SEARCH · Search NASA

Results for “synthetic”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 37 records · Page 2

All sources NASA NTRS DOE OSTI

DOE OSTI2020

Synthetic membranes and methods of use thereof

The present invention relates to synthetic membranes and use of these synthetic membranes for isolation of volatile organic compounds and purification of water. The synthetic membrane includes a hydrophobic polymer layer located on a polymeric membrane support layer. The invention includes a method of isolating volatile organic compounds with the synthetic membrane by contacting a volatile organic mixture with the hydrophobic polymer layer of the synthetic membrane and removing volatile organic compounds from the polymeric membrane support layer of the synthetic membrane by a process of pervaporation. The invention also includes a method of purifying water with the synthetic membrane by contacting an ionic solution with the hydrophobic polymer layer of the synthetic membrane and removing water from the polymeric membrane support layer of the synthetic membrane by a process of reverse osmosis. The invention also relates to methods of isolating non-polar gases by gas fractionation.

36 MATERIALS SCIENCE↗

DOE OSTI2021

Synthetic membranes and methods of use thereof

Belfort, Georges↗

DOE OSTI2021

Synthetic membranes and methods of use thereof

Belfort, Georges↗

DOE OSTI2021

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

09 BIOMASS FUELS↗

DOE OSTI2024

Data-Informed Synthetic Networks of Water Distribution Systems for Resilience Analysis in Puerto Rico

The increasing potential of infrastructure disruptions calls for high-quality infrastructure models to be used in resilience analysis and decision making. Unfortunately, many utilities and communities do not have access to accurate and detailed models due to a lack of data and resources. Furthermore, security restrictions on sharing infrastructure models present roadblocks to research, analysis, and decision making. Recent advances in the development of synthetic water distribution models provide a potential solution to this problem. There is an opportunity to improve these methods by leveraging incomplete pipe datasets to aid synthetic network generation. To address this gap, we developed a methodology for synthetic network generation that incorporates partial pipe data using a modification of the minimum cost flow algorithm for network generation and pipe sizing. This methodology demonstrates how partial pipe data can be leveraged to improve site-specific synthetic network generation. For the study area of Mayagüez, Puerto Rico, a synthetic model generated using 50% of real pipe data matches the pressure of the validation system with an average error of 23.5 m of head, which improves upon the average error of 31.6 m of head produced by a synthetic model generated using no data of the real pipes. Additionally, synthetic networks are shown to replicate the pressure response under a disruption scenario of the validation network, suggesting potential use in resilience analysis.

resilience analysis↗

DOE OSTI2020

SYMBA: An end-to-end VLBI synthetic data generation pipeline

Realistic synthetic observations of theoretical source models are essential for our understanding of real observational data. In using synthetic data, one can verify the extent to which source parameters can be recovered and evaluate how various data corruption effects can be calibrated. These studies are the most important when proposing observations of new sources, in the characterization of the capabilities of new or upgraded instruments, and when verifying model-based theoretical predictions in a direct comparison with observational data. We present the SYnthetic Measurement creator for long Baseline Arrays (SYMBA), a novel synthetic data generation pipeline for Very Long Baseline Interferometry (VLBI) observations. SYMBA takes into account several realistic atmospheric, instrumental, and calibration effects. Here, we used SYMBA to create synthetic observations for the Event Horizon Telescope (EHT), a millimetre VLBI array, which has recently captured the first image of a black hole shadow. After testing SYMBA with simple source and corruption models, we study the importance of including all corruption and calibration effects, compared to the addition of thermal noise only. Using synthetic data based on two example general relativistic magnetohydrodynamics (GRMHD) model images of M 87, we performed case studies to assess the image quality that can be obtained with the current and future EHT array for different weather conditions. Our synthetic observations show that the effects of atmospheric and instrumental corruptions on the measured visibilities are significant. Despite these effects, we demonstrate how the overall structure of our GRMHD source models can be recovered robustly with the EHT2017 array after performing calibration steps, which include fringe fitting, a priori amplitude and network calibration, and self-calibration. With the planned addition of new stations to the EHT array in the coming years, images could be reconstructed with higher angular resolution and dynamic range. In our case study, these improvements allowed for a distinction between a thermal and a non-thermal GRMHD model based on salient features in reconstructed images.

79 ASTRONOMY AND ASTROPHYSICS↗

DOE OSTI2021

Improving the Methanol Tolerance of an Escherichia coli Methylotroph via Adaptive Laboratory Evolution Enhances Synthetic Methanol Utilization

There is great interest in developing synthetic methylotrophs that harbor methane and methanol utilization pathways in heterologous hosts such as Escherichia coli for industrial bioconversion of one-carbon compounds. While there are recent reports that describe the successful engineering of synthetic methylotrophs, additional efforts are required to achieve the robust methylotrophic phenotypes required for industrial realization. Here, we address an important issue of synthetic methylotrophy in E. coli : methanol toxicity. Both methanol, and its oxidation product, formaldehyde, are cytotoxic to cells. Methanol alters the fluidity and biological properties of cellular membranes while formaldehyde reacts readily with proteins and nucleic acids. Thus, efforts to enhance the methanol tolerance of synthetic methylotrophs are important. Here, adaptive laboratory evolution was performed to improve the methanol tolerance of several E. coli strains, both methylotrophic and non-methylotrophic. Serial batch passaging in rich medium containing toxic methanol concentrations yielded clones exhibiting improved methanol tolerance. In several cases, these evolved clones exhibited a > 50% improvement in growth rate and biomass yield in the presence of high methanol concentrations compared to the respective parental strains. Importantly, one evolved clone exhibited a two to threefold improvement in the methanol utilization phenotype, as determined via 13 C-labeling, at non-toxic, industrially relevant methanol concentrations compared to the respective parental strain. Whole genome sequencing was performed to identify causative mutations contributing to methanol tolerance. Common mutations were identified in 30S ribosomal subunit proteins, which increased translational accuracy and provided insight into a novel methanol tolerance mechanism. This study addresses an important issue of synthetic methylotrophy in E. coli and provides insight as to how methanol toxicity can be alleviated via enhancing methanol tolerance. Coupled improvement of methanol tolerance and synthetic methanol utilization is an important advancement for the field of synthetic methylotrophy.

Bennett, R. Kyle↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2022

Kimberlina 1.2 CCUS Geophysical Models and Synthetic Data Sets

This synthetic multi-scale and multi-physics data set was produced in collaboration with teams at the Lawrence Berkeley National Laboratory, National Energy Technology Laboratory, Los Alamos National Laboratory, and Colorado School of Mines through the Science-informed Machine Learning for Accelerating Real-Time Decisions in Subsurface Applications (SMART) Initiative. Data are associated with the following publication: Alumbaugh, D., Gasperikova, E., Crandall, D., Commer, M., Feng, S., Harbert, W., Li, Y., Lin, Y., and Samarasinghe, S., “The Kimberlina Synthetic Geophysical Model and Data Set for CO2 Monitoring Investigations”, The Geoscience Data Journal, 2023, DOI: 10.1002/gdj3.191. The dataset uses the Kimberlina 1.2 CO2 reservoir flow model simulations based on a hypothetical CO2 storage site in California (Birkholzer et al., 2011; Wainwright et al., 2013). Geophysical properties models (P- and S-wave seismic velocities, saturated density, and electrical resistivity) were produced with an approach similar to that of Yang et al. (2019) and Gasperikova et al. (2022) for 100 Kimberlina 1.2 reservoir models. Links to individual resources are provided below: [CO2 Saturation Models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-co2-saturation-models); Resistivity Models – [part 1](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-resistivity-models-part-1), [part 2](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-resistivity-models-part-2), and [part 3](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-resistivity-models-part-3); [Vp Velocity Models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-vp-velocity-models); [Vs Velocity Models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-vs-velocity-models); [Density Models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-density-models). The 3D distributions of geophysical properties for the 33 time stamps of the SIM001 model were used to generate synthetic seismic, gravity, and electromagnetic (EM) responses for 33 times between zero and 200 years. Synthetic surface seismic data were generated using 2D and 3D finite-difference codes that simulate the acoustic wave equation (Moczo et al., 2007). 2D data were simulated for six point-pressure sources along a 2D line with 10 m receiver spacing and a time spacing of 0.0005 s. 3D simulations were completed for 25 surface pressure sources using a source separation of 1 km in both the x and y directions and a time spacing of 0.001 s. Links to individual resources are provided below: [2D velocity models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-2d-velocity-models) and [2D surface seismic data](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-2d-surface-seismic-data). [3D velocity models](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-velocity-models), and 3D seismic data [year0](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year0), [year1](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year1), [year2](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year2), [year5](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year5), [year10](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year10), [year15](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year15), [year20](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year20), [year25](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year25), [year30](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year30), [year35](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year35), [year40](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year40), [year45](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year45), [year49](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year49), [year50](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year50), [year51](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year51), [year52](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year52), [year55](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year55), [year60](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year60), [year65](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year65), [year70](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year70), [year75](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year75), [year80](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year80), [year85](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year85), [year90](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year90), [year95](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year95), [year100](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year100), [year110](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year110), [year120](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year120), [year130](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year130), [year140](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year140), [year150](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year150), [year175](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year175), [year200](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-seismic-data-year200). The Python scripts to read these models and data are provided [here](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-python-scripts). EM simulations used a borehole-to-surface survey configuration, with the source located near the reservoir level and receivers on the surface using the code developed by Commer and Newman (2008). Pseudo-2D data for the source at [2500 m](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-pseudo-2d-csem-data-tz2500m) and [3025 m](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-pseudo-2d-csem-data-tz3025m), used a 2D inline receiver configuration to simulate a response over 3D resistivity models. The [3D data](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-3d-csem-data) contain electric fields generated by borehole sources at monitoring well locations and measured over a surface receiver grid. Vector gravity data, both on the surface and in boreholes, were simulated using a modeling code developed by Rim and Li (2015). The simulation scenarios were parallel to those used for the EM: [pseudo-2D data](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-gravity-data) were calculated along the same lines and within the same boreholes, and [3D data](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-gravity-data) were simulated over 3D models on the surface and in three monitoring wells. A series of [synthetic well logs](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-well-logs) of CO2 saturation, acoustic velocity, density, and induction resistivity in the injection well and three monitoring wells are also provided at 0, 1, 2, 5, 10, 15, and 20 years after the initiation of injection. These were constructed by combining the low-frequency trend of the geophysical models with the high-frequency variations of actual well logs collected in the Kimberlina 1 well that was drilled at the proposed site. Measurements of permeability and pore connectivity were made on cores of Vedder Sandstone, which forms the primary reservoir unit: [CT micro scans](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-ct-micro-scans-of-vedder-formation) and [Industrial CT Images](https://edx.netl.doe.gov/dataset/kimberlina-1-2-ccus-geophysical-models-and-synthetic-data-sets-industrial-ct-images-vedder-formation). These measurements provide the range of scales in the otherwise synthetic data set to be as close to a real-world situation as possible. References: Birkholzer, J.T., Zhou, Q., Cortis, A. and Finsterle, S., 2011. A sensitivity study on regional pressure buildup from large-scale CO2 storage projects. Energy Procedia, 4, 4371-4378. Commer, M., and Newman, G.A., 2008. New advances in three-dimensional controlled-source electromagnetic inversion, Geophysical Journal International, 172, 513-535. Gasperikova, E., Appriou, D., Bonneville, A., Feng, Z., Huang, L., Gao, K., Yang, X., Daley, T., 2022, Sensitivity of geophysical techniques for monitoring secondary CO2 storage plumes, Int. J. Greenh. Gas Control, Volume 114, 103585, ISSN 1750-5836, https://doi.org/10.1016/j.ijggc.2022.103585. Moczo, P., J.O. Robertsson and L. Eisner, 2007, The finite-difference time-domain method for modeling of seismic wave propagation: Advances in geophysics, 48, 421-516. Rim, H., and Y. Li, 2015, Advantages of borehole vector gravity in density imaging, Geophysics, 80, G1-G13. Wainwright, H. M.; Finsterle, S.; Zhou, Q.; Birkholzer, J. T., 2013. Modeling the Performance of Large-Scale CO2 Storage Systems: A Comparison of Different Sensitivity Analysis Methods. International Journal of Greenhouse Gas Control, 17, 189205. https://doi.org/10.1016/j.ijggc.2013.05.007, DOI: 10.18141/1603331. Yang, X., Buscheck, T.A., Mansoor, K., Wang, Z., Gao, K., Huang, L., Appriou, D., and Carroll, S.A., 2019. Assessment of geophysical monitoring methods for detection of brine and CO2 leakage in drinking water aquifers, International Journal of Greenhouse Gas Control, 90, 102803, https://doi.org/10.1016/j.ijggc.2019.102803.

CCUS↗

DOE OSTI2020

Quantitative and Predictive Genetic Parts for Plant Synthetic Biology

Plant synthetic biology aims to harness the natural abilities of plants and to turn them to new purposes. A primary goal of plant synthetic biology is to produce predictable and programmable genetic circuits from simple regulatory elements and well-characterized genetic components. The number of available DNA parts for plants is increasing, and the methods for rapid quantitative characterization are being developed, but the field of plant synthetic biology is still in its early stages. We here describe methods used to describe the quantitative properties of genetic components needed for plant synthetic biology. Once the quantitative properties and transfer function of a variety of genetic parts are known, computers can select the optimal components to assemble into functional devices, such as toggle switches and positive feedback circuits. However, while the variety of circuits and traits that can be put into plants are limitless, doing synthetic biology in plants poses unique challenges. Plants are composed of differentiated cells and tissues, each representing potentially unique regulatory or developmental contexts to introduced synthetic genetic circuits. Further, plants have evolved to be highly sensitive to environmental influences, such as light or temperature, any of which can affect the quantitative function of individual parts or whole circuits. Measuring the function of plant components within the context of a plant cell and, ideally, in a living plant, will be essential to using these components in gene circuits with predictable function. Mathematical modeling will be needed to account for the variety of contexts a genetic part will experience in different plant tissues or environments. With such understanding in hand, it may be possible to redesign plant traits to serve human and environmental needs.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2023

Motility of Synthetic Cells from Engineered Lipids

Synthetic cells are artificial systems that resemble natural cells. Significant efforts have been made over the years to construct synthetic protocells that can mimic biological mechanisms and perform various complex processes. These include compartmentalization, metabolism, energy supply, communication, and gene reproduction. Cell motility is also of great importance, as nature uses elegant mechanisms for intracellular trafficking, immune response, and embryogenesis. In this review, we discuss the motility of synthetic cells made from lipid vesicles and relevant molecular mechanisms. Synthetic cell motion may be classified into surface-based or solution-based depending on whether it involves interactions with surfaces or movement in fluids. Collective migration behaviors have also been demonstrated. The swarm motion requires additional mechanisms for intercellular signaling and directional motility that enable communication and coordination among the synthetic vesicles. In addition, intracellular trafficking for molecular transport has been reconstituted in minimal cells with the help of DNA nanotechnology. These efforts demonstrate synthetic cells that can move, detect, respond, and interact. Finally, we envision that new developments in protocell motility will enhance our understanding of biological processes and be instrumental in bioengineering and therapeutic applications.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2020

Editorial: Proceedings of ICPSBBB 2018 - 2nd International Conference on Plant Synthetic Biology, Bioengineering and Biotechnology

Plant synthetic biology combines engineering principles with plant biology toward the design, construction, and testing of plants with new traits (Liu and Stewart, 2015). Synthetic biology applies engineering principles, using defined genetic parts with the aim of achieving predictable outcomes. The field aims at providing fuels, pharmaceuticals, bioactive metabolites and increased crop yield. Synthetic biology is increasingly forming a framework in genetic transformation of plants allowing us to improve traits and crop performance. The conference on Plant Synthetic Biology, Bioengineering, and Biotechnology covers broad aspects of plant synthetic biology, ranging from tools to the design of predictable functions and precision genome editing, to re-designed photosynthesis, plant bioengineering techniques, and rational design of novel plant traits. This Frontiers in Plant Science virtual issue on the “Research Topic Proceedings of ICPSBBB 2018 - 2nd International Conference on Plant Synthetic Biology, Bioengineering and Biotechnology” consists of 8 publications, including four reviews and four original research articles, which fall into the following general topics: quantitative and genetic parts, evolution, expression of transgenes and epigenetic changes, engineering of stress tolerance and bioproduction.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2024

Finite-Temperature Quantum Matter with Rydberg or Molecule Synthetic Dimensions

Synthetic-dimension platforms offer unique pathways for engineering quantum matter. We compute the phase diagram of a many-body system of ultracold atoms (or polar molecules) with a set of Rydberg states (or rotational states) as a synthetic dimension, where the particles are arranged in real space in optical microtrap arrays and interact via dipole-dipole exchange interaction. Using mean-field theory, we find three ordered phases—two are localized in the synthetic dimension, predicted as zero-temperature ground states, and one is a delocalized phase. We characterize them by identifying the spontaneously broken discrete symmetries of the Hamiltonian. We also compute the phase diagram as a function of temperature and interaction strength for both signs of the interaction. For system sizes with more than six synthetic sites and attractive interactions, we find that the thermal phase transitions can be first or second order, which leads to a tricritical point on the phase boundary. Furthermore, by examining the dependence of the tricritical point and other special points of the phase boundary on the synthetic dimension size, we shed light on the physics for thermodynamically large synthetic dimension.

74 ATOMIC AND MOLECULAR PHYSICS↗

DOE OSTI2026

Generalizing synthetic data-trained acoustic predictive models to real-world measurements

Acoustic Resonance Spectroscopy (ARS) is highly sensitive to structural properties such as material, geometry, and environmental conditions; as a consequence, it can noninvasively measure internal properties that are unobservable by most other methods. Because of its sensing capabilities and low implementation cost and complexity, ARS has potential as a paradigm shift in noninvasive sensing, characterization, and monitoring applications. However, extracting specific properties from ARS measurements, comprising the vibration spectrum of a test object, is challenging due to the sensitivity of the spectra to other structural changes not being measured, e.g. manufacturing tolerances, component coupling, environmental variation, etc. Neural Networks are promising tools for identifying trends in ARS measurements, but their training typically requires large datasets, which are often impractical to obtain for real-world systems. Synthetic data can be simulated efficiently, but discrepancies between synthetic and real-world data frequently lead to poor generalization when testing on the real-world data. We propose a novel ARS model training framework that enables networks trained exclusively on synthetic ARS data to generalize effectively to real-world measurements. Our approach leverages the Correlation Alignment (CORAL) technique to enforce the extraction of features common to both synthetic and real-world domains. As a case study, we demonstrate noninvasive ARS-based pressure measurements in sealed systems. Finite element method (FEM) simulations were used to generate synthetic training data across diverse vessel configurations and pressure conditions, and model performance was then tested on real-world measurements. We demonstrate that robust machine learning models for ARS can be developed without large real-world datasets, significantly broadening the applicability of ARS for noninvasive sensing. Moreover, the approach is extensible to other sensing modalities where synthetic data are abundant but real-world data are limited.

36 MATERIALS SCIENCE↗

DOE OSTI2021

Synthetic High Impedance Fault Data through Deep Convolutional Generated Adversarial Network

High impedance faults (HIFs) have always been significant challenge in the power grids. Researchers have developed some advanced protective methods to detect the HIFs. To test and validate these methods, large amounts of HIF data are required. This paper presents a synthetic HIF data generating method using the deep convolutional generated adversarial network (DCGAN). The DCGAN includes a generator module to create synthetic HIF waveform from random noises; and a discriminator module to identify the flaws of those synthetic data, which ultimately help improve the quality of the synthetic data created by the generator. To test the fidelity of the generated synthetic HIF data, two different HIF-detection methods have been applied. Extensive simulation results have validated the effectiveness of using the DCGAN to create synthetic HIF data.

Yang, Kun↗

DOE OSTI2022

Performance of abiotic stress-inducible synthetic promoters in genetically engineered hybrid poplar (Populus tremula × Populus alba)

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six s ynthetic d rought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis -regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2024

Path-Integrated X-Ray Digital Image Correlation using Synthetic Reference Images

X-rays can provide images when an object is visibly obstructed, allowing for motion measurements via x-ray digital image correlation (DIC). However, x-ray images are path-integrated and contain data for all objects between the source and detector. If multiple objects are present in the x-ray path, conventional DIC algorithms may fail to correlate the x-ray images. A new DIC algorithm called path-integrated (PI)-DIC addresses this issue by reformulating the matching criterion for DIC to account for multiple, independently-moving objects. PI-DIC requires a set of reference x-ray images of each independent object. However, due to experimental constraints, such reference images might not be obtainable from the experiment. Here, this work focuses on the reliability of synthetically-generated reference images, in such cases. A simplified exemplar is used for demonstration purposes, consisting of two aluminum plates with tantalum x-ray DIC patterns undergoing independent rigid translations. Synthetic reference images based on the “as-designed” DIC patterns were generated. However, PI-DIC with the synthetic images suffered some biases due to manufacturing defects of the patterns. A systematic study of seven identified defect types found that an incorrect feature diameter was the most influential defect. Synthetic images were re-generated with the corrected feature diameter, and PI-DIC errors were improved by a factor of 3-4. Final biases ranged from 0.00-0.04 px, and standard uncertainties ranged from 0.06-0.11 px. In conclusion, PI-DIC accurately measured the independent displacement of two plates from a single series of path-integrated x-ray images using synthetically-generated reference images, and the methods and conclusions derived here can be extended to more generalized cases involving stereo PI-DIC for arbitrary specimen geometry and motion. This work thus extends the application space of x-ray imaging for full-field DIC measurements of multiple surfaces or objects in extreme environments where optical DIC is not possible.

46 INSTRUMENTATION RELATED TO NUCLEAR SCIENCE AND ↗

DOE OSTI2020

Generation and evaluation of synthetic patient data

Background: Machine learning (ML) has made a significant impact in medicine and cancer research; however, its impact in these areas has been undeniably slower and more limited than in other application domains. A major reason for this has been the lack of availability of patient data to the broader ML research community, in large part due to patient privacy protection concerns. High-quality, realistic, synthetic datasets can be leveraged to accelerate methodological developments in medicine. By and large, medical data is high dimensional and often categorical. These characteristics pose multiple modeling challenges. Methods: In this paper, we evaluate three classes of synthetic data generation approaches; probabilistic models, classification-based imputation models, and generative adversarial neural networks. Metrics for evaluating the quality of the generated synthetic datasets are presented and discussed. Results: While the results and discussions are broadly applicable to medical data, for demonstration purposes we generate synthetic datasets for cancer based on the publicly available cancer registry data from the Surveillance Epidemiology and End Results (SEER) program. Specifically, our cohort consists of breast, respiratory, and non-solid cancer cases diagnosed between 2010 and 2015, which includes over 360,000 individual cases. Conclusions: We discuss the trade-offs of the different methods and metrics, providing guidance on considerations for the generation and usage of medical synthetic data.

59 BASIC BIOLOGICAL SCIENCES↗