Results for “Core Design” — Page 28

DOE OSTI2023

Mechanism of glycoform specificity and in vivo protection by an anti-afucosylated IgG nanobody

Abstract Immunoglobulin G (IgG) antibodies contain a complex N -glycan embedded in the hydrophobic pocket between its heavy chain protomers. This glycan contributes to the structural organization of the Fc domain and determines its specificity for Fcγ receptors, thereby dictating distinct cellular responses. The variable construction of this glycan structure leads to highly-related, but non-equivalent glycoproteins known as glycoforms. We previously reported synthetic nanobodies that distinguish IgG glycoforms. Here, we present the structure of one such nanobody, X0, in complex with the Fc fragment of afucosylated IgG1. Upon binding, the elongated CDR3 loop of X0 undergoes a conformational shift to access the buried N -glycan and acts as a ‘glycan sensor’, forming hydrogen bonds with the afucosylated IgG N -glycan that would otherwise be sterically hindered by the presence of a core fucose residue. Based on this structure, we designed X0 fusion constructs that disrupt pathogenic afucosylated IgG1-FcγRIIIa interactions and rescue mice in a model of dengue virus infection.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2024

Thermal Fluid Modeling Approaches in SAM for High Temperature Gas-Cooled Reactor Applications

This paper provides an overview of the unique modeling and simulation challenges and needs in the system and safety analysis of two common types of High Temperature Gas-cooled Reactor (HTGR) designs. The challenges are associated with the complex core geometry configurations and the change of the dominant heat removal mechanisms between normal operating conditions and decay heat removal transients. This requires that simulation tools utilize models with reasonable length scales and capture both the localized heat transfer and the core-scale heat transfer at the same time. To meet such analysis needs, different methodologies were developed. In conclusion, this includes adopting existing methods and further developing/improving them, as well as proposing innovative methods that leverage advanced computational frameworks such as the Multiphysics Object Oriented Simulation Environment (MOOSE).

HTGR↗

DOE OSTI2022

Global gyrokinetic simulations of ASDEX Upgrade up to the transport timescale with GENE–Tango

An accurate description of turbulence up to the transport timescale is essential for predicting core plasma profiles and enabling reliable calculations for designing advanced scenarios and future devices. Here, we exploit the gap separation between turbulence and transport timescales and couple the global gyrokinetic code GENE to the transport-solver Tango, including kinetic electrons, collisions, realistic geometries, toroidal rotation and electromagnetic effects for the first time. This approach overcomes gyrokinetic codes' limitations and enables high-fidelity profile calculations in experimentally relevant plasma conditions, significantly reducing the computational cost. We present numerical results of GENE–Tango for two ASDEX Upgrade discharges, one of which exhibits a pronounced peaking of the ion temperature profile not reproduced by TGLF–ASTRA. We show that GENE–Tango can correctly capture the ion temperature peaking observed in the experiment. By retaining different physical effects in the GENE simulations, e.g., collisions, toroidal rotation and electromagnetic effects, we show that the ion temperature profile's peaking can be linked to electromagnetic effects of submarginal (stable) KBM modes. Furthermore, based on these results, the expected GENE–Tango speedup for the ITER standard scenario is larger than two orders of magnitude compared to a single gyrokinetic simulation up to the transport timescale, possibly making first-principles ITER simulations feasible on current computing resources.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2021

MODELING AND TESTING OF A NOVEL ULTRA-LOW TEMPERATURE SCO2 OPPOSING PISTON EXPANDER

The Flameless Pressurized Oxy-Combustion (FPO) cycle, a novel flexible fuel technology, is being developed into a large pilot. This effort seeks to complete the preliminary engineering and planning of a 25 MWth Pilot Plant that will demonstrate the technology for scale-up to a commercial unit. The technology, pioneered by ITEA at the 5 MWth scale, must be brought to a higher technology readiness level (TRL) to be viable at the commercial scale. The 25 MWth pilot cycle was optimized for cost and technology development and demonstration. Preliminary drawings, layouts, and plans were defined. Process flow diagrams were used to describe the pilot configuration in greater detail. A heat and mass balance with stream data was created. A master equipment list specified the operating conditions for major pieces of equipment within the pilot using this heat and mass balance. The 25 MWth FPO pilot is assessed for environmental performance. A test campaign is developed to assess the type of test and number of hours required for pilot demonstration. The environmental performance is compared against projected performance at the commercial scale. This project builds upon extensive evaluation of the techno-economic performance of the FPO technology already performed by ITEA. This includes system improvements, such as the addition of a turbo-expander to the flue gas stream. Some of the performance-enhancing components are not as well defined as others. The primary goal of this effort was to bring all of the core cycle components to the same level of design maturity. A techno-economic assessment (TEA) evaluated the FPO technology at the commercial scale in comparison to the NETL baseline cases. The reference plants were used in combination with proprietary equipment estimates to build a plant capital cost and cost of electricity evaluation. FPO performed better than the sub-bituminous post-combustion capture cases. Further preliminary estimates of improvements to the FPO cycle show even further gains when compared to conventional carbon capture methods.

01 COAL, LIGNITE, AND PEAT↗

DOE OSTI2020

Parameter Optimization Toolbox for NS-3 network optimization, NS-3 Parameter Optimization Framework [SWR-18-60]

This simulation-based parameter optimization framework is proposed to tune parameters of different types of communication networks using ns-3 to achieve the optimal network performance. It consists of three main components: an ns-3 packet reporting module; a sampler running simulations with all possible parameter sets for the input parameter variables by using a parallel executor at each generation; and a hybrid optimization algorithm for tuning configurable parameters of hybrid designs and application parameter variables. The proposed hybrid metaheuristic optimization algorithm combines an evolutionary algorithm with a gradient descent function to quickly achieve an approximate globally optimum solution. This software is designed to be used in a multi-core processing Linux environment and run over a long duration of time. The execution time varies depending mainly upon the nature of the ns-3 configuration being simulated. This software includes a custom ns-3 QoS measurement application which must be included with the ns-3 source code during installation of the software.

Hasandka, Adarsh↗

DOE OSTI2021

High Flux Isotope Reactor Low-Enriched Uranium Low Density Silicide Fuel Design Parameters

High Flux Isotope Reactor (HFIR) highly enriched uranium (HEU) to low-enriched uranium (LEU) conversion activities are ongoing as part of the Department of Energy (DOE) National Nuclear Security Administration (NNSA)’s nuclear nonproliferation mission. Design activities studying the conversion of HFIR from HEU to LEU fuel explored different fuel design features and shapes with a low density uranium-silicide dispersion (U 3 Si 2 -Al) fuel, which has a uranium density of 4.8 gU/cm 3 . The goal of these studies is to generate several HFIR LEU fuel designs of varying fuel fabrication complexity that meet the current HEU performance metrics and safety requirements. The documented designs will serve as references for fuel fabrication and qualification activities. Recent advancements in modeling and simulation tools enable quick prototyping of fuel designs. Shift, a Monte Carlo neutron transport and depletion tool optimized for high-performance computing (HPC) architectures, is used for efficient fuel cycle and performance metrics calculations. The HFIR Steady State Heat Transfer Code (HSSHTC) is used to vet the thermal safety margin. Also, a new automation tool that connects all fuel design analysis steps, named Python HFIR Analysis and Measurement Engine (PHAME), has been developed to expedite the design study in an efficient and reproducible manner. Leveraging these tools, several candidate fuel designs were selected for varying fabrication complexity. This report provides design feature details for four selected HFIR LEU low density U 3 Si 2 -Al fuel designs and their corresponding performance and safety metrics. Nominal, best-estimate design parameters and irradiation conditions, including fission rate densities, power densities, heat fluxes, and cumulative fission densities are provided for candidate fuel designs relevant to framing irradiation experiments to support fuel qualification efforts. Simulations show that the low density U 3 Si 2 -Al, with design features to enhance safety, can meet HEU core performance metrics and safety requirements if the reactor power is increased from 85 MW (HEU) to 95 MW (LEU) and if the active fuel length is increased from 50.80 cm (HEU) to 55.88 cm (LEU).

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗

DOE OSTI2021

DEVELOPMENT OF A 25 MWTH FLAMELESS PRESSURIZED OXY-COMBUSTION PILOT

The Flameless Pressurized Oxy-Combustion (FPO) cycle, a novel flexible fuel technology, is being developed into a large pilot. This effort seeks to complete the preliminary engineering and planning of a 25 MWth Pilot Plant that will demonstrate the technology for scale-up to a commercial unit. The technology, pioneered by ITEA at the 5 MWth scale, must be brought to a higher technology readiness level (TRL) to be viable at the commercial scale. The 25 MWth pilot cycle was optimized for cost and technology development and demonstration. Preliminary drawings, layouts, and plans were defined. Process flow diagrams were used to describe the pilot configuration in greater detail. A heat and mass balance with stream data was created. A master equipment list specified the operating conditions for major pieces of equipment within the pilot using this heat and mass balance. The 25 MWth FPO pilot is assessed for environmental performance. A test campaign is developed to assess the type of test and number of hours required for pilot demonstration. The environmental performance is compared against projected performance at the commercial scale. This project builds upon extensive evaluation of the techno-economic performance of the FPO technology already performed by ITEA. This includes system improvements, such as the addition of a turbo-expander to the flue gas stream. Some of the performance-enhancing components are not as well defined as others. The primary goal of this effort was to bring all of the core cycle components to the same level of design maturity. A techno-economic assessment (TEA) evaluated the FPO technology at the commercial scale in comparison to the NETL baseline cases. The reference plants were used in combination with proprietary equipment estimates to build a plant capital cost and cost of electricity evaluation. FPO performed better than the sub-bituminous post-combustion capture cases. Further preliminary estimates of improvements to the FPO cycle show even further gains when compared to conventional carbon capture methods.

20 FOSSIL-FUELED POWER PLANTS↗

DOE OSTI2024

Safety Analysis of Chromium-Coated Accident-Tolerant Fuels with Increased Enrichment and Extended Burnup [Slides]

This report documents research and development conducted in support of deployment of accident-tolerant fuels. Specifically, the performance of chromium coating during a beyond design basis accident was investigated. An 18m reference core was considered, and the performance of cases with and without chromium coating compared. An extended cycle length of 24m was then considered with the chromium coating, to determine if the benefit of using the chromium coating was more or less significant than the increased fission product inventory when considering fission product release. The chromium coating model utilized here is a preliminary implementation and further work is recommended on a more detailed model.

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗

DOE OSTI2024

The Austin Chalk/Eagle Ford Field Laboratory (ACEFFL)

This project, led by Texas A&M University, developed a science-based field laboratory in the Austin Chalk/Eagle Ford Shale Formation to determine the stimulated reservoir volume created by the fracturing of multiple wells. Utilizing newly developed monitoring solutions, the team delivered comprehensive high-quality field data on the extent and morphologies of productive fractures created from these wells. Advanced field monitoring was complemented by laboratory testing on cores and drill cuttings, and coupled modeling for design, prediction, calibration, and code validation. The Austin Chalk/Eagle Ford Field Laboratory (ACEFFL) was hosted by SM Energy, which provided access to the wells of opportunity.

02 PETROLEUM↗

DOE OSTI2022

Management of the Three Mile Island Unit 2 Accident Corium and Severely Damaged Fuel Debris (Rev. 2)

The Three Mile Island, Unit Two (TMI-2) pressurized water reactor core underwent a significant meltdown in 1979 due to an untimely combination of maintenance problems that led to a loss of feedwater, followed by a series of operational misunderstandings and errors. Primary coolant discharging through a malfunctioning valve represented what was analyzed as a “small-break” loss-of-coolant accident (LOCA) and ultimately became a full core meltdown. The melted core recovery process required the development of a wide array of tools. After approximately three years of water management and other cleanup actions, the first views of the core revealed a much higher degree of damage than previously expected. Approximately 62 metric tons of the core had melted, leaving only 42 of the 177 fuel assemblies standing with fuel rods intact. The core to be recovered was composed of loose, gravel-like and granular particulate material and a central solidified mass of formerly molten fuel. Molten fuel had also penetrated some of the pressure vessel internals and resolidified below the main core support structure. Robotic tools that had been designed for the task were of limited effectiveness due to the range of material types and phases.

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗

DOE OSTI2022

Management of the Three Mile Island Unit 2 Accident Corium and Severely Damaged Fuel Debris (Rev. 2)

The Three Mile Island, Unit Two (TMI-2) pressurized water reactor core underwent a significant meltdown in 1979 due to an untimely combination of maintenance problems that led to a loss of feedwater, followed by a series of operational misunderstandings and errors. Primary coolant discharging through a malfunctioning valve represented what was analyzed as a “small-break” loss-of-coolant accident (LOCA) and ultimately became a full core meltdown. The melted core recovery process required the development of a wide array of tools. After approximately three years of water management and other cleanup actions, the first views of the core revealed a much higher degree of damage than previously expected. Approximately 62 metric tons of the core had melted, leaving only 42 of the 177 fuel assemblies standing with fuel rods intact. The core to be recovered was composed of loose, gravel-like and granular particulate material and a central solidified mass of formerly molten fuel. Molten fuel had also penetrated some of the pressure vessel internals and resolidified below the main core support structure. Robotic tools that had been designed for the task were of limited effectiveness due to the range of material types and phases.

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗

DOE OSTI2023

Monte Carlo Analyses of the FOEHN Experiment

The FOEHN critical experiment, which has been carried out at Cadarache (France) in the reactor EOLE in the early 70s, was designed to verify RHF design analyses. This study focuses on the impact of the FOEHN experiment uncertainties on the calculation of the energy deposition. The latter has been obtained by the Monte Carlo codes Serpent and MCNP. In the calculation of the energy deposition, the first code relies on KERMA factors whereas the latter code relies on Q-values. The two Monte Carlo codes share the same geometry and material specifications. In addition to the design and experiment parameters uncertainties, nuclear data also impacts the calculation of the energy deposition. In this study, the MCNP simulations use three different nuclear data library sets: ENDF/B versions VII.0, VII.1, and VIII.0. Finally, the ksens card of MCNP, using perturbation theory, has been used to identify the cross sections and isotopes with largest impact on the effective multiplication factor. By showing that the use of different software and computational methodologies and design parameters uncertainties do not significantly impact the core power distribution, this work demonstrate the appropriateness of the tools and methods employed for the conversion of involute-plate reactors.

73 NUCLEAR PHYSICS AND RADIATION PHYSICS↗

DOE OSTI2026

Automated and Accelerated Continuum Model Development for Electrochemical Systems (Abbreviated Report)

Despite the availability of computational resources and advancements in numerical computing capabilities, the multiscale models core to understanding, predicting the behaviors of, and designing energy and environmental systems involving porous media are still 1.) developed through by-hand derivations and 2.) limited by many methodological assumptions employed during model derivation. As a result, the advancement of effective media models for engineering DOE mission-critical systems (e.g., batteries, flow batteries, electrolyzers, geothermal systems, subsurface chemical storage systems, etc.) is slow (i.e., it takes years for models to traverse from stages of “development” to “practical utilization”), hindering our ability to effectively optimize such systems and stay at the cutting-edge of the energy frontier. In this work, we aimed to address these limitations by 1.) automating and accelerating multiscale model derivation via symbolic computing and 2.) develop a novel multiscale modeling methodology for flow and transport through porous media that avoids the typical assumptions hindering previous models. As a result of our efforts, we 1.) developed a hybrid symbolic-numeric code called Fouriera for fully-automating the implementation of multiphysical and phase-field models via the Fourier spectral method for materials science research, and 2.) advanced a multiscale modeling methodology called The Method of Finite Averages that rigorously predicts the behaviors of flow and transport through heterogeneous porous media under the influence of non-local effects and strong advection. Ultimately, these deliverables provide strong foundations from which further efforts can advance multiscale modeling tools and capabilities that do not intrinsically rely on 1.) the speed and mathematical capabilities of humans, nor 2.) the methodological assumptions limiting current models.

36 MATERIALS SCIENCE↗

DOE OSTI2022

FNAL PIP-II Accumulator Ring

The FNAL accelerator complex is poised to reach MW neutrino beams on target for the exploration of the dark sector physics and rare physics program spaces. Future operations of the complex will include CW linac operations at beam intensities that have not been seen before \cite{PIP2,RCS_LOI}. The ambitious beam program relies on multi-turn H$^{-}$ injection into the FNAL Booster and then extracted into delivery rings or the Booster Neutrino Beam (BNB) 8 GeV HEP program. A new rapid-cycling synchrotron (RCS) will be required to reach the LBNF goal of 2.4 MW because of intense space-charge limitations. There are many accelerator engineering challenges that are already known and many that will be discovered. This proposal calls for an intermediate step that will both facilitate the operation of Booster in the PIP-II era and gain operational experience associated with high power injection rings. This step includes the design, construction and installation of a 0.8 GeV accumulator ring (upgradeable to 1+ GeV) to be located in the PIP-II Booster Transfer Line (BTL). The PIP-II accumulator ring (PAR) may be primarily designed around permanent magnets or use standard iron core magnet technology with an aperture selected to accommodate the desired high intensity protons at 0.8 GeV.

43 PARTICLE ACCELERATORS↗

DOE OSTI2022

Alabama A&M University Senior Project

This entry is being conducted in order to review documents (drawings and pictures) necessary for senior students of Alabama A&M to conduct their senior project. This project will include helping design an upgraded operating system for the TREAT core clamping units.

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗

DOE OSTI2023

Alabama A&M University Senior Project Cont'd

This entry is being conducted in order to review documents (drawings and pictures) necessary for senior students of Alabama A&M to conduct their senior project. This project will include helping design an upgraded operating system for the TREAT core clamping units. A previous has been completed for the project per STI # INL/MIS-22-69603 Rev:000, these additional items will further assist the students in there work.

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗

DOE OSTI2023

FY23 Status Report on MOOSE-Based Approaches to Modeling Core Bowing in Fast Reactors

Under the U.S. Department of Energy Office of Nuclear Energy’s Advanced Modeling and Simulation (NEAMS) Program, an integrated multiphysics approach is being developed to model the core bowing phenomena important to liquid metal-cooled fast reactors. Core bowing is an important passive safety mechanism whereby increased power (which leads to temperature and flux gradients) influences the core to bow into less reactive configurations when the restraint system is properly designed. The phenomenon includes a complex interplay of radiation transport, duct temperature calculations involving fluid flow and heat transfer, and thermo-mechanical responses to the induced temperature and flux gradients. Structural material properties are also important to determining inelastic response to longer term flux gradients which cause irradiation creep and swelling. While core bowing provides a strong negative reactivity feedback when the restraint system is designed properly, it also results in additional forces between assemblies which increase the loads required to extricate them during refueling or control rod movement. Therefore, the restraint system must be designed with these tradeoffs in mind. The first stage of the work, which commenced in FY21 and continues through FY23, assesses thermo-mechanical modeling tools for producing core bowing predictions consistent with conventional tools. The Multiphysics Object Oriented Simulation Environment (MOOSE) Tensor Mechanics and Contact Modules are employed. This status report describes work on additional thermo-mechanical benchmark verification problems with increased complexity from the examples demonstrated in FY21 and FY22. Several benchmark verification examples were selected from the IAEA verification and validation report with increased number of ducts and more complex contact interaction behavior. These examples involve a full symmetric sector with restraint rings at multiple load pad locations to simulate a limited free-bow restraint system concept, as well as irradiation induced swelling and creep effects in a sector. In addition, improvements to the contact module sideset assignment were assessed and compared with previous MOOSE results to verify the contact behavior. The MOOSE-based results were compared to IAEA benchmark participants’ results. In every case, the MOOSE results agreed with other simulations results for estimating bowing behavior, providing additional verification basis of the tools for this particular physics application. Estimation of contact forces were mostly in agreement, with a few outlier results. A plan was suggested for dealing with the discrepancies with estimating contact force values. In addition, a 1-way coupling demonstration was performed using subchannel analysis code Pronghorn-SC and MOOSE on an ABR-1000-design sodium-cooled fast reactor assembly to evaluate coolant and duct wall temperatures.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗