chemical reactive properties of lunar dust, exposure of the cornea may contribute to detrimental effects at the molecular level including but not limited to oxidative damage. Additionally, low level chronic exposures may confound any results obtained in previous acute studies. We report here preliminary results from a tissue sharing effort using 10‐week‐old Fischer 344 male rats chronically exposed to filtered air or jet milled lunar dust collected during Apollo 14 using a Jaeger‐NYU nose‐only chamber for a total of 120 hours (6 hours daily, 5 days a week) over a 4‐week period. RNA was isolated from corneas collected from rats at 1 day and 7 days after being exposed to concentrations of 0, 20, and 60 mg/m3 of lunar dust. Microarray analysis was performed using the Affymetrix GeneChip Rat Genome 230 2.0 Array with Affymetrix Expression Console and Transcriptome Analysis Console used for normalization and secondary analysis. An Ingenuity iReport"TM" was then generated for canonical pathway identification. The number of differentially expressed genes identified increases with dose compared to controls suggesting a more severe response to the lunar dust insult at higher levels. Pathways of interests that have been identified in all exposed samples include oxidative stress response, mitochondrial dysfunction, fibrosis, epithelial healing, TGF-Beta signaling, and extracellular matrix remodeling. Several biological processes related to cell migration, cellular proliferation, and eye development were also identified to be altered by exposure to lunar dust. Our preliminary results suggest that even a chronic insult of lunar dust as low as 20 mg/m(exp 3) elicits a molecular response in cornea tissue. Lunar dust on the surface of the moon would have the added properties of ionization and activation potentially leading to further damage to the cornea and greater sensitivity to any other environmental insult such as exposure to radiation. Additional studies are required to fully assess the risk of vision impairment and the mechanistic responses initiated in cornea exposed to lunar dust as well as the potential for long‐term effects to astronaut health
PHD Finger Recognition of Unmodified Histone H3R2 Links UHRF1 to Regulation of Euchromatic Gene Expression
Histone methylation occurs on both lysine and arginine residues, and its dynamic regulation plays a critical role in chromatin biology. Here we identify the UHRF1 PHD finger (PHD{sub UHRF1}), an important regulator of DNA CpG methylation, as a histone H3 unmodified arginine 2 (H3R2) recognition modality. This conclusion is based on binding studies and cocrystal structures of PHD{sub UHRF1} bound to histone H3 peptides, where the guanidinium group of unmodified R2 forms an extensive intermolecular hydrogen bond network, with methylation of H3R2, but not H3K4 or H3K9, disrupting complex formation. We have identified direct target genes of UHRF1 from microarray and ChIP studies. Importantly, we show that UHRF1's ability to repress its direct target gene expression is dependent on PHD{sub UHRF1} binding to unmodified H3R2, thereby demonstrating the functional importance of this recognition event and supporting the potential for crosstalk between histone arginine methylation and UHRF1 function.