On the Reduction of Proliferation of Finite Element Programs
Reduction of proliferation and maintainability of finite element method computer programs
Butler, T. G.↗
SEARCH · Search NASA
Results for “PROLIFERATION”
Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
Effects of weightlessness on tissue proliferation
The repair of bone marrow stroma following mechanical injury was studied to obtain baseline data for a proposed space experiment regarding the effect of weightlessness on marrow stroma and other proliferating cell systems.
Crosby, W. H.↗
Effect of weightlessness on lymphocyte proliferation
An experiment to study the effect of weightlessness on lymphocyte proliferation to detect possible alteration of the cells responsible for the immune response during long-duration space flights is described. Human lymphocytes in culture medium will be delivered shortly before launch in an incubator which will be kept at 37C. Mitogen will be added to the culture. A control without mitogen will be run in parallel. After 70 hours of incubation, radioactive thymidine will be added. After two hours, cellular activity will be stopped by fixation and incubator power switched off. Later, the amount of incorporated thymidine will be determined and the cell morphology and the distribution of cell organelles will be investigated.
Cogoli, A.↗
Effects of spaceflight on the proliferation of jejunal mucosal cells
The purpose of this project was to test the hypothesis that the generalized, whole body decrease in synthetic activity due to microgravity conditions encountered during spaceflight would be demonstrable in cells and tissues characterized by a rapid rate of turnover. Jejunal mucosal cells were chosen as a model since these cells are among the most rapidly proliferating in the body. Accordingly, the percentage of mitotic cells present in the crypts of Lieberkuhn in each of 5 rats flown on the COSMOS 2044 mission were compared to the percentage of mitotic cells present in the crypts in rats included in each of 3 ground control groups (i.e., vivarium, synchronous and caudal-elevated). No significant difference (p greater than .05) was detected in mitotic indices between the flight and vivarium group. Although the ability of jejunal mucosal cells to divide by mitosis was not impaired in flight group, there was, however, a reduction in the length of villi and depth of crypts. The concommitant reduction in villus length and crypth depth in the flight group probably reflects changes in connective tissue components within the core of villi.
Phillips, Robert W.↗
Experiment K-7-17: Effects of Spaceflight on the Proliferation of Jejunal Mucosal Cells
The purpose of this project was to test the hypothesis that the generalized, whole body decrease in synthetic activity due to microgravity conditions encountered during spaceflight would be demonstrable in cells and tissues characterized by a rapid rate of turnover. Jejunal mucosal cells were chosen as a model since these cells are among the most rapidly proliferating in the body. Accordingly, the percentage of mitotic cells present in the crypts of Lieberkuhn in each of 5 rats flown on the COSMOS 2044 mission were compared to the percentage of mitotic cells present in the crypts in rats included in each of 3 ground control groups (i.e., vivarium, synchronous and caudal-elevated). No significant difference (p greater than .05) was detected in mitotic indices between the flight and vivarium group. Although the ability of jejunal mucosal cells to divide by mitosis was not impaired in flight group, there was, however, a reduction in the length of villi and depth of crypts. The concommitant reduction in villus length and crypth depth in the flight group probably reflects changes in connective tissue components within the core of villi.
Phillips, R. W.↗
Proliferation, differentiation and apoptosis in connexin43-null osteoblasts
Osteoblasts are highly coupled by gap junctions formed primarily by connexin43 (Cx43). We have shown that interference with Cx43 expression or function disrupts transcriptional regulation of osteoblast genes, and that deletion of Cx43 in the mouse causes skeletal malformations, delayed mineralization, and osteoblast dysfunction. Here, we studied the mechanisms by which genetic deficiency of Cx43 alters osteoblast development. While cell proliferation rates were similar in osteoblastic cells derived from calvaria of Cx43-null and wild type mice, camptothecin-induced apoptosis was 3-fold higher in mutant compared to wild type osteoblasts. When grown in mineralizing medium, Cx43-null cells were able to produce mineralized matrix but it took one week longer to reach the same mineralization levels as in normal cells. Likewise, expression of alkaline phosphatase activity per cell--a marker of osteoblast differentiation--was maximal only 2 weeks later in Cx43-null relative to wild-type cells. These observations suggest that Cx43 is important for a normal and timely development of the osteoblastic phenotype. Delayed differentiation and increase programmed cell death may explain the skeletal phenotype of Cx43-null mice.
NASA Discipline Cell Biology↗
The use of the tyrosine phosphatase antagonist orthovanadate in the study of a cell proliferation inhibitor
Incubation of murine fibroblasts with orthovanadate, a global tyrosine phosphatase inhibitor, was shown to confer a "pseudo-transformed" phenotype with regard to cell morphology and growth characteristics. This alteration was manifested by both an increasing refractile appearance of the cells, consistent with many transformed cell lines, as well as an increase in maximum cell density was attained. Despite the abrogation of cellular tyrosine phosphatase activity, orthovanadate-treated cells remained sensitive to the biological activity of a naturally occurring sialoglycopeptide (SGP) cell surface proliferation inhibitor. The results indicated that tyrosine phosphatase activity, inhibited by orthovanadate, was not involved in the signal transduction pathway of the SGP.
NASA Discipline Number 93-10↗
Respiration rate in maize roots is related to concentration of reduced nitrogen and proliferation of lateral roots
The relationship between specific rate of respiration (respiration rate per unit root dry weight) and concentration of reduced nitrogen was examined for maize (Zea mays L.) roots. Plants with 2 primary nodal root axes were grown for 8 days in a split-root hydroponic system in which NO3- was supplied to both axes at 1.0 mol m-3, to one axis at 1.0 mol m-3 and the other axis at 0.0 mol m-3, or to both axes at 0.0 mol m-3. Respiration rates and root characteristics were measured at 2-day intervals. Specific rate of respiration was positively correlated in a nonlinear relationship with concentration of reduced nitrogen. The lowest specific rates of respiration occurred when neither axis received exogenous NO3- and the concentration of reduced nitrogen in the axes was less than 9 mg g-1. The greatest rates occurred in axes that were actively absorbing NO3- and contained more than 35 mg g-1 of reduced nitrogen. At 23 mg g-1 of reduced nitrogen, below which initiation of lateral branches was decreased by 30-50%, specific rate of respiration was 17% greater for roots actively absorbing NO3- than for roots not absorbing NO3-. Increases in specific rate of respiration associated with concentrations of reduced nitrogen greater than 23 mg g-1 were concluded to be attributable primarily to proliferation of lateral branches.
Non-NASA Center↗
Mouse osteoblastic cell line (MC3T3-E1) expresses extracellular calcium (Ca2+o)-sensing receptor and its agonists stimulate chemotaxis and proliferation of MC3T3-E1 cells
The calcium-sensing receptor (CaR) is a G protein-coupled receptor that plays key roles in extracellular calcium ion (Ca2+o) homeostasis in parathyroid gland and kidney. Osteoblasts appear at sites of osteoclastic bone resorption during bone remodeling in the "reversal" phase following osteoclastic resorption and preceding bone formation. Bone resorption produces substantial local increases in Ca2+o that could provide a signal for osteoblasts in the vicinity, leading us to determine whether such osteoblasts express the CaR. In this study, we used the mouse osteoblastic, clonal cell line MC3T3-E1. Both immunocytochemistry and Western blot analysis, using an antiserum specific for the CaR, detected CaR protein in MC3T3-E1 cells. We also identified CaR transcripts in MC3T3-E1 cells by Northern analysis using a CaR-specific riboprobe and by reverse transcription-polymerase chain reaction with CaR-specific primers, followed by nucleotide sequencing of the amplified products. Exposure of MC3T3-E1 cells to high Ca2+o (up to 4.8 mM) or the polycationic CaR agonists, neomycin and gadolinium (Gd3+), stimulated both chemotaxis and DNA synthesis in MC3T3-E1 cells. Therefore, taken together, our data strongly suggest that the osteoblastic cell line MC3T3-E1 possesses both CaR protein and mRNA very similar, if not identical, to those in parathyroid and kidney. Furthermore, the CaR in these osteoblasts could play a key role in regulating bone turnover by stimulating the proliferation and migration of such cells to sites of bone resorption as a result of local release of Ca2+o.
Non-NASA Center↗
Cell proliferation inhibition in reduced gravity
Extended durations of spaceflight have been shown to be deleterious on an organismic level; however, mechanisms underlying cellular sensitivity to the gravitational environment remain to be elucidated. The majority of the gravitational studies to date indicates that cell regulatory pathways may be influenced by their gravitational environment. Still, few cell biology experiments have been performed in space flight and even fewer experiments have been repeated on subsequent flights. With flight opportunities on STS-50, 54, and 57, Sf9 cells were flown in the BioServe Fluids Processing Apparatus and cell proliferation was measured with and without exposure to a cell regulatory sialoglycopeptide (CeReS) inhibitor. Results from these flights indicate that the Sf9 cells grew comparable to ground controls, that the CeReS inhibitor bound to its specific receptor, and that its signal transduction cascade was not gravity sensitive.
STS-54 Shuttle Project↗
Satellite cell proliferation in adult skeletal muscle
Novel methods of retroviral-mediated gene transfer for the in vivo corporation and stable expression of eukaryotic or prokaryotic foreign genes in tissues of living animals is described. More specifically, methods of incorporating foreign genes into mitotically active cells are disclosed. The constitutive and stable expression of E. coli .beta.-galactosidase gene under the promoter control of the Moloney murine leukemia virus long terminal repeat is employed as a particularly preferred embodiment, by way of example, establishes the model upon which the incorporation of a foreign gene into a mitotically-active living eukaryotic tissue is based. Use of the described methods in therapeutic treatments for genetic diseases, such as those muscular degenerative diseases, is also presented. In muscle tissue, the described processes result in genetically-altered satellite cells which proliferate daughter myoblasts which preferentially fuse to form a single undamaged muscle fiber replacing damaged muscle tissue in a treated animal. The retroviral vector, by way of example, includes a dystrophin gene construct for use in treating muscular dystrophy. The present invention also comprises an experimental model utilizable in the study of the physiological regulation of skeletal muscle gene expression in intact animals.
Booth, Frank W.↗
University-level Non-proliferation and Safeguards Education and Human Capital Development Activities at Brookhaven National Laboratory
BNL has offered Nuclear Nonproliferation, Safeguards and Security in the 21st Century,? referred to as NNSS, every year since 2009 for graduate students in technical and policy fields related to nuclear safeguards and nonproliferation. The course focuses on relevant policy issues, in addition to technical components, and is part of a larger NGSI short course initiative that includes separate courses that are delivered at three other national laboratories and NNSA headquarters. [SCHOLZ and ROSENTHAL] The course includes lectures from esteemed nonproliferation experts, tours of various BNL facilities and laboratories, and in-field and table-top exercises on both technical and policy subjects. Topics include the history of the Treaty on the Non-proliferation of Nuclear Weapons (NPT) and other relevant treaties, the history of and advances in international nuclear safeguards, current relevant political situations in countries such as Iran, Iraq, and the Democratic Peoples? Republic of Korea (DPRK), nuclear science and technology, instrumentation and techniques used for verification activities, and associated research and development. The students conduct a mock Design Information Verification (DIV) at BNL?s decommissioned Medical Research Reactor. The capstone of the course includes a series of student presentations in which students act as policy advisors and provide recommendations in response to scenarios involving a current nonproliferation related event that are prepared by the course organizers. ?The course is open to domestic and foreign students, and caters to students in, entering, or recently having completed graduate school. Interested students must complete an application and provide a resume and a statement describing their interest in the course. Eighteen to 22 students attend annually; 165 students have completed the course to date. A stipend helps to defray students? travel and subsistence expenses. In 2015, the course was shortened from three weeks to two weeks to streamline the material, standardize NGSI course length, and draw in a larger applicant pool. ?The international and interdisciplinary mix of students attending the course encourages discussions of the topics presented during the course. Information about the course is available at https://www.bnl.gov/nnsscourse/. While a complete analysis of course students has not been undertaken, BNL is aware of three individuals who worked at national laboratories after attending the NNSS course, one who worked at a national laboratory prior to attending NNSS, two who worked as federal employees after attending NNSS, three who were Nonproliferation Graduate Fellows before or after attending NNSS, and three who have participated in other NGSI activities.?Design Information Verification is an IAEA inspection activity that is implemented for the purpose of ensuring that the facility design is consistent with the declared use of a facility.
98 NUCLEAR DISARMAMENT, SAFEGUARDS, AND PHYSICAL P↗
Toward a Multimodal-Deep Learning Retrieval System for Monitoring Nuclear Proliferation Activities
As the amount of available data increases, the human ability to locate, process, and analyze it is strained and eventually overwhelmed. To address this challenge for nonproliferation analysts, the authors have been creating a large-scale multimodal retrieval system to help analysts triage and search open source science, technology, and news data for indicators of nuclear proliferation capabilities and activities. The system relies on a set of deep neural networks (DNNs) trained to evaluate conceptual similarities across data modalities, such as text, image, and video. These DNNs can be used to search and prioritize data, according to a nuclear fuel cycle (NFC) process template, that are conceptually closest to the seed query items regardless of data modality. The DNNs have been trained to map conceptually related words, sentences, and images to nearby points in a multimodal feature space, enabling intra- and intermodal retrieval via nearest-neighbor calculations to seed query points. The authors evaluate the system’s ability to retrieve NFC-related data that have been purposely hidden in collections of unrelated background data. They demonstrate quantitative and qualitative results for text-to-image, image-to-image, and image-to-video retrievals. This paper discusses data challenges confronting nonproliferation analysts, describes the DNNs designed to retrieve multimodal data that are proximal in the semantic space, and demonstrates their effectiveness by applying the DNNs to nonproliferation-specific multimodal data sets.
97 MATHEMATICS AND COMPUTING↗
Importance of 3-D S{sub N} depletion in non-proliferation using BSOLVE
We present a single Pressurized Water Reactor (PWR) 3-D fuel rod design for depletion analysis using BSOLVE, our newly developed Runge-Kutta-Fehlberg based depletion code. BSOLVE is coupled with the deterministic 3-D S{sub N} particle transport code, PENTRAN, applied here with a 4-neutron energy group comparison to Continuous Energy (C/E) SERPENT2 Monte Carlo results. Differences are expected, as PENTRAN+BSOLVE retains full (multi-group) energy information for reactions, nuclide specific fission contributions, and energy dependent fission yields, using the latest available ENDF-BVIII data, important to retain accurate burned fuel inventories; SERPENT2 collapses burnup reactions to a single energy value. For depletion times up to ∼ 700 days and typical PWR power densities, relative differences between multigroup 3-D S{sub N} with full energy data and Monte Carlo one group burnup for trans-uranium nuclide concentrations and fission products are up to ∼20%. System eigenvalues are consistent, but with differences early and late in the cycle attributed to multigroup vs. C/E Monte Carlo cross sections. This work highlights the importance of low variance transport driven burnup for non-proliferation concerns, since plutonium quality varies significantly along axial lengths, and is more challenging to converge using Monte Carlo; details of depletion steps with spatial/zone dependent plutonium quality are provided. (authors)
21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗
NNSA Digital Twin to Detect Nuclear Proliferation (SAC Rapidfire)
This is a short presentation on the NNSA digital twin for proliferation detection, for a scientific advisory committee meeting
artificial intelligence↗
Quantifying Correlations between International Relations and Nuclear Proliferation Status
Poster for the Advances in Nuclear Nonproliferation Technology & Policy Conference, to be held in Santa Fe, New Mexico, on September 25-30, 2016.
98 NUCLEAR DISARMAMENT, SAFEGUARDS, AND PHYSICAL P↗
Cellular Composition and Expression of Cell Proliferation and Apoptosis Markers in Bone Marrow Cells after Heterotransplantation
The effects of heterotransplantation on bone marrow structures were studied in experimental male mice. Suspension of the bone marrow from feline femur (1 ml bone marrow diluted in isotonic saline, 1:2) was injected into the caudal vein. Heterotransplantation led to an increase in the level of serotonin involved in cell differentiation. In 2 days, the counts of all cells except erythroid cells decreased. Immunohistochemical analysis of Ki-67 marker within 40 min after transplantation showed a significant increase of cell proliferative activity in comparison with that in intact mice. At later terms, the expression of Ki-67 in bone marrow cells decreased, while the expression of apoptosis regulator P-53 increased, which was associated with the presence of numerous dead cells.
60 APPLIED LIFE SCIENCES↗
Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer
The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as 'TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT'.
62 RADIOLOGY AND NUCLEAR MEDICINE↗