SEARCH · Search NASA

Results for “synthetic”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 37 records · Page 2

All sources NASA NTRS DOE OSTI

NASA NTRS2016

On Beyond Star Trek, the Role of Synthetic Biology in Nasa's Missions

The time has come to for NASA to exploit the nascent field of synthetic biology in pursuit of its mission, including aeronautics, earth science, astrobiology and notably, human exploration. Conversely, NASA advances the fundamental technology of synthetic biology as no one else can because of its unique expertise in the origin of life and life in extreme environments, including the potential for alternate life forms. This enables unique, creative "game changing" advances. NASA's requirement for minimizing upmass in flight will also drive the field toward miniaturization and automation. These drivers will greatly increase the utility of synthetic biology solutions for military, health in remote areas and commercial purposes. To this end, we have begun a program at NASA to explore the use of synthetic biology in NASA's missions, particularly space exploration. As part of this program, we began hosting an iGEM team of undergraduates drawn from Brown and Stanford Universities to conduct synthetic biology research at NASA Ames Research Center. The 2011 team (http://2011.igem.org/Team:Brown-Stanford) produced an award-winning project on using synthetic biology as a basis for a human Mars settlement and the 2012 team has expanded the use of synthetic biology to estimate the potential for life in the clouds of other planets (http://2012.igem.org/Team:Stanford-Brown; http://www.calacademy.org/sciencetoday/igem-competition/). More recent projects from the Stanford-Brown team have expanded our ideas of how synthetic biology can aid NASA's missions from "Synthetic BioCommunication" (http://2013.igem.org/Team:Stanford-Brown) to a "Biodegradable UAS (drone)" in collaboration with Spelman College (http://2014.igem.org/Team:StanfordBrownSpelman#SBS%20iGEM) and most recently, "Self-Folding Origami" (http://2015.igem.org/Team:Stanford-Brown), the winner of the 2015 award for Manufacturing.

miniaturization and automation↗

NASA NTRS2016

Misconceptions of Synthetic Biology: Lessons from an Interdisciplinary Summer School

In 2014, an international group of scholars from various fields analysed the "societal dimensions" of synthetic biology in an interdisciplinary summer school. Here, we report and discuss the biologists' observations on the general perception of synthetic biology by non-biologists who took part in this event. Most attendees mainly associated synthetic biology with contributions from the best-known public figures of the field, rarely mentioning other scientists. Media extrapolations of those contributions appeared to have created unrealistic expectations and irrelevant fears that were widely disconnected from the current research in synthetic biology. Another observation was that when debating developments in synthetic biology, semantics strongly mattered: depending on the terms used to present an application of synthetic biology, attendees reacted in radically different ways. For example, using the term "GMOs" (genetically modified organisms) rather than the term "genetic engineering" led to very different reactions. Stimulating debates also happened with participants having unanticipated points of view, for instance biocentrist ethicists who argued that engineered microbes should not be used for human purposes. Another communication challenge emerged from the connotations and inaccuracies surrounding the word "life", which impaired constructive debates, thus leading to misconceptions about the abilities of scientists to engineer or even create living organisms. Finally, it appeared that synthetic biologists tend to overestimate the knowledge of non-biologists, further affecting communication. The motivation and ability of synthetic biologists to communicate their work outside their research field needs to be fostered, notably towards policymakers who need a more accurate and technical understanding of the field to make informed decisions. Interdisciplinary events gathering scholars working in and around synthetic biology are an effective tool in addressing those issues.

synthetic biology↗

NASA NTRS2019

The Role of Synthetic Biology in NASA's Missions

Rothschild, Lynn J.↗

DOE OSTI2020

Synthetic membranes and methods of use thereof

The present invention relates to synthetic membranes and use of these synthetic membranes for isolation of volatile organic compounds and purification of water. The synthetic membrane includes a hydrophobic polymer layer located on a polymeric membrane support layer. The invention includes a method of isolating volatile organic compounds with the synthetic membrane by contacting a volatile organic mixture with the hydrophobic polymer layer of the synthetic membrane and removing volatile organic compounds from the polymeric membrane support layer of the synthetic membrane by a process of pervaporation. The invention also includes a method of purifying water with the synthetic membrane by contacting an ionic solution with the hydrophobic polymer layer of the synthetic membrane and removing water from the polymeric membrane support layer of the synthetic membrane by a process of reverse osmosis. The invention also relates to methods of isolating non-polar gases by gas fractionation.

36 MATERIALS SCIENCE↗

DOE OSTI2021

Synthetic membranes and methods of use thereof

Belfort, Georges↗

DOE OSTI2021

Synthetic membranes and methods of use thereof

Belfort, Georges↗

DOE OSTI2021

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

09 BIOMASS FUELS↗

NASA NTRS2002

Synthetic Jet Interaction With A Turbulent Boundary Layer Flow

Perhaps one of the more notable advances to have occurred in flow control technology in the last fifteen years is the application of surface-issuing jets for separation control on aerodynamic surfaces. The concept was introduced by Johnston and Night (1990) who proposed using circular jets, skewed and inclined to the wall, to generate streamwise vortices for the purpose of mitigating boundary layer separation. The skew and inclination angles have subsequently been shown to affect the strength and sign of the ensuing vortices. With a non-circular orifice, in addition to skew and inclination, the yaw angle of the major axis of the orifice can influence the flow control effectiveness of the jet. In particular, a study by Chang arid Collins (1997) revealed that a non-circular orifice, yawed relative to the freestream, can be used to control the size and strength of the vortices produced by the control jet. This early work used jets with only a steady injection of mass. Seifert et al. revealed that an unsteady blowing jet, could be as effective at separation control as a steady jet but with less mass flow. Seifert et al. showed that small amplitude blowing oscillations superimposed on a low momentum steady jet Was the most effective approach to delaying separation on a NACA 0015 airfoil at post-stall angles of attack. More recent work suggests that perhaps the most efficient jet control effect comes from a synthetic (oscillatory) jet where the time-averaged mass flux through the orifice is zero, but the net wall normal momentum is non-zero. The control effectiveness of synthetic jets has been demonstrated for several internal and external flow fields used synthetic jet control on a thick, blunt-nosed airfoil to delay stall well beyond the stall angles for the uncontrolled airfoil and with a dramatic increase in the lift-to-drag performance. Amitay et al. used an array of synthetic jets to mitigate flow separation in curved and diffusing ducts. While the control effectiveness of synthetic jet actuators in an application setting has been confirmed through a number of studies, the fluid dynamic mechanism by which control is effected is not well understood. Issues like yaw angle arid velocity ratio that have been studied for steady control jets have not been investigated for synthetic jets. Moreover, the role played by the inherently unsteady nature of a synthetic jet in the interaction with the controlled flow is not known. Some recent work by Rinehart and Glazer and Smith suggests that away from tile immediate vicinity of the jet orifice the flow field is steady in the mean, and that the interaction of a synthetic jet and a boundary layer creates a secondary flow in the boundary layer consisting primarily of streamwise vortices.

Smith, Douglas R.↗

DOE OSTI2024

Data-Informed Synthetic Networks of Water Distribution Systems for Resilience Analysis in Puerto Rico

The increasing potential of infrastructure disruptions calls for high-quality infrastructure models to be used in resilience analysis and decision making. Unfortunately, many utilities and communities do not have access to accurate and detailed models due to a lack of data and resources. Furthermore, security restrictions on sharing infrastructure models present roadblocks to research, analysis, and decision making. Recent advances in the development of synthetic water distribution models provide a potential solution to this problem. There is an opportunity to improve these methods by leveraging incomplete pipe datasets to aid synthetic network generation. To address this gap, we developed a methodology for synthetic network generation that incorporates partial pipe data using a modification of the minimum cost flow algorithm for network generation and pipe sizing. This methodology demonstrates how partial pipe data can be leveraged to improve site-specific synthetic network generation. For the study area of Mayagüez, Puerto Rico, a synthetic model generated using 50% of real pipe data matches the pressure of the validation system with an average error of 23.5 m of head, which improves upon the average error of 31.6 m of head produced by a synthetic model generated using no data of the real pipes. Additionally, synthetic networks are shown to replicate the pressure response under a disruption scenario of the validation network, suggesting potential use in resilience analysis.

resilience analysis↗

DOE OSTI2020

SYMBA: An end-to-end VLBI synthetic data generation pipeline

Realistic synthetic observations of theoretical source models are essential for our understanding of real observational data. In using synthetic data, one can verify the extent to which source parameters can be recovered and evaluate how various data corruption effects can be calibrated. These studies are the most important when proposing observations of new sources, in the characterization of the capabilities of new or upgraded instruments, and when verifying model-based theoretical predictions in a direct comparison with observational data. We present the SYnthetic Measurement creator for long Baseline Arrays (SYMBA), a novel synthetic data generation pipeline for Very Long Baseline Interferometry (VLBI) observations. SYMBA takes into account several realistic atmospheric, instrumental, and calibration effects. Here, we used SYMBA to create synthetic observations for the Event Horizon Telescope (EHT), a millimetre VLBI array, which has recently captured the first image of a black hole shadow. After testing SYMBA with simple source and corruption models, we study the importance of including all corruption and calibration effects, compared to the addition of thermal noise only. Using synthetic data based on two example general relativistic magnetohydrodynamics (GRMHD) model images of M 87, we performed case studies to assess the image quality that can be obtained with the current and future EHT array for different weather conditions. Our synthetic observations show that the effects of atmospheric and instrumental corruptions on the measured visibilities are significant. Despite these effects, we demonstrate how the overall structure of our GRMHD source models can be recovered robustly with the EHT2017 array after performing calibration steps, which include fringe fitting, a priori amplitude and network calibration, and self-calibration. With the planned addition of new stations to the EHT array in the coming years, images could be reconstructed with higher angular resolution and dynamic range. In our case study, these improvements allowed for a distinction between a thermal and a non-thermal GRMHD model based on salient features in reconstructed images.

79 ASTRONOMY AND ASTROPHYSICS↗

DOE OSTI2021

Improving the Methanol Tolerance of an Escherichia coli Methylotroph via Adaptive Laboratory Evolution Enhances Synthetic Methanol Utilization

There is great interest in developing synthetic methylotrophs that harbor methane and methanol utilization pathways in heterologous hosts such as Escherichia coli for industrial bioconversion of one-carbon compounds. While there are recent reports that describe the successful engineering of synthetic methylotrophs, additional efforts are required to achieve the robust methylotrophic phenotypes required for industrial realization. Here, we address an important issue of synthetic methylotrophy in E. coli : methanol toxicity. Both methanol, and its oxidation product, formaldehyde, are cytotoxic to cells. Methanol alters the fluidity and biological properties of cellular membranes while formaldehyde reacts readily with proteins and nucleic acids. Thus, efforts to enhance the methanol tolerance of synthetic methylotrophs are important. Here, adaptive laboratory evolution was performed to improve the methanol tolerance of several E. coli strains, both methylotrophic and non-methylotrophic. Serial batch passaging in rich medium containing toxic methanol concentrations yielded clones exhibiting improved methanol tolerance. In several cases, these evolved clones exhibited a > 50% improvement in growth rate and biomass yield in the presence of high methanol concentrations compared to the respective parental strains. Importantly, one evolved clone exhibited a two to threefold improvement in the methanol utilization phenotype, as determined via 13 C-labeling, at non-toxic, industrially relevant methanol concentrations compared to the respective parental strain. Whole genome sequencing was performed to identify causative mutations contributing to methanol tolerance. Common mutations were identified in 30S ribosomal subunit proteins, which increased translational accuracy and provided insight into a novel methanol tolerance mechanism. This study addresses an important issue of synthetic methylotrophy in E. coli and provides insight as to how methanol toxicity can be alleviated via enhancing methanol tolerance. Coupled improvement of methanol tolerance and synthetic methanol utilization is an important advancement for the field of synthetic methylotrophy.

Bennett, R. Kyle↗

NASA NTRS1995

Distributed and collaborative synthetic environments

Fast graphics workstations and increased computing power, together with improved interface technologies, have created new and diverse possibilities for developing and interacting with synthetic environments. A synthetic environment system is generally characterized by input/output devices that constitute the interface between the human senses and the synthetic environment generated by the computer; and a computation system running a real-time simulation of the environment. A basic need of a synthetic environment system is that of giving the user a plausible reproduction of the visual aspect of the objects with which he is interacting. The goal of our Shastra research project is to provide a substrate of geometric data structures and algorithms which allow the distributed construction and modification of the environment, efficient querying of objects attributes, collaborative interaction with the environment, fast computation of collision detection and visibility information for efficient dynamic simulation and real-time scene display. In particular, we address the following issues: (1) A geometric framework for modeling and visualizing synthetic environments and interacting with them. We highlight the functions required for the geometric engine of a synthetic environment system. (2) A distribution and collaboration substrate that supports construction, modification, and interaction with synthetic environments on networked desktop machines.

Bajaj, Chandrajit L.↗

NASA NTRS2017

Monitoring Land Surface Albedo and Vegetation Dynamics Using High Spatial and Temporal Resolution Synthetic Time Series from Landsat and the MODIS BRDF/NBAR/Albedo Product

Seasonal vegetation phenology can significantly alter surface albedo which in turn affects the global energy balance and the albedo warmingcooling feedbacks that impact climate change. To monitor and quantify the surface dynamics of heterogeneous landscapes, high temporal and spatial resolution synthetic time series of albedo and the enhanced vegetation index (EVI) were generated from the 500-meter Moderate Resolution Imaging Spectroradiometer (MODIS) operational Collection V006 daily BRDF (Bidirectional Reflectance Distribution Function) / NBAR (Nadir BRDF-Adjusted Reflectance) / albedo products and 30-meter Landsat 5 albedo and near-nadir reflectance data through the use of the Spatial and Temporal Adaptive Reflectance Fusion Model (STARFM). The traditional Landsat Albedo (Shuai et al., 2011) makes use of the MODIS BRDFAlbedo products (MCD43) by assigning appropriate BRDFs from coincident MODIS products to each Landsat image to generate a 30-meter Landsat albedo product for that acquisition date. The available cloud free Landsat 5 albedos (due to clouds, generated every 16 days at best) were used in conjunction with the daily MODIS albedos to determine the appropriate 30-meter albedos for the intervening daily time steps in this study. These enhanced daily 30-meter spatial resolution synthetic time series were then used to track albedo and vegetation phenology dynamics over three Ameriflux tower sites (Harvard Forest in 2007, Santa Rita in 2011 and Walker Branch in 2005). These Ameriflux sites were chosen as they are all quite nearby new towers coming on line for the National Ecological Observatory Network (NEON), and thus represent locations which will be served by spatially paired albedo measures in the near future. The availability of data from the NEON towers will greatly expand the sources of tower albedometer data available for evaluation of satellite products. At these three Ameriflux tower sites the synthetic time series of broadband shortwave albedos were evaluated using the tower albedo measurements with a Root Mean Square Error (RMSE) less than 0.013 and a bias within the range of 0.006. These synthetic time series provide much greater spatial detail than the 500 meter gridded MODIS data, especially over more heterogeneous surfaces, which improves the efforts to characterize and monitor the spatial variation across species and communities. The mean of the difference between maximum and minimum synthetic time series of albedo within the MODIS pixels over a subset of satellite data of Harvard Forest (16 kilometers by 14 kilometers) was as high as 0.2 during the snow-covered period and reduced to around 0.1 during the snow-free period. Similarly, we have used STARFM to also couple MODIS Nadir BRDF-Adjusted Reflectances (NBAR) values with Landsat 5 reflectances to generate daily synthetic times series of NBAR and thus Enhanced Vegetation Index (NBAR-EVI) at a 30-meter resolution. While normally STARFM is used with directional reflectances, the use of the view angle corrected daily MODIS NBAR values will provide more consistent time series. These synthetic times series of EVI are shown to capture seasonal vegetation dynamics with finer spatial and temporal details, especially over heterogeneous land surfaces.

Vegetation Index↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2022

Kimberlina 1.2 CCUS Geophysical Models and Synthetic Data Sets

This synthetic multi-scale and multi-physics data set was produced in collaboration with teams at the Lawrence Berkeley National Laboratory, National Energy Technology Laboratory, Los Alamos National Laboratory, and Colorado School of Mines through the Science-informed Machine Learning for Accelerating Real-Time Decisions in Subsurface Applications (SMART) Initiative. Data are associated with the following publication: Alumbaugh, D., Gasperikova, E., Crandall, D., Commer, M., Feng, S., Harbert, W., Li, Y., Lin, Y., and Samarasinghe, S., “The Kimberlina Synthetic Geophysical Model and Data Set for CO2 Monitoring Investigations”, The Geoscience Data Journal, 2023, DOI: 10.1002/gdj3.191. The dataset uses the Kimberlina 1.2 CO2 reservoir flow model simulations based on a hypothetical CO2 storage site in California (Birkholzer et al., 2011; Wainwright et al., 2013). Geophysical properties models (P- and S-wave seismic velocities, saturated density, and electrical resistivity) were produced with an approach similar to that of Yang et al. (2019) and Gasperikova et al. (2022) for 100 Kimberlina 1.2 reservoir models. Links to individual resources are provided below: [CO2 Saturation Models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-co2-saturation-models); Resistivity Models – [part 1](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-resistivity-models-part-1), [part 2](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-resistivity-models-part-2), and [part 3](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-resistivity-models-part-3); [Vp Velocity Models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-vp-velocity-models); [Vs Velocity Models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-vs-velocity-models); [Density Models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-density-models). The 3D distributions of geophysical properties for the 33 time stamps of the SIM001 model were used to generate synthetic seismic, gravity, and electromagnetic (EM) responses for 33 times between zero and 200 years. Synthetic surface seismic data were generated using 2D and 3D finite-difference codes that simulate the acoustic wave equation (Moczo et al., 2007). 2D data were simulated for six point-pressure sources along a 2D line with 10 m receiver spacing and a time spacing of 0.0005 s. 3D simulations were completed for 25 surface pressure sources using a source separation of 1 km in both the x and y directions and a time spacing of 0.001 s. Links to individual resources are provided below: [2D velocity models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-2d-velocity-models) and [2D surface seismic data](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-2d-surface-seismic-data). [3D velocity models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-velocity-models), and 3D seismic data [year0](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year0), [year1](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year1), [year2](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year2), [year5](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year5), [year10](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year10), [year15](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year15), [year20](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year20), [year25](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year25), [year30](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year30), [year35](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year35), [year40](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year40), [year45](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year45), [year49](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year49), [year50](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year50), [year51](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year51), [year52](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year52), [year55](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year55), [year60](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year60), [year65](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year65), [year70](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year70), [year75](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year75), [year80](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year80), [year85](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year85), [year90](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year90), [year95](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year95), [year100](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year100), [year110](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year110), [year120](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year120), [year130](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year130), [year140](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year140), [year150](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year150), [year175](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year175), [year200](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year200). The Python scripts to read these models and data are provided [here](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-python-scripts). EM simulations used a borehole-to-surface survey configuration, with the source located near the reservoir level and receivers on the surface using the code developed by Commer and Newman (2008). Pseudo-2D data for the source at [2500 m](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-pseudo-2d-csem-data-tz2500m) and [3025 m](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-pseudo-2d-csem-data-tz3025m), used a 2D inline receiver configuration to simulate a response over 3D resistivity models. The [3D data](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-csem-data) contain electric fields generated by borehole sources at monitoring well locations and measured over a surface receiver grid. Vector gravity data, both on the surface and in boreholes, were simulated using a modeling code developed by Rim and Li (2015). The simulation scenarios were parallel to those used for the EM: [pseudo-2D data](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-gravity-data) were calculated along the same lines and within the same boreholes, and [3D data](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-gravity-data) were simulated over 3D models on the surface and in three monitoring wells. A series of [synthetic well logs](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-well-logs) of CO2 saturation, acoustic velocity, density, and induction resistivity in the injection well and three monitoring wells are also provided at 0, 1, 2, 5, 10, 15, and 20 years after the initiation of injection. These were constructed by combining the low-frequency trend of the geophysical models with the high-frequency variations of actual well logs collected in the Kimberlina 1 well that was drilled at the proposed site. Measurements of permeability and pore connectivity were made on cores of Vedder Sandstone, which forms the primary reservoir unit: [CT micro scans](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-ct-micro-scans-of-vedder-formation) and [Industrial CT Images](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-industrial-ct-images-vedder-formation). These measurements provide the range of scales in the otherwise synthetic data set to be as close to a real-world situation as possible. References: Birkholzer, J.T., Zhou, Q., Cortis, A. and Finsterle, S., 2011. A sensitivity study on regional pressure buildup from large-scale CO2 storage projects. Energy Procedia, 4, 4371-4378. Commer, M., and Newman, G.A., 2008. New advances in three-dimensional controlled-source electromagnetic inversion, Geophysical Journal International, 172, 513-535. Gasperikova, E., Appriou, D., Bonneville, A., Feng, Z., Huang, L., Gao, K., Yang, X., Daley, T., 2022, Sensitivity of geophysical techniques for monitoring secondary CO2 storage plumes, Int. J. Greenh. Gas Control, Volume 114, 103585, ISSN 1750-5836, https://doi.org/10.1016/j.ijggc.2022.103585. Moczo, P., J.O. Robertsson and L. Eisner, 2007, The finite-difference time-domain method for modeling of seismic wave propagation: Advances in geophysics, 48, 421-516. Rim, H., and Y. Li, 2015, Advantages of borehole vector gravity in density imaging, Geophysics, 80, G1-G13. Wainwright, H. M.; Finsterle, S.; Zhou, Q.; Birkholzer, J. T., 2013. Modeling the Performance of Large-Scale CO2 Storage Systems: A Comparison of Different Sensitivity Analysis Methods. International Journal of Greenhouse Gas Control, 17, 189205. https://doi.org/10.1016/j.ijggc.2013.05.007, DOI: 10.18141/1603331. Yang, X., Buscheck, T.A., Mansoor, K., Wang, Z., Gao, K., Huang, L., Appriou, D., and Carroll, S.A., 2019. Assessment of geophysical monitoring methods for detection of brine and CO2 leakage in drinking water aquifers, International Journal of Greenhouse Gas Control, 90, 102803, https://doi.org/10.1016/j.ijggc.2019.102803.

CCUS↗

DOE OSTI2020

Quantitative and Predictive Genetic Parts for Plant Synthetic Biology

Plant synthetic biology aims to harness the natural abilities of plants and to turn them to new purposes. A primary goal of plant synthetic biology is to produce predictable and programmable genetic circuits from simple regulatory elements and well-characterized genetic components. The number of available DNA parts for plants is increasing, and the methods for rapid quantitative characterization are being developed, but the field of plant synthetic biology is still in its early stages. We here describe methods used to describe the quantitative properties of genetic components needed for plant synthetic biology. Once the quantitative properties and transfer function of a variety of genetic parts are known, computers can select the optimal components to assemble into functional devices, such as toggle switches and positive feedback circuits. However, while the variety of circuits and traits that can be put into plants are limitless, doing synthetic biology in plants poses unique challenges. Plants are composed of differentiated cells and tissues, each representing potentially unique regulatory or developmental contexts to introduced synthetic genetic circuits. Further, plants have evolved to be highly sensitive to environmental influences, such as light or temperature, any of which can affect the quantitative function of individual parts or whole circuits. Measuring the function of plant components within the context of a plant cell and, ideally, in a living plant, will be essential to using these components in gene circuits with predictable function. Mathematical modeling will be needed to account for the variety of contexts a genetic part will experience in different plant tissues or environments. With such understanding in hand, it may be possible to redesign plant traits to serve human and environmental needs.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2023

Motility of Synthetic Cells from Engineered Lipids

Synthetic cells are artificial systems that resemble natural cells. Significant efforts have been made over the years to construct synthetic protocells that can mimic biological mechanisms and perform various complex processes. These include compartmentalization, metabolism, energy supply, communication, and gene reproduction. Cell motility is also of great importance, as nature uses elegant mechanisms for intracellular trafficking, immune response, and embryogenesis. In this review, we discuss the motility of synthetic cells made from lipid vesicles and relevant molecular mechanisms. Synthetic cell motion may be classified into surface-based or solution-based depending on whether it involves interactions with surfaces or movement in fluids. Collective migration behaviors have also been demonstrated. The swarm motion requires additional mechanisms for intercellular signaling and directional motility that enable communication and coordination among the synthetic vesicles. In addition, intracellular trafficking for molecular transport has been reconstituted in minimal cells with the help of DNA nanotechnology. These efforts demonstrate synthetic cells that can move, detect, respond, and interact. Finally, we envision that new developments in protocell motility will enhance our understanding of biological processes and be instrumental in bioengineering and therapeutic applications.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2020

Editorial: Proceedings of ICPSBBB 2018 - 2nd International Conference on Plant Synthetic Biology, Bioengineering and Biotechnology

Plant synthetic biology combines engineering principles with plant biology toward the design, construction, and testing of plants with new traits (Liu and Stewart, 2015). Synthetic biology applies engineering principles, using defined genetic parts with the aim of achieving predictable outcomes. The field aims at providing fuels, pharmaceuticals, bioactive metabolites and increased crop yield. Synthetic biology is increasingly forming a framework in genetic transformation of plants allowing us to improve traits and crop performance. The conference on Plant Synthetic Biology, Bioengineering, and Biotechnology covers broad aspects of plant synthetic biology, ranging from tools to the design of predictable functions and precision genome editing, to re-designed photosynthesis, plant bioengineering techniques, and rational design of novel plant traits. This Frontiers in Plant Science virtual issue on the “Research Topic Proceedings of ICPSBBB 2018 - 2nd International Conference on Plant Synthetic Biology, Bioengineering and Biotechnology” consists of 8 publications, including four reviews and four original research articles, which fall into the following general topics: quantitative and genetic parts, evolution, expression of transgenes and epigenetic changes, engineering of stress tolerance and bioproduction.

59 BASIC BIOLOGICAL SCIENCES↗