SEARCH · Search NASA

Results for “mock”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 397 records · Page 22

All sources NASA NTRS DOE OSTI

DOE OSTI2022

Constraints on the Maximum Densities of Neutron Stars from Postmerger Gravitational Waves with Third-Generation Observations

Using data from 289 numerical relativity simulations of binary neutron star mergers, we identify, for the first time, a robust quasiuniversal relation connecting the postmerger peak gravitational-wave frequency and the value of the density at the center of the maximum mass nonrotating neutron star. This relation offers a new possibility for precision equation-of-state constraints with next-generation ground-based gravitational-wave interferometers. Mock Einstein Telescope observations of fiducial events indicate that Bayesian inferences can constrain the maximum density to ~15% (90% credibility level) for a single signal at the minimum sensitivity threshold for a detection. If the postmerger signal is included in a full-spectrum (inspiral-merger-postmerger) analysis of such a signal, the pressure-density function can be tightly constrained up to the maximum density, and the maximum neutron star mass can be measured with an accuracy better than 12% (90% credibility level).

79 ASTRONOMY AND ASTROPHYSICS↗

DOE OSTI2025

Machine learning assisted unfolding for neutrino cross-section measurements with the OmniFold technique

The choice of unfolding method for a cross-section measurement is tightly coupled to the model dependence of the efficiency correction and the overall impact of cross-section modeling uncertainties in the analysis. A key issue is the dimensionality used in unfolding, as the kinematics of all outgoing particles in an event typically affect the reconstruction performance in a neutrino detector. OmniFold is an unfolding method that iteratively reweights a simulated dataset, using machine learning to utilize arbitrarily high-dimensional information, that has previously been applied to proton-proton and proton-electron datasets. This paper demonstrates OmniFold’s application to a neutrino cross-section measurement for the first time using a public T2K near detector simulated dataset, comparing its performance with traditional approaches using a mock data study.

Machine learning↗

DOE OSTI2025

Dark energy survey: Modeling strategy for multiprobe cluster cosmology and validation for the full six-year dataset

Here, we introduce an updated To&Krause2021 model for joint analyses of cluster abundances and large-scale two-point correlations of weak lensing and galaxy and cluster clustering (termed CL+3×2 pt analysis) and validate that this model meets the systematic accuracy requirements of analyses with the statistical precision of the final Dark Energy Survey (DES) Year 6 (Y6) dataset. The validation program consists of two distinct approaches, (i) identification of modeling and parametrization choices and impact studies using simulated analyses with each possible model misspecification and (ii) end-to-end validation using mock catalogs from customized Cardinal simulations that incorporate realistic galaxy populations and DES-Y6-specific galaxy and cluster selection and photometric redshift modeling, which are the key observational systematics. In combination, these validation tests indicate that the model presented here meets the accuracy requirements of DES-Y6 for CL+3×2 pt based on a large list of tests for known systematics. In addition, we also validate that the model is sufficient for several other data combinations: the CL+GC subset of this data vector (excluding galaxy–galaxy lensing and cosmic shear two-point statistics) and the CL+3×2 pt+BAO+SN (combination of CL+3×2 pt with the previously published Y6 DES baryonic acoustic oscillation and Y5 supernovae data).

79 ASTRONOMY AND ASTROPHYSICS↗

DOE OSTI2025

Lanczos algorithm for lattice QCD matrix elements

Recent work [M. L. Wagman, Lanczos, the transfer matrix, and the signal-to-noise problem, .] found that an analysis formalism based on the Lanczos algorithm allows energy levels to be extracted from Euclidean correlation functions with faster ground-state convergence than effective masses, convergent estimators for multiple states from a single correlator, and two-sided error bounds. After filtering out spurious eigenvalues and using outlier-robust estimators within a nested bootstrap framework, Lanczos estimators behave more like multistate fit results than effective masses—but without involving statistical fitting. We extend this formalism to the determination of matrix elements from three-point correlation functions and provide a physical picture of “spurious-state filtering” involving restriction to a Hermitian subspace. We demonstrate similar advantages for matrix elements as for spectroscopy through example applications to noiseless mock-data and (bare) forward matrix elements of the strange scalar current between both ground and excited states with the quantum numbers of the nucleon.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗

DOE OSTI2024

Space Nuclear Power Autonomous Control Algorithm and Control Element Test Bed

Nuclear thermal rockets are currently NASA’s preferred option for use in a manned mission to Mars in the 2040s. The communication delay between an Earth ground station and a spacecraft heading toward Mars can be up to 20 min. Therefore, controlling the nuclear rocket engine would require either a full-time reactor operator on the mission or an autonomous control system for the reactor. The latter idea of making space nuclear reactors fully autonomous has drawn more interest from stakeholders, but such an autonomous control system must be rigorously tested and validated before it is certified for human use. The cost of a full ground test for a space nuclear reactor is tremendous, so a nonnuclear mock reactor test bed was created to test and validate control elements and control algorithms for space nuclear reactors. The test bed consists of control element hardware that inputs physical measurement data into a reactor emulator to produce the reactor’s performance under steady-state, transient, and fault conditions. The control element hardware consists of six full-sized control drums equipped with servo drives and motors and is instrumented with optical encoders, resolvers, and torque sensors for drum movement characterization. In addition to the drums, a two-phase flow loop was designed and built to mimic the valves and turbomachinery associated with the propellant flow through a nuclear thermal rocket engine; components such as pressure sensors, flow meters, thermocouples, and tachometers are instrumented throughout the loop to characterize the fluid flow, valve, and turbomachinery behavior of the system. The data from the physical hardware (e.g., drum position, propellant flow rates) are input to a nuclear reactor simulator to determine the actual nuclear reactor parameters, and the data are sent back to a control algorithm to complete the control loop. The ability to conduct numerous tests of the control systems and autonomous algorithms can help validate the instrumentation and control aspects for a space nuclear reactor for every possible fault situation.

Wilson, Brandon↗

DOE OSTI2020

High-Field Ignition-Capable Stellarator i-ASTER: Initial Structural Evaluation

i-ASTER is a preliminary conceptual design of a high-field pulsed experimental stellarator aimed essentially at achieving and understanding plasma ignition. The averaged magnetic field on the axis of i-ASTER.v1 is B ~ 10 T and the plasma volume is 30 m 3 . A toroidal monolithic support structure, which is located externally to the modular coils, is defined to accurately arrange the coils and withstand the magnetic Lorentz forces from the high magnetic fields. The magnetic field in the coils and the resulting Lorentz forces on the coils were calculated and utilized for the stress calculation in monolithic support of constant thickness. Subsequently, a monolithic support of variable thickness is proposed and studied. The thickness of the structure is variable and adjusted to the magnitude of the mechanical stress in each area of the toroidal structure so as to smooth the stresses while minimizing the quantity of material used. A fabrication method for the monolithic structure has been tested. For that, a scaled-down mock-up of one period of stellarator has been additively manufactured and strengthened with fiber-reinforced resin. Unsurmountable difficulties have not been found for this fabrication method.

Queral, Vicente↗

DOE OSTI2021

Escaping the fate of Sisyphus: assessing resistome hybridization baits for antimicrobial resistance gene capture

Finding, characterizing and monitoring reservoirs for antimicrobial resistance (AMR) is vital to protecting public health. Hybridization capture baits are an accurate, sensitive and cost-effective technique used to enrich and characterize DNA sequences of interest, including antimicrobial resistance genes (ARGs), in complex environmental samples. We demonstrate the continued utility of a set of 19 933 hybridization capture baits designed from the Comprehensive Antibiotic Resistance Database (CARD)v1.1.2 and Pathogenicity Island Database (PAIDB)v2.0, targeting 3565 unique nucleotide sequences that confer resistance. We demonstrate the efficiency of our bait set on a custom-made resistance mock community and complex environmental samples to increase the proportion of on-target reads as much as >200-fold. However, keeping pace with newly discovered ARGs poses a challenge when studying AMR, because novel ARGs are continually being identified and would not be included in bait sets designed prior to discovery. Here we provide imperative information on how our bait set performs against CARDv3.3.1, as well as a generalizable approach for deciding when and how to update hybridization capture bait sets. This research encapsulates the full life cycle of baits for hybridization capture of the resistome from design and validation (both in silico and in vitro) to utilization and forecasting updates and retirement.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2024

THERMAL MODELING OF HANFORD CESIUM AND STRONTIUM CANISTERS DURING SIMULATED LOADING

A computational fluid dynamics (CFD) model was built to simulate planned testing of heater assemblies within a canister and overpack for the Hanford Lead Canister (HLC) project. The HLC is a canister storage system that will contain heaters to simulate the decay heat of nuclear material and provide the canister storage system with environmental conditions equivalent to the operating conditions on a dry storage pad. The HLC will be equipped with long-term data collection and monitoring systems to provide an early warning of corrosion, pitting, cracking, or other signs of canister degradation that might threaten the integrity of the containment boundary over the potentially long term of dry storage. An important part of the HLC development is to make pretest numerical predictions for the behavior of the heated canister during the simulated radiolytic decay heat testing, which simulates the dry storage system during loading operations. The simulated radiolytic decay heat test is planned for mid-2024 in a configuration that includes the heater assembly, overpack, and canister, but with the lids removed to allow loading cesium and strontium capsules into the canister. One of the goals of the test is to evaluate the thermal behavior of the canister and overpack assembly in the ambient air of the test facility, which will provide data critical to validating the thermal models and understanding how the HLC will perform as a system once deployed. To best approximate real-world conditions, the CFD model includes the full air volume of the mock-up truck bay the heated canister test will be performed in, enabling detailed investigation of how the heated canister affects airflow around it. Rigorous pre-deployment testing of the complete HLC cask and canister system is intended to be completed before the HLC is deployed in the 2028 timeframe. This study presents the pre-test temperature predictions of the simulated radiolytic decay heat test. A description of the heater assembly, canister, and overpack system is presented. The model was developed with the commercial CFD software STAR-CCM+. An uncertainty analysis was run with the CFD model to determine the uncertainty in the temperature predictions and provide a range over which the predicted temperatures are expected to vary. The uncertainty analysis was preformed by coupling STAR-CCM+ with the software Dakota, which provides advanced parametric analyses, including quantification of margins and uncertainty with computational models. This work is expected to provide insight into SNF canister behavior.

Carpenter-Graffy, Dina E.↗

DOE OSTI2025

Improved field assessments of chemicals and explosives using high-resolution gamma-ray spectroscopy with a tagged neutron interrogation system

A field-portable tagged neutron interrogation system is being developed for detection of explosives and chemical warfare agents by prompt γ-ray neutron activation analysis. The system combines an associated particle imaging deuterium-tritium neutron generator with a high-purity germanium γ-ray detector. Fine spatial resolution neutron and α detectors enable precise mapping of characteristic γ-ray emission distributions onto high-clarity neutron radiographic images. A narrow coincidence gate associated with each tagged neutron ensures a large signal-to-background ratio, thus significantly improving sensitivity to the chemical compositions of the items being assessed. Recent experimental results recorded from test objects involving mock explosives and other chemicals are presented.

Bucher, Brian [Idaho National Laboratory (INL)]↗

DOE OSTI2025

RB-TnSeq elucidates dicarboxylic-acid-specific catabolism in β-proteobacteria for improved plastic monomer upcycling

Dicarboxylic acids are key components of many polymers and plastics, making them a target for both engineered microbial degradation and sustainable bioproduction. In this study, we generated a comprehensive data set of functional evidence for the genetic basis of dicarboxylic and fatty acid metabolism using randomly barcoded transposon sequencing (RB-TnSeq). We identified four β-proteobacteria that displayed robust growth with dicarboxylic acid sole carbon source and cultured their mutant libraries with dicarboxylic and fatty acids with carbon chain lengths from C3 to C12. The resulting fitness data suggested that dicarboxylic and fatty acid metabolisms are largely distinct, and different sets of β-oxidation genes are required for catabolizing dicarboxylic versus fatty acids of the same carbon chain lengths. In addition, we identified transcriptional regulators and transporters with strong fitness phenotypes related to dicarboxylic acid utilization. In Ralstonia sp. UNC404CL21Col (R. CL21), we deleted two transcriptional repressors to improve its utilization of short-chain dicarboxylic acids. We exploited the diacid-utilizing catabolism of R. CL21 to upcycle a mock mixture of the dicarboxylic acids produced when polyethylene is oxidized. After introducing a heterologous indigoidine production pathway, this engineered Ralstonia produced 0.56 ± 0.02 g/L indigoidine from a mixture of dicarboxylic acids as a carbon source, demonstrating the potential of R. CL21 to upcycle plastic wastes to products derived from tricarboxylic acid (TCA) cycle intermediates. IMPORTANCE: Upcycling the carbon in plastic wastes to value-added products is a promising approach to address the plastic waste and climate crises, and dicarboxylic acid metabolism is an important facet of several approaches. Improving our understanding of the genetic basis of this metabolism has the potential to uncover new enzymes and genetic parts for engineered pathways involving dicarboxylic acids. Our data set is the most comprehensive interrogation of dicarboxylic acid catabolism to date, and this work will be of utility to researchers interested in both plastics bioproduction and upcycling applications.

Pearson, Allison N↗

DOE OSTI2025

Modeling of hepatitis B virus infection spread in primary human hepatocytes

ABSTRACT Chronic hepatitis B virus (HBV) infection poses a significant global health threat, causing severe liver diseases including cirrhosis and hepatocellular carcinoma. We characterized HBV DNA kinetics in primary human hepatocytes (PHHs) over 32 days post-inoculation (p.i.) and modified ourin-vivoagent-based modeling (ABM) to gain insights into the HBV lifecycle and spreadin vitro. Parallel PHH cultures were mock-treated or treated with HBV entry inhibitor Myr-preS1 (6.25 µg/mL) was initiated 24 h p.i. In untreated PHH, three viral DNA kinetic patterns were identified: (i) an initial decline, followed by (ii) rapid amplification and (iii) slower amplification/accumulation. In the presence of Myr-preS1, viral DNA and infected cell numbers in phase 3 were effectively blocked, with minimal to no increase. This suggests that phase 2 represents viral amplification in initially infected cells, while phase 3 corresponds to viral spread to naïve cells. The ABM reproduced well the HBV kinetic patterns observed and predicted that the viral eclipse phase lasts between 18 and 38 h. After the eclipse phase, the viral production rate increased over time, starting with a slow production cycle of 1 virion per day, which gradually accelerated to 1 virion per hour after 3 days. Approximately 4 days later, virion production reached a steady state production rate of 4 virions/h. The estimated median efficacy of Myr-preS1 in blocking HBV spread was 91% (range: 90–92%). The HBV kinetics and the predicted estimates of the HBV eclipse phase duration and HBV production cycles in PHH are similar to those predicted in uPA/SCID mice with human livers. IMPORTANCE While primary human hepatocytes (PHHs) are the most physiologically relevant culture system for studying HBV infectionin vitro, a comprehensive understanding of HBV infection kinetics and spread in PHH is lacking. In this study, we characterize HBV viral kinetics and modify ourin vivoagent-based modeling (ABM) to provide quantitative insights into the HBV production cycle and viral spread in PHH. The ABM provides an estimate of the HBV eclipse phase duration, HBV production cycles, and Myr-preS1 efficacy in blocking HBV spread in PHH. The results resemble those predicted in uPA/SCID mice with human livers, demonstrating that estimated HBV infection kinetic parameters in PHHin vitromirror those observed in thein vivoHBV infection chimeric mouse model.

Virology↗

DOE OSTI2023

Inferring microbial co-occurrence networks from amplicon data: a systematic evaluation

Microbes commonly organize into communities consisting of hundreds of species involved in complex interactions with each other. 16S ribosomal RNA (16S rRNA) amplicon profiling provides snapshots that reveal the phylogenies and abundance profiles of these microbial communities. These snapshots, when collected from multiple samples, can reveal the co-occurrence of microbes, providing a glimpse into the network of associations in these communities. However, the inference of networks from 16S data involves numerous steps, each requiring specific tools and parameter choices. Moreover, the extent to which these steps affect the final network is still unclear. In this study, we perform a meticulous analysis of each step of a pipeline that can convert 16S sequencing data into a network of microbial associations. Through this process, we map how different choices of algorithms and parameters affect the co-occurrence network and identify the steps that contribute substantially to the variance. We further determine the tools and parameters that generate robust co-occurrence networks and develop consensus network algorithms based on benchmarks with mock and synthetic data sets. The Microbial Co-occurrence Network Explorer, or MiCoNE (available at https://github.com/segrelab/MiCoNE) follows these default tools and parameters and can help explore the outcome of these combinations of choices on the inferred networks. We envisage that this pipeline could be used for integrating multiple data sets and generating comparative analyses and consensus networks that can guide our understanding of microbial community assembly in different biomes.

16S rRNA↗

DOE OSTI2026

Unraveling TeV halos with the Cherenkov Telescope Array

Pulsars are observed to emit bright and spatially extended gamma-ray emission at multi-TeV energies. These so-called "TeV halos" are now understood to be a nearly universal feature of middle-aged pulsars. However, many of the key physical processes that govern these systems, particularly those affecting particle diffusion, remain poorly constrained. We aim to evaluate the ability of the Cherenkov Telescope Array (CTA) to probe the physical properties of TeV halos, with a focus on the nearby and well-studied case of the Geminga pulsar. We simulate gamma-ray emission from various TeV halo models, incorporating different assumptions for the injected electron spectrum, spin-down evolution, and energy-dependent diffusion. These models are then used to forecast CTA's sensitivity to spectral and spatial differences, based on realistic mock observations and instrument response simulations. We find that CTA will be able to distinguish between a wide range of TeV halo models that are currently consistent with existing data. In particular, CTA observations can constrain the normalization, energy dependence, and spatial extent of the diffusion coefficient surrounding Geminga, as well as the spectral shape of the injected electron population.

79 ASTRONOMY AND ASTROPHYSICS↗

DOE OSTI2026

Beyond $\rho ^{2/3}$ scaling: microscopic origins and multimessengers of high-density nuclear symmetry energy

The nature and Equation of State (EOS) of dense neutron-rich matter are still very poorly known, while they have broad impacts on many interesting issues in both astrophysics and nuclear physics. In particular, the nuclear symmetry energy $E_{\textrm{sym}}(\rho )$ encoding the cost to make nuclear matter more neutron-rich has been the most uncertain component of the EOS of dense neutron-rich nucleonic matter. It significantly affects the radii, tidal deformations, cooling rates, and frequencies of various oscillation modes of isolated neutron stars as well as the strain amplitude and frequencies of gravitational waves from their mergers, besides its many effects on the structures of nuclei as well as the dynamics and observables of their collisions. Siemens (1970s) observed that $E_{\textrm{sym}}(\rho )$ scales as $(\rho /\rho _0)^{2/3}$ near the saturation density $\rho _0$ of nuclear matter, since both the kinetic part and the potential contribution (quadratic in momentum) exhibit this dependence. The scaling holds if: (1) the nucleon isoscalar potential is quadratic in momentum, and (2) the isovector interaction is weakly density-dependent. After examining many empirical evidences and understanding theoretical findings in the literature, we conclude that: (1) Siemens’ $\rho ^{2/3}$ scaling is robust and serves as a valuable benchmark for both nuclear theories and experiments up to $2\rho _0$ but breaks down at higher densities, (2) Experimental and theoretical findings about $E_{\textrm{sym}}(\rho )$ up to $2\rho _0$ are broadly consistent, but uncertainties remain large for its curvature $K_{\textrm{sym}}(\rho )$ and higher-order parameters, (3) Above $2\rho _0$ , uncertainties grow due to poorly constrained spin-isospin-dependent tensor and three-body forces as well as the resulting nucleon short-range correlations. Looking forward, combining signals from both observations of neutron stars and terrestrial heavy-ion reaction experiments is the most promising path to finally constraining the high-density $E_{\textrm{sym}}(\rho )$ and the EOS of supradense neutron-rich matter. Multiple examples of community efforts to further constrain the high-density $E_{\textrm{sym}}(\rho )$ using both real and mocked data of present and future high-precision observations of neutron stars, as well as heavy-ion collisions involving high-energy rare isotopes, are briefly reviewed.

Li, Bao-An [East Texas A & M Univ., Commerce, TX (↗

DOE OSTI2025

Simulation-Based Inference for Neutrino Interaction Model Tuning

This project demonstrates, for the first time, the application of simulation-based inference (SBI) techniques to tune neutrino–nucleus interaction models. Using a mock dataset based on the MicroBooNE tuning of the GENIE event generator, our approach employs a Neural Posterior Estimator (NPE) with Masked Autoregressive Flows (MAF) to infer the posterior distributions of key GENIE parameters directly from simulated histograms. The workflow provides a scalable and amortized framework for performing likelihood-free inference in high-dimensional parameter spaces, offering a pathway to more efficient and uncertainty-aware model tuning for next-generation neutrino experiments such as DUNE and SBND.

Tame-Narvaez, KarlaMaria [Fermi National Accelerat↗

DOE OSTI2023

Reverse engineering environmental metatranscriptomes clarifies best practices for eukaryotic assembly

Abstract Background Diverse communities of microbial eukaryotes in the global ocean provide a variety of essential ecosystem services, from primary production and carbon flow through trophic transfer to cooperation via symbioses. Increasingly, these communities are being understood through the lens of omics tools, which enable high-throughput processing of diverse communities. Metatranscriptomics offers an understanding of near real-time gene expression in microbial eukaryotic communities, providing a window into community metabolic activity. Results Here we present a workflow for eukaryotic metatranscriptome assembly, and validate the ability of the pipeline to recapitulate real and manufactured eukaryotic community-level expression data. We also include an open-source tool for simulating environmental metatranscriptomes for testing and validation purposes. We reanalyze previously published metatranscriptomic datasets using our metatranscriptome analysis approach. Conclusion We determined that a multi-assembler approach improves eukaryotic metatranscriptome assembly based on recapitulated taxonomic and functional annotations from an in-silico mock community. The systematic validation of metatranscriptome assembly and annotation methods provided here is a necessary step to assess the fidelity of our community composition measurements and functional content assignments from eukaryotic metatranscriptomes.

Krinos, Arianna I. (ORCID:0000000197678392)↗

DOE OSTI2021

Glacier ice archives nearly 15,000-year-old microbes and phages

Background Glacier ice archives information, including microbiology, that helps reveal paleoclimate histories and predict future climate change. Though glacier-ice microbes are studied using culture or amplicon approaches, more challenging metagenomic approaches, which provide access to functional, genome-resolved information and viruses, are under-utilized, partly due to low biomass and potential contamination. Results We expand existing clean sampling procedures using controlled artificial ice-core experiments and adapted previously established low-biomass metagenomic approaches to study glacier-ice viruses. Controlled sampling experiments drastically reduced mock contaminants including bacteria, viruses, and free DNA to background levels. Amplicon sequencing from eight depths of two Tibetan Plateau ice cores revealed common glacier-ice lineages including Janthinobacterium, Polaromonas, Herminiimonas, Flavobacterium, Sphingomonas, and Methylobacterium as the dominant genera, while microbial communities were significantly different between two ice cores, associating with different climate conditions during deposition. Separately, ~355- and ~14,400-year-old ice were subject to viral enrichment and low-input quantitative sequencing, yielding genomic sequences for 33 vOTUs. These were virtually all unique to this study, representing 28 novel genera and not a single species shared with 225 environmentally diverse viromes. Further, 42.4% of the vOTUs were identifiable temperate, which is significantly higher than that in gut, soil, and marine viromes, and indicates that temperate phages are possibly favored in glacier-ice environments before being frozen. In silico host predictions linked 18 vOTUs to co-occurring abundant bacteria (Methylobacterium, Sphingomonas, and Janthinobacterium), indicating that these phages infected ice-abundant bacterial groups before being archived. Functional genome annotation revealed four virus-encoded auxiliary metabolic genes, particularly two motility genes suggest viruses potentially facilitate nutrient acquisition for their hosts. Finally, given their possible importance to methane cycling in ice, we focused on Methylobacterium viruses by contextualizing our ice-observed viruses against 123 viromes and prophages extracted from 131 Methylobacterium genomes, revealing that the archived viruses might originate from soil or plants. Conclusions Together, these efforts further microbial and viral sampling procedures for glacier ice and provide a first window into viral communities and functions in ancient glacier environments. Such methods and datasets can potentially enable researchers to contextualize new discoveries and begin to incorporate glacier-ice microbes and their viruses relative to past and present climate change in geographically diverse regions globally.

59 BASIC BIOLOGICAL SCIENCES↗