SEARCH · Search NASA

Results for “planted solution”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 487 records · Page 27

All sources NASA NTRS DOE OSTI

DOE OSTI2024

SMR Current Status: Development Needs and Global Perspectives

Defined as nuclear reactors with a power output up to 300 megawatts electrical (MWe) by the International Atomic Energy Agency (IAEA) and targeted for multipurpose applications, small modular reactors (SMRs) have been recognized as a very promising, clean, affordable, and sustainable energy source by many countries. At present, more than 80 SMRs are under design, development, demonstration, deployment, and beyond (4D+) phases worldwide. This study focuses on the current world status of SMRs and focuses on the necessary developments to accelerate the process of adopting SMRs as a major energy source globally. SMRs are not a new concept, but they do represent a new vision for older concepts if the challenges inherent within them are mitigated with strategic and realistic solution approaches. The major challenges for SMRs 4D+ like any new reactors are: (a) qualifying the advanced fuel-to-reactor design; (b) supporting rapid scaled/prototypic experimentations; (c) maintaining local and global codes, standards, and licensing; (d) supply chain issues;(e) effective cradle-to-grave nuclear fuel cycle and fuel material transportation, and (f) mitigating financial and environmental risks. These upfront challenges can be mitigated with a synergistic solution approach among the various stakeholders: industry, academia, research, government, and international entities.

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗

DOE OSTI2024

Presentation: SMR Current Status: Development Needs and Global Perspectives

Defined as nuclear reactors with a power output up to 300 megawatts electrical (MWe) by the International Atomic Energy Agency (IAEA) and targeted for multipurpose applications, small modular reactors (SMRs) have been recognized as a very promising, clean, affordable, and sustainable energy source by many countries. At present, more than 80 SMRs are under design, development, demonstration, deployment, and beyond (4D+) phases worldwide. This paper focuses on the current world status of SMRs and focuses on the necessary developments to accelerate the process of adopting SMRs as a major energy source globally. SMRs are not a new concept, but they do represent a new vision for older concepts if the challenges inherent within them are mitigated with strategic and realistic solution approaches. The major challenges for SMRs 4D+ like any new reactors are: (a) qualifying the advanced fuel-to-reactor design; (b) supporting rapid scaled/prototypic experimentations; (c) maintaining local and global codes, standards, and licensing; (d) supply chain issues; (e) effective cradle-to-grave nuclear fuel cycle and fuel material transportation, and (f) mitigating financial and environmental risks. These upfront challenges can be mitigated with a synergistic solution approach among the various stakeholders: industry, academia, research, government, and international entities.

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗

DOE OSTI2024

SMR Current Status: Development Needs and Global Perspectives

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗

DOE OSTI2020

The Effects of Synthesis Conditions on the Carbon Capture Capacity of Polyethylenimine Impregnated Protonated Titanate Nanotubes

Capture and storage of carbon dioxide emitted from power plants, which burn fossil fuels, is one of the best ways to mitigate climate change. Polyethylenimine (PEI) impregnated protonated titanate nanotubes (PEI-PTNTs) are efficient amine-modified solid adsorbents for post combustion carbon capture. This study is to investigate the effects of synthesis conditions of titanate nanotubes on the carbon capture capacity of PEI-PTNTs. PTNTs are synthesized using hydrothermal treatment of TiO 2 anatase powder at different temperatures and in different days, followed by washing with dilute HCl solution and deionized water. PEI-PTNTs are prepared by loading PEI (M.W. = 10,000) onto PTNTs at a weight ratio of 1:1 using a wet impregnation process. PTNTs and PEI-PTNTs are characterized using transmission electron microscopy, porosity and surface area analysis, powder X-ray diffraction, and Fourier transform infrared spectroscopy. CO 2 adsorption is conducted at 75 °C using simulated flue gas, and CO 2 desorption is performed at 110 °C by purging the adsorbent with dry nitrogen gas. CO 2 adsorption experiments demonstrate that the PEI-PTNTs synthesized at 130 °C within 3 or 5 days, have the highest CO 2 capture capacity. These optimized PEI-PTNTs have a significant potential to capture CO 2 from power plants.

Materials Science↗

DOE OSTI2022

Energy-Storing Cryogenic Carbon Capture™ for Utility and Industrial-scale Processes (Final Report)

This project leverages work completed under funding from previous U.S. Department of Energy (DOE) projects and other sources of funding around the Cryogenic Carbon Capture Process™ (CCC). The purpose of this project is to further develop a perturbation of the CCC process that stores energy called the Cryogenic Carbon Capture™ Energy Storing (CCC-ES) process. The successful completion of the tasks in this project has prepared the CCC-ES process for scaling and developed initial plans and a feasibility analysis for an engineering-scale or small-commercial scale system that can store at least 10 MWh of energy. The specific areas of work in this project are: (1) Develop a conceptual, site-specific integrated process flow diagram: Sustainable Energy Solutions (SES) developed a conceptual, site-specific plan including a process flow diagram for integrating CCC-ES at a specific location. The proposed system was based on a typical engineering-scale CCC system designed to capture 30-50 metric tonnes of CO 2 per day (TPD), with modifications and additional changes and equipment put in place to add the energy storage element to the system. The 30-50 TPD scale corresponds to the required 10 MWh of stored energy. This task includes updating simulation software for transient analysis. SES also coordinated with the Jim Bridger Power Plant in Point of Rocks, Wyoming to get site-specific data. Using these data, SES completed site-specific preliminary process flow diagrams, estimated capital and operating costs for the CCC-ES system, and used the upgraded software package to estimate the primary figures of merit. (2) Complete a technoeconomic analysis (TEA): SES completed a full-scale TEA of the CCC-ES system to meet specific success criteria. This TEA used process information from the host site selected above. (3) Technology and data gap assessment for the CCC-ES process: As part of the technology gap assessment, SES performed an assessment of the best alternative energy storage solutions including figures of merit and operational strengths and weaknesses. SES then compared the proposed system with a discussion of how it addresses the weaknesses of alternative systems, showing for example a cost of stored energy at less than $50/MWh and with a roundtrip efficiency of greater than 95%. This assessment includes technical and other risk analyses and technology gaps with research and development needs to commercialize the process by 2030. Finally, work includes a commercialization roadmap/development pathway outlining the major milestones to move to a commercially operating CCC-ES system. (4) Phase II pre-FEED project plan: SES completed a project plan for the Phase II pre-FEED analysis using the same host site as in the Phase I conceptual study.

03 NATURAL GAS↗

DOE OSTI2020

Using Machine Learning to Predict Future Temperature Outputs in Geothermal Systems

Optimizing the power output, and economic value, of geothermal power plants over decades of operation is a major challenge in renewable energy. Optimizing the output requires the ability to predict the mass flow rates and the output temperatures of production wells based on the inputs of injection wells, as well as the time history of the system. Machine Learning (ML) that incorporates the known physics of geothermal systems is one possible solution to this challenge. In this work, we explore the ability of ML algorithms to predict future temperature outputs based on historical data. Considering the challenges with obtaining an empirical dataset from field data that is large enough to enable reliable ML, we propose an alternate approach: developing a high-fidelity reservoir model and using computational resources to build a dataset that enables ML. As a first step towards achieving this goal, we present preliminary results from applying ML to predict the temperature timeseries of simple modeled geothermal systems. We describe the application of relevant state-of-the-art ML approaches, such as the Long Short-Term Memory (LSTM) networks and Convolutional Neural Networks (CNN), to extract temporal structures in the model data. We assess the accuracy of the forecasts we obtain, compare the selected approaches, and share the lessons learned that would inform the process of training and utilizing ML algorithms for larger and more complex geothermal systems.

GEOTHERMAL ENERGY↗

DOE OSTI2020

Performance assessment of long-legged tightly-baffled divertor geometries in the ARC reactor concept

Extremely intense power exhaust channels are projected for tokamak-based fusion power reactors; a means to handle them remains to be demonstrated. Advanced divertor configurations have been proposed as potential solutions. Recent modelling of tightly baffled, long-legged divertor geometries for the divertor test tokamak concept, ADX, has shown that these concepts may access passively stable, fully detached regimes over a broad range of parameters. The question remains as to how such divertors may perform in a reactor setting. To explore this, numerical simulations are performed with UEDGE for the long-legged divertor geometry proposed for the ARC pilot plant conceptual design - a device with projected heat flux power width (λq||) of 0.4 mm and power exhaust of 93 MW - first for a simplified Super-X divertor configuration (SXD) and then for the actual X-point target divertor (XPTD) being proposed. It is found that the SXD, combined with 0.5% fixed-fraction neon impurity concentration, can produce passively stable, detached divertor regimes for power exhausts in the range of 80-108 MW - fully accommodating ARC's power exhaust. The XPTD configuration is found to reduce the strike-point temperature by a factor of ~10 compared to the SXD for small separations (~1.4λq||) between main and divertor X-point magnetic flux surfaces. Even greater potential reductions are identified for reducing separations to ~1λq|| or less. The power handling response is found to be insensitive to the level of cross-field convective or diffusive transport assumed in the divertor leg. By raising the separatrix density by a factor of 1.5, stable fully detached divertor solutions are obtained that fully accommodate the ARC exhaust power without impurity seeding. To our knowledge, this is the first time an impurity-free divertor power handling scenario has been obtained in edge modelling for a tokamak fusion power reactor with λq|| of 0.4 mm.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗

DOE OSTI2022

Techno-Economic Analysis of Natural Gas Fuel Cell Plant Configurations

The United States (U.S.) Department of Energy (DOE) Office of Fossil Energy and Carbon Management (FECM) and the National Energy Technology Laboratory (NETL) have been pursuing the development of solid oxide fuel cell (SOFC) technology to enable future power generation systems that are consistent with the cornerstones of the DOE mission—to ensure America’s security and prosperity by addressing its energy and environmental challenges through transformative science and technology solutions. The U.S. DOE FECM SOFC Program is currently focused on the development of low-cost, highly efficient, and reliable SOFC power systems. NETL’s SOFC technology development roadmap is aligned with near-term market opportunities in the distributed generation sector to validate and advance the technology while paving the way for utility-scale (> 50 MW) natural gas and coal-derived synthesis gas-fueled applications via progressively larger system demonstrations. The present study represents a part of a series of system evaluations being developed at NETL to aid in prioritizing technological advances along research pathways to the realization of utility-scale SOFC systems, a transformational goal of the fuel cell program. In particular, the system performance of utility-scale natural gas fuel cell (NGFC) systems with and without carbon dioxide (CO 2 ) capture is presented. The objective of the study is to provide targeted research and development (R&D) guidance to the FECM SOFC Program and SOFC commercial developers to accelerate technology deployment.

03 NATURAL GAS↗

DOE OSTI2025

A Study on Co-existing Heterogeneous Wireless Networks for Data Transmission within a Nuclear Facility

Deployment of wireless technologies is a salient need for modernization, automation and improved operation of nuclear power plants (NPPs). As a single technology cannot support the ever-changing needs, it is required to have a heterogeneous wireless network architecture to address the different technical and economic challenges. However, the coexistence of these multiband heterogeneous wireless networks brings numerous challenges due to the factors including dissimilarity in their channel access mechanism, distance between nodes, transmit power level and many more. This paper develops real-world experiments and simulations of wireless coexistence for Wi-Fi, Fifth generation cellular (5G) and Zigbee in the unlicensed band to understand the challenges and opportunities. The experiments were conducted over the Platform for Open Wireless Data-driven Experimental Research (POWDER) testbed at the university of Utah. In addition, this paper is the first to propose a novel packet rate control technique at the network layer to create temporary opportunities for 5G or Zigbee signal transmissions focusing its application in a nuclear facility while using the shared band. The performance of the proposed coexistence solution is validated with experimental results and simulation.

5G↗

DOE OSTI2021

sCO 2 Brayton Energy Conversion Customer Discovery

All energy production systems need efficient energy conversion systems. Current Rankine cycles use water to generate steam at temperatures where efficiency is limited to around 40%. As existing fossil and nuclear power plants are decommissioned due to end of effective life and/or societies’ desire for cleaner generation options, more efficient energy conversion is needed to keep up with increasing electricity demands. Modern energy generation technologies, such as advanced nuclear reactors and concentrated solar, coupled to high efficiency sCO 2 conversion systems provide a solution to efficient, clean energy systems. Leading R&D communities worldwide agree that the successful development of sCO 2 Brayton power cycle technology will eventually bring about large-scale changes to existing multi-billion-dollar global markets and enable power applications not currently possible or economically justifiable. However, all new technologies face challenges in the path to commercialization and the electricity sector is distinctively risk averse. The Sandia sCO 2 Brayton team needs to better understand what the electricity sector needs in terms of new technology risk mitigation, generation efficiency, reliability improvements above current technology, and cost requirements which would make new technology adoption worthwhile. Relying on the R&D community consensus that a sCO 2 power cycle will increase the revenue of the electrical industry, without addressing the electrical industry’s concerns, significantly decreases the potential for adoption at commercial scale. With a clear understanding of the market perspectives on technology adoption, including military, private sector, and utilities customers, the Sandia Brayton Team can resolve industry concerns for smoother development and faster transition to commercialization. An extensive customer discovery process, similar to that executed through the NSF’s I-Corp program, is necessary in order to understand the pain points of the market and articulate the value proposition of Brayton systems in terms that engage decision makers and facilitate commercialization of the technology.

29 ENERGY PLANNING, POLICY, AND ECONOMY↗

DOE OSTI2023

Diversifying and perennializing plants in agroecosystems alters retention of new C and N from crop residues

Abstract Managing soils to retain new plant inputs is key to moving toward a sustainable and regenerative agriculture. Management practices, like diversifying and perennializing agroecosystems, may affect the decomposer organisms that regulate how new residue is converted to persistent soil organic matter. Here we tested whether 12 years of diversifying/perennializing plants in agroecosystems through extended rotations or grassland restoration would decrease losses of new plant residue inputs and, thus, increase retention of carbon (C) and nitrogen (N) in soil. We tracked dual‐labeled ( 13 C and 15 N), isotopically enriched wheat ( Triticum aestivum ) residue in situ for 2 years as it decomposed in three agroecosystems: maize–soybean (CS) rotation, maize–soybean–wheat plus red clover and cereal rye cover crops (CSW2), and spring fallow management with regeneration of natural grassland species (seven to 10 species; SF). We measured losses of wheat residue (C wheat and N wheat ) in leached soil solution and greenhouse gas fluxes, as well as how much was recovered in microbial biomass and bulk soil at 5‐cm increments down to 20 cm. CSW2 and SF both had unique, significant effects on residue decomposition and retention dynamics that were clear only when using nuanced metrics that able to tease apart subtle differences. For example, SF retained a greater portion of C wheat in 0–5 cm surface soils (155%, p = 0.035) and narrowed the C wheat to N wheat ratio ( p < 0.030) compared to CS. CSW2 increased an index of carbon‐retention efficiency, C wheat retained in the mesocosm divided by total measured, from 0.18 to 0.27 (49%, p = 0.001), compared to CS. Overall, we found that diversifying and extending the duration of living plants in agroecosystems can lead to greater retention of new residue inputs in subtle ways that require further investigation to fully understand.

McDaniel, Marshall D.↗

DOE OSTI2022

FLOW Estimation and Rose Superposition (FLOWERS): an integral approach to engineering wake models

Abstract. Annual energy production (AEP) is often the objective function in wind plant layout optimization studies. The conventional method to compute AEP for a wind farm is to first evaluate power production for each discrete wind direction and speed using either computational fluid dynamics simulations or engineering wake models. The AEP is then calculated by weighted-averaging (based on the wind rose at the wind farm site) the power produced across all wind directions and speeds. We propose a novel formulation for time-averaged wake velocity that incorporates an analytical integral of a wake deficit model across every wind direction. This approach computes the average flow field more efficiently, and layout optimization is an obvious application to exploit this benefit. The clear advantage of this new approach is that the layout optimization produces solutions with comparable AEP performance yet is completed 2 orders of magnitude faster. The analytical integral and the use of a Fourier expansion to express the wind speed and wind direction frequency create a relatively smooth solution space for the gradient-based optimizer to excel in comparison to the existing weighted-averaging power calculation.

17 WIND ENERGY↗

DOE OSTI2026

Optimizing pressurized-water reactor equilibrium cycle using a novel loading pattern encoding and rule-based genetic crossover operators

This work presents an extended multi-batch approach applied in shuffling scheme optimization for equilibrium cycle for pressurized water reactors using Genetic Algorithms (GAs). A new ruled based GA crossover operator called Inherited Location and Batch (ILB) was introduced to enhance offsprings reproduction efficiency specialized for equilibrium cycle optimization problem. This approach was implemented within the Plant ReLoad Optimization (PRLO) framework and validated using a generic reactor model based on the AP1000 design, with core parameters calculated via the CASMO/SIMULATE software package. The ILB approach is then applied for both single and multi-objective problems in maximizing cycle length and core average exposure while minimizing the average enrichment of the 57 fresh fuel assemblies (FAs) per cycle. The optimal solutions are selected based on their dominance to the objectives from all feasible solutions. This research identified three optimal solutions satisfied safety constraints: The first solution minimizes feed enrichment costs with a cycle length of 338.8 days and core exposure of 25.39 MWd/MT; the second solution extends cycle length to 361.2 days, with the highest core exposure of 26.84 MWd/MT, using 3.75 wt% average fuel enrichment; the third solution balances both objectives with a cycle length of 349.6 days, core exposure of 25.82 MWd/MT with a slight enrichment increase compared to the first solution. Collectively, these findings underscore the efficiency and effectiveness of the proposed approach in achieving practical multi-objective optimal equilibrium cycle designs using GAs optimizer.

11 - NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗

DOE OSTI2025

Carbon Capture and Storage for Small-to-Medium Biorefineries: Promising Carbon Removal Solution with Economic Challenges

Carbon capture and storage (CCS) integrated with biomass-based fuel production can provide cost-effective biomass carbon removal and storage (BiCRS) and produce high-value bioproducts, such as sustainable aviation fuels. To accelerate BiCRS deployment, it is crucial to quantify the costs of CCS integration, particularly for small- and medium-scale biorefineries that are representative of early-stage deployment. Existing studies tend to focus on plant sizes that are orders-of-magnitude larger than early-stage installations, possibly underestimating CCS costs for small-to-medium biorefineries. We show that the capture, transport, and storage costs to maximize CO 2 removal from a 526 dry tonne per day (tpd) biomass gasification plant (largest existing size) could be 13–47% higher than costs for a typical modeled plant size (2000 dry tpd). The higher cost estimates are driven by less favorable economies of scale and realistic assumptions about the availability of affordable CO 2 transport infrastructure with both drivers broadly applicable to other BiCRS technologies. Compliance and voluntary carbon markets could incentivize biorefinery CCS, but both carry a high degree of uncertainty. In conclusion, these findings highlight that sufficient and reliable financial mechanisms would be essential to unlocking the full CO 2 removal potential of biorefineries and facilitating BiCRS scale-up.

Biological transport↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2020

Development of Remote Cutting Tools for use at ATR - 20438

As a result of years of operations of the Advanced Test Reactor (ATR) at the Idaho National Lab (INL), the ATR canal has become congested due to the storage of materials including waste consisting of highly irradiated remote handled (RH) metals. In order to support its continuing nuclear mission the ATR requires canal space to support fuel storage and future core internal change out (CIC) components. INL staff determined that the canal must be cleaned out and waste removed to efficiently utilize the valuable canal floor space. It was determined that a methodology for processing, packaging, characterizing, and removing current and future irradiated hardware from the ATR canal is needed. Orano Federal Services (OFS) and its subcontractor Babcock Services Inc. (BSI) were selected to provide remote tooling in order to safely and efficiently size reduce the material currently stored in the ATR canal. INL developed detailed requirements that established the design and performance requirements for the tooling. Orano TN and BSI had recently successfully completed similar tasks in clearing highly activated materials from spent fuel pools and canals at commercial nuclear plants. That experience directly translated into a proven approach that could be used at the ATR thereby saving time and money and lowering risks. Based on BSI's demonstrated proficiency in the design and deployment of remote size reduction specialty tooling at comparable commercial facilities, Orano Federal Services was confident that a solution to INL's requirements could be delivered. The tooling had to be designed to be compatible with the operational requirements of the ATR canal as well as the functionality needed by the facility operators that will use the equipment. Some of the major design requirements and functions of the equipment included remote operations, capability to shear highly irradiated sections of aluminum and steel tubing, pipe, and components ranging in size from 0.6 cm to 16.5 cm diameter into 1.5 m -1.8 m lengths, utilizing buoyancy compensation to assist with underwater operations, and use commercially available existing technology and components as much as practical. The design team evaluated and selected commercially available equipment that could be modified to meet the design and performance specifications. In addition, a waste sizing table (WST) was designed and fabricated to further ensure the size reduction equipment would perform as expected and give the facility operators a stable and usable remote, underwater work platform. After successful development of the tooling, a mock up test and operator training was conducted to ensure the tooling performed as expected and met the requirements of INL. (authors)

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗

DOE OSTI2021

VERA-Grizzly Ex-Core Calculations: Watts Bar Unit 1 Cycles 1-2

The critical structures that comprise light-water reactor (LWR) nuclear power plants are subjected to operating environments that can challenge their integrity. Structures in close proximity to the reactor core, such as the reactor pressure vessel (RPV) and the biological shield wall, are subjected to high levels of radiation emanating from the core, as well as elevated temperatures. As the US fleet of operating LWRs ages, the effects of these operating environments on the integrity of these structures must be considered to ensure their continued safe operation. Extending the lifetime of commercial reactors and maintaining the aging reactor fleet require accurate prediction of the exposure of ex-core components to neutron and photon radiation. In particular, concrete degradation studies must be performed to evaluate the safety and long-term operation of reactors with lifetime extensions. The concrete reactor bioshield is important for providing radiological protection during operation and must last for the entire lifetime of the reactor. Recent interest in lifetime extensions furthers the need to accurately simulate concrete material degradation in the reactor bioshield. As a result of this need, the Nuclear Energy Advanced Modeling and Simulation (NEAMS) program has funded this study to couple its tools, Virtual Environment for Reactor Applications (VERA) and Grizzly. VERA allows users to set up models to calculate time-dependent and fully coupled solutions (with thermal feedback) for ex-core quantities of interest such as vessel and coupon fluence and detector responses for multiple statepoints and cycles. Grizzly is a finite-element application based on the Multiphysics Object Oriented Simulation Environment (MOOSE) framework that is used to enable aging materials calculations. This report highlights the work performed to calculate the fluence in the vessel and concrete for Watts Bar Nuclear Plant Unit 1 (WBN1) Cycles 1 and 2. The fluences obtained from VERA were successfully transferred to Grizzly using a Python script. Four simulations were run with Grizzly: (1) the Mazars model with the initial Young’s modulus being the instantaneous modulus, (2) the Mazars model with the initial Young’s modulus being the delayed modulus, (3) the Mazars model with the initial Young’s modulus being the delayed modulus with the addition of the effects of micro-damage caused by irradiation, and (4) the Mazars model with the initial Young’s modulus being the instantaneous modulus, and with the addition of micro-damage and creep. Details regarding the methods used to obtain the fluence and the statistical errors associated with the VERA Monte Carlo Shift calculations are discussed in greater detail in this report. The results obtained from the four Grizzly models are also presented in this report.

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗

DOE OSTI2026

Data for Clumping Index Estimation With 30°-tilted Cameras in Row Crops: Evaluation of Methods and Segment Size Effects

The clumping index (CI) quantifies the spatial distribution of foliage elements and is essential for accurately estimating the plant area index (PAI), canopy radiative transfer, and photosynthesis. Traditionally, the finite-length averaging method (LX), the gap size distribution method (CC), and a combined approach of CC and LX (CLX) have been applied to instruments like TRAC and digital hemispherical photography to estimate CI. However, a comprehensive evaluation of these methods in row crops remains limited, especially regarding the influence of segment size on CI. Meanwhile, digital cameras offer a cost-effective and user-friendly solution for canopy measurements in row crops, yet their application in this context remains underexplored. In this study, we employed a new approach using a 30°-tilted digital camera to estimate CI in corn and soybean fields, applying the LX, CC, and CLX methods. We systematically assessed the performance of these three methods by combining field measurements in real-world fields with simulations using the LESS 3D radiative transfer model. Our results showed that CLX applied to the whole image and 45° segment offered accurate estimation of CI (bias within ±0.1, RMSE < 0.2) and PAI (bias within ±0.4, RMSE < 1) in real-world fields and LESS simulations. The accuracy of the LX method was highly sensitive to segment size, with the best performance observed at the 15° segment (PAI bias within ±0.4). In contrast, the CC method remained stable across different segment sizes, and its performance was generally comparable to that of LX, except at the 15° segment. Across view zenith angles, CI derived from CC generally showed a continuous increase, while those from LX and CLX followed a rising trend at small zenith angles but began to decline at 68°, likely due to an increasing proportion of no-gap segments. Seasonally, LX tended to show decreasing CI during early growth stages but increased as the canopy matured, whereas CC and CLX showed gradually increasing CI before plateauing at peak PAI. The 30°-tilted camera effectively captured CI variations across different angles and growth stages, making it a practical and robust instrument for row crop canopy structure analysis. Applying these CI methods to digital cameras offers a low-cost and accessible CI estimation alternative, improving canopy structure monitoring accuracy in row crops.

Modeling↗