Search NASA⌕ Search

SEARCH · Search NASA

Results for “induced”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 361 records · Page 20
All sourcesNASA NTRSDOE OSTI
DOE OSTI2024

Medium-induced photon bremsstrahlung in neutrino-nucleus, antineutrino-nucleus, and electron-nucleus scattering from multiple QED interactions

Interactions of charged leptons with nuclei and the naive tree-level kinematics of these processes are affected by radiation of photons induced by the QED nuclear medium. We evaluate cross section modifications at leading orders of the number of correlated interactions inside the nucleus, known as the opacity expansion. We derive results for soft and collinear types of the bremsstrahlung at the first three orders in opacity and generalize them to higher orders. We present the leading in opacity energy spectra of soft and collinear photons and radiative energy loss inside the nucleus for experiments with lepton kinematics in the GeV energy range. At leading power of the Glauber soft-collinear effective field theory, the soft radiation is further resummed to all orders both in opacity and in the electromagnetic coupling constant. We find that the soft and collinear medium-induced radiation is vacuumlike, and additional corrections are power suppressed. Despite the negligible modification to the induced photon spectra, the nuclear medium-induced radiation sizably affects the broadening of charged leptons in the direction orthogonal to their propagation. Published by the American Physical Society 2024

72 PHYSICS OF ELEMENTARY PARTICLES AND FIELDS↗
DOE OSTI2025

Quasiclassical evaluation of gluon saturation induced helicity effects

At sub-eikonal order in the high-energy limit, helicity dependences are generally contained in the transverse components of the gluon field. In the gluon saturation regime, novel helicity effects arise from the nonlinear interaction between the eikonal-order longitudinal gluon field and the sub-eikonal-order transverse gluon field. We derive this saturation induced helicity-dependent field both by solving the classical Yang-Mills equations and through direct diagrammatic calculations. Our analysis shows that the saturation induced helicity effect is intrinsically a two-particle (or multiparticle) correlation effect, rather than a single-particle distribution effect. Furthermore, we evaluate this effect in the context of double-spin asymmetry for incoherent diffractive dijet production in longitudinally polarized electron-nucleus collisions, using a simplified helicity-extended McLerran-Venugopalan model. We find that the saturation induced helicity effect further suppresses the back-to-back peak in the dijet azimuthal angle correlation, with a magnitude comparable to that of the direct helicity effect. This gluon saturation induced helicity effect may offer a novel avenue to probe gluon saturation in polarized collisions. Published by the American Physical Society 2025

Li, Ming (ORCID:0000000195509691)↗
DOE OSTI2020

Vortex rings drive entrainment and cooling in flow induced by a spark discharge

Spark plasma discharges induce vortex rings and a hot gas kernel. We develop a model to describe the late stage of the spark-induced flow and the role of the vortex rings in the entrainment of cold ambient gas and the cooling of the hot gas kernel. The model is tested in a plasma-induced flow using density and velocity measurements obtained from simultaneous stereoscopic particle image velocimetry and background oriented schlieren. We show that the spatial distribution of the hot kernel follows the motion of the vortex rings, whose radial expansion increases with the electrical energy deposited during the spark discharge. Here, the vortex ring cooling model establishes that entrainment in the convective cooling regime is induced by the vortex rings and governs the cooling of the hot gas kernel, and the rate of cooling increases with the electrical energy deposited during the spark discharge.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2020

Exotic silicon phases synthesized through ultrashort laser-induced microexplosion: Characterization with Raman microspectroscopy

Exotic metastable phases of silicon formed under high pressure are expected to have attractive semiconducting properties including narrow band gaps that open up novel technological applications. Confined microexplosions induced by powerful ultrashort laser pulses have been demonstrated as an advanced tool for the creation of new high-pressure phases that cannot be synthesized by other means. Tightly focused laser pulses are used to generate localized modifications inside the material structure, providing the possibility for precise controlled band-gap engineering. In this study, noninvasive Raman spectroscopy was used for analysis of laser-modified zones in silicon and to determine the metastable high-pressure phases contained. Low laser energies induced the formation of amorphous-only silicon, while higher energies led to crystalline silicon polymorphs within the modifications, albeit under considerable residual stress up to 4.5 GPa. The presence of the structurally similar r8-Si, bc8-Si, and bt8-Si phases is revealed, as well as other yet to be identified phases, and the stacking-related 9R Si polytype is evidenced, presumably stress-induced by the highly compressed laser-modified zone. The ab initio random structure searching approach is used to calculate the Raman signatures and to help identify different Si polymorphs. The findings of this study by Raman spectroscopy from ultrashort laser-induced microexplosion sites may yield insights into the local structure and properties of new silicon metastable phases and the prospect of utilizing exotic phases for extending current applications.

36 MATERIALS SCIENCE↗
DOE OSTI2024

Light-Induced Melting of Competing Stripe Orders without Introducing Superconductivity in La 2 − x Ba x CuO 4

The ultrafast manipulation of quantum material has led to many novel and significant discoveries. Among them, the light-induced transient superconductivity in cuprates achieved by melting competing stripe orders represents a highly appealing accomplishment. However, recent investigations have shown that the notion of photoinduced superconductivity remains a topic of controversy, and its elucidation solely through c -axis time-resolved terahertz spectroscopy remains an arduous task. Here, we measure the in-plane and out-of-plane transient terahertz responses simultaneously in the stripe-ordered nonsuperconducting La 2 − x Ba x CuO 4 after near-infrared excitations. We find that although a pump-induced reflectivity edge appears in the c -axis reflectance spectrum, the reflectivity along the CuO 2 planes decreases simultaneously, indicating an enhancement in the scattering rate of quasiparticles. This in-plane transient response is clearly distinct from the features associated with superconducting condensation. Therefore, we conclude the out-of-plane transient responses cannot be explained by an equivalent of Josephson tunneling. Notably, those pump-induced terahertz responses remain consistent even when we vary the near-infrared optical pump wavelengths and hole concentrations. Our results provide critical evidence that transient three-dimensional superconductivity cannot be induced by melting the competing stripe orders with pump pulses whose photon energy is much higher than the superconducting gap of cuprates. Published by the American Physical Society 2024

36 MATERIALS SCIENCE↗
DOE OSTI2025

Allopregnanolone as an Adjunct Therapy to Midazolam is More Effective Than Midazolam Alone in Suppressing Soman‐Induced Status Epilepticus in Male Rats

ABSTRACT Aims Humans and animals acutely intoxicated with the organophosphate soman can develop sustained status epilepticus (SE) that rapidly becomes refractory to benzodiazepines. We compared the antiseizure efficacy of midazolam, a current standard of care treatment for OP‐induced SE, versus combined therapy with midazolam and allopregnanolone (ALLO) in a rat model of soman‐induced SE. Methods Soman‐intoxicated male rats with robust seizure behavior and high‐amplitude electroencephalographic (EEG) activity were administered midazolam (0.65 mg, i.m.) 20 min after seizure initiation and 10 min later either a second dose of midazolam or ALLO (12 or 24 mg/kg, i.m.). Seizure behavior and EEG were monitored for 4 h after treatment. Brains were collected at the end of the monitoring period for histological analyses. Results Animals receiving 2 doses of midazolam exhibited persistent SE. Sequential dosing with midazolam followed by ALLO suppressed electrographic seizure activity. The combination therapy also significantly reduced soman‐induced neurodegeneration and neuroinflammation compared to 2 doses of midazolam. High but not low dose ALLO was associated with transitory and reversible respiratory compromise during the 1 h period after dosing. Conclusions Treatment with midazolam followed by ALLO was more effective than 2 doses of midazolam in suppressing benzodiazepine‐refractory, soman‐induced SE, and in mitigating its acute neuropathological consequences.

Andrew, Peter M. [Department of Molecular Bioscien↗
DOE OSTI2026

Flash electropolishing for TEM: Reducing FIB‐induced defects in tungsten with protocols for new materials

Focused ion beam (FIB) milling has become the dominant approach for site-specific transmission electron microscopy (TEM) specimen preparation; however, FIB damage remains a critical limitation for reliable microstructural characterisation, particularly in radiation effects studies. Tungsten is especially susceptible to FIB damage due to its high nuclear stopping power, which promotes the formation and strong diffraction contrast of FIB-induced ‘black spot’ defects that are indistinguishable from very fine irradiation-induced loops/defects resulting from low to intermediate temperature neutron irradiation. In this work, flash electropolishing is systematically evaluated as a post-FIB treatment for minimising preparation-induced artefacts for TEM analysis of tungsten-based alloys. Using a range of non-, ion-, and neutron-irradiated tungsten materials, the effectiveness of flash electropolishing has been assessed through direct comparison with conventional FIB and plasma-FIB preparation including low-energy Ga, Ar, Xe ion cleaning. The results demonstrate that flash electropolishing effectively removes FIB-damaged layers and ‘black spot’ defects, thereby enabling reliable observation of irradiation-induced dislocation structures. Key processing parameters governing flash electropolishing quality – including lamella thickness, applied voltage, polishing duration, electrolyte chemistry, and cathode geometry – have been systematically evaluated, and clear criteria were established for determining when flash electropolishing is required to ensure reliable microstructural analysis. This work also provides practical guidance for implementing flash electropolishing as an artefact-controlled specimen-preparation approach for TEM characterisation of FIB-produced specimens. The systematic protocol can be extended to other, non-tungsten materials.

TEM sample preparation↗
DOE OSTI2022

The influence of increasing atmospheric CO 2 , temperature, and vapor pressure deficit on seawater-induced tree mortality

We report increasing seawater exposure is killing coastal trees globally, with expectations of accelerating mortality with rising sea levels. However, the impact of concomitant changes in atmospheric CO 2 concentration, temperature, and vapor pressure deficit (VPD) on seawater-induced tree mortality is uncertain. We examined the mechanisms of seawater-induced mortality under varying climate scenarios using a photosynthetic gain and hydraulic cost optimization model validated against observations in a mature stand of Sitka-spruce (Picea sitchensis) trees in the Pacific Northwest, USA, that were dying from recent seawater exposure. The simulations matched well with observations of photosynthesis, transpiration, nonstructural carbohydrates concentrations, leaf water potential, the percentage loss of xylem conductivity, and stand-level mortality rates. The simulations suggest that seawater-induced mortality could decrease by ~16.7% with increasing atmospheric CO 2 levels due to reduced risk of carbon starvation. Conversely, rising VPD could increase mortality by ~5.6% because of increasing risk of hydraulic failure. Across all scenarios, seawater-induced mortality was driven by hydraulic failure in the first two years after seawater exposure began, with carbon starvation becoming more important in subsequent years. Changing CO 2 and climate appear unlikely to have a significant impact on coastal tree mortality under rising sea levels.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Strain-switchable field-induced superconductivity

Field-induced superconductivity is a rare phenomenon where an applied magnetic field enhances or induces superconductivity. Here, we use applied stress as a control switch between a field-tunable superconducting state and a robust non–field-tunable state. This marks the first demonstration of a strain-tunable superconducting spin valve with infinite magnetoresistance. We combine tunable uniaxial stress and applied magnetic field on the ferromagnetic superconductor Eu(Fe 0.88 Co 0.12 ) 2 As 2 to shift the field-induced zero-resistance temperature between 4 K and a record-high value of 10 K. We use x-ray diffraction and spectroscopy measurements under stress and field to reveal that strain tuning of the nematic order and field tuning of the ferromagnetism act as independent control parameters of the superconductivity. Combining comprehensive measurements with DFT calculations, we propose that field-induced superconductivity arises from a novel mechanism, namely, the uniquely dominant effect of the Eu dipolar field when the exchange field splitting is nearly zero.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2024

MIP-4 is Induced by Bleomycin and Stimulates Cell Migration Partially via Nir-1 Receptor

Background. CC-chemokine ligand 18 also known as MIP-4 is a chemokine with roles in inflammation and immune responses. It has been shown that MIP-4 is involved in the development of several diseases including lung fibrosis and cancer. How exactly MIP-4 is regulated and exerts its role in lung fibrosis remains unclear. Therefore, in the present study, we examined how MIP-4 is regulated and whether it acts via its potential receptor Nir-1. Materials and Methods. A549 cells were grown and maintained in DMEM : F12 (1 : 1) and supplemented with 10% FBS and 1000 U of penicillin/streptomycin and maintained as recommended by the manufacturer (ATCC). Cell migration and invasion, immunohistochemistry (IHC), Western blot, qPCR, and siRNA Nir-1 were used to determine MIP-4 regulation and its role in cell migration. Results. Cell migration was increased following stimulation of cells with recombinant (r) MIP-4 and bleomycin (BLM), whereas quenching rMIP-4 with its antibody (Ab) or addition of the Ab to BLM or H 2 O 2 diminished rMIP-4-induced cell migration. Along with cell migration, rMIP-4, BLM, and H 2 O 2 induced the formation of actin filaments dynamic structures whereas costimulation with MIP-4 Ab limited BLM- and H 2 O 2 -induced effects. MIP-4 mRNA and protein were increased by BLM and H 2 O 2 , and the addition of its Ab significantly reduced treatments effect. Experiments with siRNA investigating whether Nir-1 is a potential MIR-4 receptor indicated that the inhibition of Nir-1 decreased cell migration/invasion but did not totally inhibit rMIP-4-induced cell migration. Conclusion. Therefore, our data indicate that MIP-4 is regulated by BLM and H 2 O 2 and costimulation with its Ab limits the effects on MIP-4 and that the Nir-1 receptor partially mediates MIP-4’s effects on increased cell migration. These data also evidenced that MIP-4 is regulated by fibrotic and oxidative stimuli and that quenching MIP-4 with its Ab or therapeutically targeting the Nir-1 receptor may partially limit MIP-4 effects under fibrotic or oxidative stimulation.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2023

Stronger Tropical Cyclone–Induced Ocean Cooling in Near-Coastal Regions Compared to the Open Ocean

Abstract Tropical cyclones (TC) often induce strong mixing in the upper ocean that generates a trail of cooler sea surface temperature (Twake) in their wakes. The Twake can affect TC intensity, so its prediction is important, especially in coastal regions where TCs can make landfall. Coastal Twakes are often more complex than those in the open ocean due to the influences of coastline geometry, highly variable water depth, continental runoff, and shelf processes. Using observational data since 2002, here we show a significantly stronger global mean Twake in coastal regions compared to offshore regions. Temperature stratification is the main driver of stronger coastal Twakes in the North Atlantic and east Pacific. In the northwest Pacific and north Indian Ocean, the differences between coastal and offshore Twakes are smaller due to compensation between TC forcings and ocean stratification. The north Indian Ocean is unique in the Northern Hemisphere because salinity stratification plays a major role on the spatial distribution of Twake. In the South Pacific Ocean, TC intensity and translation speed are crucial for explaining coastal–offshore Twake differences, while ocean stratification and mixed layer depth are more important for the coastal–offshore Twake differences in the south Indian Ocean. These findings suggest that coastal–offshore differences in ocean stratification need to be properly represented in models in order to capture changes in TC-induced ocean cooling as storms approach landfall. Significance Statement Landfalling tropical cyclones (TCs) often cause considerable damage in coastal regions with dense human populations. Understanding TC–ocean interaction and how it differs between coastal and offshore regions can help predict TC intensity prior to landfall. Sea surface cooling after TC passage is an important proxy for TC–ocean interaction. A global evaluation of coastal TC-induced cooling has not been conducted. Using data covering two decades, we show significantly stronger TC-induced surface cooling in coastal regions compared to offshore regions at the global scale and in all basins except the northwest Pacific and north Indian Ocean. The difference is driven mainly by upper-ocean conditions in the North Atlantic, east Pacific, and south Indian Ocean, and by TC characteristics in the South Pacific.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2024

Effects of fire and fire-induced changes in soil properties on post-burn soil respiration

Boreal forests cover vast areas of land in the northern hemisphere and store large amounts of carbon (C) both aboveground and belowground. Wildfires, which are a primary ecosystem disturbance of boreal forests, affect soil C via combustion and transformation of organic matter during the fire itself and via changes in plant growth and microbial activity post-fire. Wildfire regimes in many areas of the boreal forests of North America are shifting towards more frequent and severe fires driven by changing climate. As wildfire regimes shift and the effects of fire on belowground microbial community composition are becoming clearer, there is a need to link fire-induced changes in soil properties to changes in microbial functions, such as respiration, in order to better predict the impact of future fires on C cycling. We used laboratory burns to simulate boreal crown fires on both organic-rich and sandy soil cores collected from Wood Buffalo National Park, Alberta, Canada, to measure the effects of burning on soil properties including pH, total C, and total nitrogen (N). We used 70-day soil incubations and two-pool exponential decay models to characterize the impacts of burning and its resulting changes in soil properties on soil respiration. Laboratory burns successfully captured a range of soil temperatures that were realistic for natural wildfire events. We found that burning increased pH and caused small decreases in C:N in organic soil. Overall, respiration per gram total (post-burn) C in burned soil cores was 16% lower than in corresponding unburned control cores, indicating that soil C lost during a burn may be partially offset by burn-induced decreases in respiration rates. Simultaneously, burning altered how remaining C cycled, causing an increase in the proportion of C represented in the modeled slow-cycling vs. fast-cycling C pool as well as an increase in fast-cycling C decomposition rates. Together, our findings imply that C storage in boreal forests following wildfires will be driven by the combination of C losses during the fire itself as well as fire-induced changes to the soil C pool that modulate post-fire respiration rates. Moving forward, we will pair these results with soil microbial community data to understand how fire-induced changes in microbial community composition may influence respiration.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2020

The role of irradiation on deformation-induced martensitic phase transformations in face-centered cubic alloys

Localized deformation, including that by the deformation-induced shearing martensitic phase transformation, is responsible for hardening and embrittlement in irradiated face-centered cubic alloys. These localized deformation processes can have profound consequences on the mechanical integrity of common structural metals used in extreme radiation environments such as nuclear reactors. This article aims to review and understand exactly how irradiation affects the martensitic phase transformation in face-centered cubic alloys, with an emphasis on austenitic stainless steel, given its ubiquity in the archival literature. The influence of irradiation on stacking fault energy and subsequent implications on the phase transformation are discussed. Mechanisms by which irradiation-induced microstructures enhance the phase transformation are also described, including the surface energy contribution of irradiation-induced cavities (i.e., voids and bubbles) toward the critical martensite nucleation energy, and partial dislocation–cavity interactions. In conclusion, a deformation mechanism map illustrates how irradiation-induced cavities can modulate the martensitic transformation pathway.

36 MATERIALS SCIENCE↗
DOE OSTI2023

Flow Induced Vibration Studies in Pressurized Helium Gas Cooling Channels

Production of metastable Technetium-99 (Tc-99m), a radioactive tracer that emits gamma rays, is vital to the medical imaging community. Tc-99m is extracted from the decay of Molybdenum-99 (Mo-99) which has a half-life of about 2-3 days. The work presented in this report is part of the NNSA’s mission to produce Mo-99 commercially, within the US, without the use of highly enriched uranium (HEU) in support of nonproliferation and global security. Los Alamos National Laboratory (LANL) is working with NorthStar Medical Radioisotopes (NMR) on their efforts to produce Mo-99 through the irradiation of Mo-100 targets using an electron beam. The NMR target comprises a stack of approximately 60-70 Mo-100 disks with diameter 24 mm and thickness 0.74 mm held in stainless steel laminations, each separated using 0.25 mm thick stainless steel spacers. The symmetric target stack is housed in an Inconel vessel with two Inconel windows on either side. Two electron accelerators are used to produce 40 MeV, 3.16 µA electron beams each that penetrate the Inconel windows and irradiate the Mo-100 disks. Approximately 90% of the total 250 kW beam power is deposited in the NMR target during the irradiation process. During irradiation, pressurized helium gas flows through 0.25 mm thin gaps between the disks cooling the beam window, target disks, disk laminations and spacers. Both NMR and LANL have found during cold testing of the target system (no heat deposition) that the Mo-100 disks undergo significant mass loss and disk breakage due to vibrations induced by the flowing helium gas. The mass loss is not only undesirable due to monetary loss from reduced final quantities of Mo-99, but also due to the hazards associated with radioactive material trapped in the cooling lines and particle filters. The effect of flow rate and target geometry on the flow induced vibrations need to be quantified, and recommendations provided to minimize this mass loss. This work describes LANL’s experimental characterization of the flow induced vibrations and disk mass loss in a reduced scale set-up containing 10 Mo-100 disks. We use high speed imaging, displacement measurements and microphone measurements combined with signal processing to estimate the vibration frequency of each disk. The effect of disk thickness, target fit and duration of testing on the mass loss is described. We find that in the current configuration of NMR targets, the vibrations and mass loss on the first disk are minimized, while those in the adjacent disks are highest. The microphone and high-speed image data show that increased flow rates and increased duration of testing increases vibration frequency and mass loss. The mass loss is due to both disk rotation and back and forth motion. There are visible wear marks on the disks with the highest mass loss. We also note that the current NMR window gap reduces flow induced vibrations compared to the previous smaller gaps. Longer duration testing will provide more data and verification for the findings presented in this report. The work will be continued in FY 24.

43 PARTICLE ACCELERATORS↗
DOE OSTI2021

Determination of Thermal Expansion, Defect Formation Energy, and Defect-Induced Strain of α-U Via ab Initio Molecular Dynamics

Uranium (U) is often alloyed with molybdenum (Mo) or zirconium (Zr) in order to stabilize its high-temperature body-centered cubic phase for use in nuclear reactors. However, in all metallic fuel forms, the α phase of U remains in some fraction. This phase decomposition due to temperature or compositional variance can play an outsized role on fuel performance and microstructural evolution. Relatively little is known about fundamental point defect properties in α -U at non-zero temperatures, from either computational or experimental studies. This work performs the first thorough evaluation of the α phase of U via ab initio molecular dynamics (AIMD). A number of thermophysical properties are calculated as a function of temperature, including equilibrium lattice parameters, thermal expansion, and heat capacity. These results indicate a two-region behavior, with the transition at 400 K. The thermal expansion/contraction in the a / b direction occurs rapidly from 100 up to 400 K, after which a more linear and gradual change in the lattice constant takes place. The volumetric expansion matches experiments quantitatively, but the individual lattice constant expansion only matches experiments qualitatively. Point defect formation energies and induced lattice strains are also determined as a function of temperature, providing insight on defect populations and the fundamentals of irradiation growth in α -U. Interstitials induce significantly more strain than vacancies, and the nature of that strain is highly dependent on the individual lattice directions. The direction of point defect-induced lattice strain is contrary to the irradiation growth behavior of α -U. This work shows that isolated point defects cannot be the primary driving force responsible for the significant irradiation-induced growth of α -U observed experimentally.

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗
DOE OSTI2023

Early life stress induces irritable bowel syndrome from childhood to adulthood in mice

Background Irritable bowel syndrome (IBS) is one of the most common functional gastrointestinal disorder. Traditionally, early life stress (ELS) is predisposed to IBS in adult. However, whether ELS induces IBS in early life remains unclear. Methods Separated cohort studies were conducted in neonatal male pups of C57BL/6 mice by maternal separation (MS) model. MS and non-separation mice were scheduled to be evaluated for prime IBS-phenotypes, including visceral hypersensitivity, intestinal motility, intestinal permeability, and anxiety-like behavior. Ileal contents and fecal samples were collected and analyzed by 16S rRNA gene sequencing and bacterial community analyses. Subcellular structures of intestinal epithelial, such as epithelial tight junctions and mitochondria, were observed under transmission electron microscopy. Results MS induced visceral hypersensitivity and decreased total intestinal transit time from childhood to adulthood. In addition, MS induced intestinal hyperpermeability and anxiety-like behavior from adolescence to adulthood. Besides, MS affected intestinal microbial composition from childhood to adulthood. Moreover, MS disrupted intestinal mitochondrial structure from childhood to adulthood. Conclusion The study showed for the first time that MS induced IBS from early life to adulthood in mice. The disrupted intestinal mitochondrial structure and the significant dysbiosis of intestinal microbiota in early life may contribute to the initiation and progress of IBS from early life to adulthood.

Tao, Enfu↗
DOE OSTI2024

Overexpression of the Mas1 gene mitigated LPS-induced inflammatory injury in mammary epithelial cells by inhibiting the NF-κB/MAPKs signaling pathways

Breast infection is the primary etiology of mastitis in dairy cows, leading to a reduction in the quality of dairy products and resulting in substantial economic losses for animal husbandry. Although antibiotic treatment can eliminate the pathogenic microorganisms that induce mastitis, it cannot repair the inflammatory damage of mammary epithelial cells and blood milk barrier. Mas1 is a G protein-coupled receptor, and its role in lipopolysaccharide (LPS) -induced inflammatory injury to mammary epithelial cells has not been studied. LPS treatment of EpH4 EV cells led to a significant downregulation of Mas1 transcript levels, which attracted our great interest, suggesting that Mas1 may be an important target for the treatment of mastitis. Therefore, this study intends to verify the role of Mas1 in the inflammatory injury of EpH4 EV cells by gene overexpression technology and gene silencing technology. The findings demonstrated that the overexpression of the Mas1 gene effectively reversed the activation of the nuclear factor-κB/mitogen-activated protein kinase (NF-κB/MAPK) signaling pathways induced by LPS, while also suppressing the upregulation of pro-inflammatory mediators. Furthermore, overexpression of the Mas1 gene reversed the downregulation of zonula occludens 1 (ZO-1), Occludin, and Claudin-3 caused by LPS, suggesting that Mas1 could promote to repair the blood-milk barrier. However, the silencing of the Mas1 gene using siRNA resulted in a contrasting effect. These results indicated that Mas1 alleviated the inflammatory injury of mammary epithelial cells induced by LPS.

Yan, Shuping↗