Search NASA⌕ Search

SEARCH · Search NASA

Results for “CONTROL ELEMENTS”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 523 records · Page 29
All sourcesNASA NTRSDOE OSTI
DOE OSTI2020

Flue Gas Desulfurization Wastewater Composition and Implications for Regulatory and Treatment Train Design

The U.S. Environmental Protection Agency is currently revising its regulations on trace element discharges from flue gas desulfurization (FGD) wastewater.<br>In this work, we expand a predictive model of trace element behavior at coal-fired power plants (CFPPs) to estimate the trace element concentration of FGD wastewater at the plant level. We demonstrate that variation in trace element concentrations in FGD wastewater can span several orders of magnitude and is a function of both coal rank and installed air pollution control devices. This conclusion suggests that the benefits and costs of FGD wastewater treatment for the median plant will poorly describe the actual benefits and costs over the full range of existing CFPPs.

Mauter, Meagan↗
DOE OSTI2021

Large aperture and durable glass-engraved optical metasurfaces using nanoparticle etching masks: prospects and future directions

Abstract Metasurfaces (MSs), or surfaces consisting of engineered spatially oriented sub-wavelength elements—also known as meta-atoms—are quickly becoming a burgeoning field of interest due to their seemingly unparalleled control over the propagation of light. This article will discuss the emergence of a MS technology that is based on dewetting thin metal films to form dry etching masks for MS fabrication. The novelty this process presents is the ability to spatially vary mask features—which translates into spatially varying index of the finished surface—in a way that, rather than writing subwavelength elements one-by-one, writes entire areas at once to provide a route to easily scale the process up to meter-sized optics. Glass-engraved MSs have shown to be laser damage resistant, with damage thresholds close to the parent substrate damage thresholds. Furthermore, these surfaces have proven to be mechanically durable and capable of handling normal loads two orders of magnitude higher than that of an average fingerprint pressure. This indicates that accidental handling contact is not detrimental to the MS optical performance. Also discussed are the foreseeable technological challenges, potential solutions for those obstacles, and some currently unexplored directions for future efforts.

47 OTHER INSTRUMENTATION↗
DOE OSTI2022

Compact automated apparatus for rapid astatine recovery from nitric acid media: Design, application, and impurity characterization

We report automation of irradiated bismuth target dissolution and astatine recovery from nitric acid media has been achieved at Texas A&M University. This process can be controlled remotely; it does not require any chemical treatment or evaporation of dissolution solution prior to the separation of above-mentioned elements on an extraction chromatography column, making the final product ready within 20 min. The accompanying radio-impurities have been identified and successfully separated from astatine, leading to greater than 99% radiopurity of the desired fractions. The system consists of only one pump and a set of LabVIEW controlled valves, and allows the connection of up to 10 different columns, providing the opportunity to prepare a variety of air dry columns, which can be different column geometries, containing astatine ready for further chemistry or shipment to desired facilities.

42 ENGINEERING↗
DOE OSTI2023

Rapid AI-based Dissection of Ashes using Raman and XRF Spectroscopy (RADAR-X)

Waste-to-energy (WTE) facilities incinerate ~35 million tons of municipal solid waste annually in the United States. The incineration process reduces the mass and the volume of the waste fraction by over 75 and 95%, respectively. The fraction left after incineration remains as ash residues and is referred to as WTE ash, compromising of bottom and fly ash. In the United States, ~10 million tons of WTE ashes are generated annually and predominantly landfilled because of the lack of secondary end-use pathways. This incurs a significant financial burden (landfilling costs) on U.S. WTE facilities and also results in the loss of materials to the landfill. The primary objective of this research is to understand better the elemental and mineralogical composition of WTE ashes from diverse origins and find composition dependent upcycling pathways for diverting these ashes from landfills. This primary objective was addressed through three research tasks –(Task I) An AI-led Multi-Modal Approach for Compositional Analysis, (Task II) Developing a Dissolution-Based Test for Real Time Analysis, and (Task III) Establishing composition-dependent end uses. The chemical composition of WTE ash is dependent on two factors, i.e., the input waste composition and the operational parameters of a WTE facility (combustion conditions). Amongst these two factors, the input waste composition will likely show spatial and temporal variation. As a result, the chemical composition of WTE ash will also fluctuate. To understand the spatial and temporal variation in WTE ash composition, in Task I, we collected 128 ash samples (62 bottom ash and 66 fly ash samples) from 11 WTE facilities located in 11 U.S. states and characterized them via X-ray Fluorescence, powder X-ray Diffraction, and Raman Spectroscopy. The findings from this extensive characterization work indicated that the key elements in WTE fly ashes are Ca, Cl (greater than 10 wt. %), Si, S, K, Zn ( between 1 and 10 wt. %), Mg, Al, P, Ti, Fe, Cu, Br, and Pb (between 0.1 and 1 wt. %). Similarly, the key elements in WTE bottom ash fraction finer than 45μm are Ca (greater than 10 wt. %), Mg, Al, Si, S, Cl, K, Ti, Fe, Zn (between 1 and 10 wt. %), P, V, Cr, Mn, Cu, Br, and Pb (between 0.1 and 1 wt. %). Here, we note that the dominant fraction of WTE bottom ash is the coarse fraction. The coarse WTE bottom ash fraction (rich in silicon) was not characterized in this study because of excessive grinding requirements and their unsuitability as a supplementary cementitious material due to their coarse nature. The elements in WTE bottom ashes are present as calcite, anhydrite, vaterite, hydroxyapatite, quartz, bassanite, gehlenite, akermanite, hydrocalumite, and portlandite. Similarly, the mineralogical species present in WTE fly ashes are calcium chloride hydroxide, halite, calcite, anhydrite, sylvite, hydrocalumite, vaterite, hannebachite, quartz, and bassanite. Temporal variation in ash composition may also result in significant fluctuations in chemical compositions. Therefore, a WTE facility may need to monitor the ash composition (elemental and mineralogical composition) in real time. In Task I, we evaluated the possibility of using a portable X-ray fluorescence (XRF) spectrometer to monitor the elemental composition in real-time. Specifically, we collected XRF data on identical specimens via a portable XRF spectrometer (low-end) and a lab-based benchtop XRF spectrometer (high-end). The collected data was used to train an A.I. algorithm (portable XRF data as an input and benchtop XRF data as an output) to predict accurate elemental composition using portable XRF data. Finally, we developed a 2-minute photobleaching protocol to monitor the mineralogical characteristics of WTE ashes via Raman spectroscopy. Overall, the activities in Task I improved our understanding of ash composition and developed techniques to monitor elemental and mineralogical composition in near real-time. Based on the findings of Task I, we find that WTE ashes exhibit wide variability in mineralogy. For ICP-based elemental analysis, all the mineralogical species in WTE ashes must be brought into solution. This is traditionally accomplished with acid digestion using a combination of multiple acids. However, acid digestion with multiple acids is time-consuming and often fails to ensure complete digestion of the ash matrix. To address this limitation, in Task II, we developed an alkali-fusion-based digestion protocol using a combination of lithium tetraborate, lithium metaborate, and their combinations as possible alkali fluxes for digesting WTE ashes entirely and rapidly. The validity of the developed method was evaluated on two standard ash specimens, i.e., SRM 1633c coal fly ash and BCR-176R incineration fly ash specimen. The findings suggest that the developed protocol can ensure complete digestion of elements such as Al, Ba, Ca, Cr, Cu, Mg, Mn, P, Sr, V, Zn, Be, K, and rare earth elements. The recent changes in the energy market towards renewables and increased metal recycling have resulted in reduced supplies of supplementary cementitious materials (coal fly ash and slag). Therefore, in Task III, we evaluated the possibility of employing WTE ashes as SCMs. As the chemical composition of WTE ashes varies temporally (on an hourly basis), there was also a need to develop tests that can evaluate the suitability of material to act as supplementary cementitious material rapidly, i.e., in a few minutes. Therefore, in Task II, we also developed a rapid test to assess the suitability of a material to act as an SCM in 5 minutes. This represents a significant advance over the state-of-the-art R 3 test, which takes ~144 hours. This test was initially validated on amorphous aluminosilicates, such as calcined clays, and could be extended to evaluate other industrial by-products, such as WTE ashes. In Task III, we evaluated the possibility of employing WTE ashes for two applications, i.e., as an SCM and a lime substitute for clay stabilization. The findings from Task I indicated that WTE ashes are enriched in chlorine and, therefore, cannot be used directly as an SCM due to corrosion-related risks and altered hydration kinetics. Accordingly, we developed an ash treatment protocol to reduce the solubility of chlorine-containing species in WTE ashes. The developed treatment protocol also immobilized lead in certain mineral forms. As a result of the treatment, WTE ashes can be used as SCMs without any corrosion or heavy metal leaching concerns. The second application examined in this study was clay stabilization. WTE ashes are calcium-rich and can be an adequate lime replacement for clay stabilization. Our findings reveal that the sum of the concentrations of Ca(OH) 2 and CaClOH controls the clay stabilization capability of WTE ashes. In summary, in this work, we evaluated the elemental and mineralogical characteristics of U.S. WTE ashes from diverse origins and developed tests to evaluate the chemical characteristics of these ashes in real time through a portable XRF and a benchtop Raman spectrometer. Based on the chemical characteristics of these ashes, we developed an ash treatment process to enable the use of WTE ashes as an SCM and also evaluated the possibility of employing these ashes for clay stabilization. Overall, the findings from this work enables the diversion of WTE ashes from landfills for multiple end-uses, i.e., as an SCM or a lime substitute for clay stabilization.

36 MATERIALS SCIENCE↗
DOE OSTI2026

Size dependent lattice pseudosymmetry for frustrated decahedral nanoparticles

Geometric frustration—where geometry prevents simultaneous satisfaction of local interactions—generates pseudosymmetry and emergent behaviors across physical and biological systems. At the nanoscale, pseudosymmetric features in crystalline materials manifest as local strain and distortion, but how they depend on particle size and control structural stability remains unclear. Here, we report the first study of a size-dependent crossover in pseudosymmetry in multi-twinned gold nanoparticles (NPs), combining four-dimensional scanning transmission electron microscopy with nanoscale strain mapping grounded in continuum solid mechanics. Analysis of more than 20 decahedral NPs (20–55 nm) reveals pronounced heterogeneity in multiple modes of in-plane strain and displacement field in small NPs as five tetrahedral grains close the geometric gap, without extended defects. With increasing particle size, strain fields homogenize across grains and local phases shift from predominantly low-symmetry body-centered tetragonal motifs at small sizes to face-centered cubic character approaching the bulk limit. We identify a crossover particle size of ~35 nm, well below bulk, correlating with a transition from modified-Wulff shapes to pentagonal bipyramids, consistent with finite element predictions. This quantitative framework for mapping size-dependent strain and pseudosymmetry enables precise design and control of functional crystalline solids and phase transformation for catalysis, photonics, electronics, and energy storage.

Lin, Oliver [University of Illinois at Urbana-Cham↗
DOE OSTI2021

Specification of EBR-II Laser Profilometry Data

All laser profilometry data stored in FIPD were originally measured using the element laser profilometer system in HFEF/N. The irradiated fuel elements or pins were scanned by a laser beam to measure the outer diameter with position mapping of the spacer wire. The normal operation and data collection were performed automatically with HFEF/N Data Acquisition and Process Control System (DAPCS). With the digital control system, measured laser profilometry data were recorded in digital form on magnetic tapes, different from the analog contact profilometry data recorded by strip-chart record sheets. Two documents contained most of the important details about laser profilometry measurements. The first one is the operational manual of the laser profilometer (title: Element laser profilometer (ELP) operation and maintenance manual, HFEF/N OMM 4329, DOC. NO. W0171-0149-ES-01). This manual provides: (1) description of laser profilometer including the functions of each component (transceiver, retroreflector, clamping guide, shielding enclosure, electronic controller, etc.); (2) step-by-step guidance for calibrations, operations and measurements; and (3) maintenance procedures and other details of the element laser profilometer. Since first issued on 12/1/1986, several revisions/changes of the manual were developed to update the measurement accuracies and other factors for the laser profilometer system. The second document is a publicly accessible conference article titled “the element laser profilometer system in HFEF/N.” This article summarizes important functions and parameters of the laser profilometer. The range of measurements and the uncertainties reported in the article were consistent with the values reported in the operational manual.

42 ENGINEERING↗
DOE OSTI2020

Viscometric flow of dense granular materials under controlled pressure and shear stress

This study examines the flow of dense granular materials under external shear stress and pressure using discrete element method simulations. In this method, the material is allowed to strain along all periodic directions and adapt its solid volume fraction in response to an imbalance between the internal state of stress and the external applied stress. By systematically varying the external shear stress and pressure, the steady rheological response is simulated for: (1) rate-independent quasi-static flow; and (2) rate-dependent inertial flow. The simulated flow is viscometric with non-negligible first and second normal stress differences. While both normal stress differences are negative in inertial flows, the first normal stress difference switches from negative to slightly positive, and second normal stress difference tends to zero in quasi-static flows. The first normal stress difference emerges from a lack of coaxiality between a second-rank contact fabric tensor and strain rate tensor in the flow plane, while the second normal stress difference is linked to an excess of contacts in the shear plane compared with the vorticity direction. A general rheological model of second order (in terms of strain rate tensor) is proposed to describe the two types of flow, and the model is calibrated for various values of interparticle friction from simulations on nearly monodisperse spheres. The model incorporates normal stress differences in both regimes of flow and provides a complete viscometric description of steady dense granular flows.

42 ENGINEERING↗
DOE OSTI2021

Surface equilibration mechanism controls the molecular packing of glassy molecular semiconductors at organic interfaces

Significance Because glasses are nonequilibrium materials, even a single-component system has an enormous number of distinct glass structures. Physical vapor deposition (PVD) is an important tool for preparing a wide range of these glasses. While the substrate can influence structure for hundreds of nanometers for crystalline and liquid crystalline systems, little is known about the structure of PVD glasses near an underlying substrate. This is important for organic electronics, as layers of PVD glasses as thin as 10 nm are used as active elements in organic light-emitting diodes, and molecular packing is vital to performance. We show that the free surface controls molecular packing of PVD glasses near a buried interface rather than the substrate, in sharp contrast with crystalline systems.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

CMPO-Functionalized Silica Sorbents for pH-Tunable Separation and Enrichment of Rare-Earth Elements from Environmental Matrices

Rare-earth elements (REEs) are crucial in many applications, yet mutual separation is challenging due to their similar chemical behavior. Octylphenyl- N,N-diisobutyl carbamoyl methyl phosphine oxide (CMPO) is an organophosphorus ligand originally developed for extracting actinides and lanthanides from spent nuclear fuel. Here, we report a pH-tunable CMPOfunctionalized silica sorbent for selective REE separation from complex aqueous matrices. A CMPO-associated silica gel sorbent was synthesized and characterized by Brunauer−Emmett−Teller (BET) surface area, scanning electron microscopy, and X-ray photoelectron spectroscopy to confirm the surface functionalization and binding behavior. Sorbent performance was evaluated by using a synthetic 46- element solution and a real phosphate rock fertilizer leachate. Notably, REEs were successfully eluted with ultrapure water, demonstrating reversible desorption controlled by pH adjustment. Packed-bed column studies increased the REE mass fraction from 3.6% to 64% (20-fold enrichment), with up to 30-fold enrichment of neodymium. The adsorption process follows the Langmuir isotherm behavior and follows pseudo-second-order kinetics. The uptake capacity of 1 μmol of REEs per 4.2 μmol of CMPO supports the formation of a predominantly 4:1 ligand:rare earth element(III) pseudocomplex. These results demonstrate CMPO-functionalized silica as a selective, water-elutable, and low-chemical-input platform for sustainable REE recovery from environmental and industrial sources.

chelating ligands↗
DOE OSTI2021

Supplemental dietary full-fatted and defatted Desmodesmus sp. exerted similar effects on growth performance, gut health, and excreta hydrothermal liquefaction of broiler chicks

This study determined effects of full-fatted (C046, 41% crude protein) and lipid extracted (LEA, 39% crude protein) microalgae Desmodesmus sp. on growth performance, gut health, and excreta hydrothermal liquefaction of broiler chickens. Two experiments were conducted by feeding day-old Cornish male chicks: 1) a corn-soybean meal basal diet (control) 2) control +5% C046, or 3) control +5% LEA for 2 weeks. Growth performance was measured weekly in both experiments. Blood, liver, and duodenum samples of chickens were collected for biochemical analyses, and excreta samples were collected for hydrothermal liquefaction (300 °C, 60 min) at the end of Experiment 2. Compared with the control, supplemental dietary C046 and LEA enhanced average daily gain (13% to 40%, p < 0.05) in both experiments, and improved feed efficiency (15% and 11%, p < 0.01) in Experiment 2. The C046 and LEA diets enhanced the duodenum (19% to –2 fold, p < 0.05), but decreased the liver (17 to 78%, p < 0.05) mRNA abundances of interleukins-1, 6 and 8 and (or) tumor necrosis factor-α, respectively, compared with the controls. Meanwhile, the two types of biomass enhanced the protein amounts of claudin-1 in the duodenum (5–34%, p < 0.05) than the controls. Hydrothermal liquefaction of the excreta derived from the three diets showed no major differences in total bio-crude oil (average of 23%), hydrochar yield (average of 12%), or elemental compositions. However, the heating values of the resultant two bio-crude oils from the microalgae-fed chicken excreta (average of 34 MJ/kg) were 16% greater than those from the control chickens (29 MJ/kg). In conclusion, supplementing the full- and de-fatted Desmodesmus sp. microalgal biomass in the starter diets for broiler chickens produced largely similar improvements of growth performance, gut health, and excreta-derived oil quality.

09 BIOMASS FUELS↗
DOE OSTI2026

MassIVE MSV000100641 - Multilayered regulation by RNA thermometers enables precise control of Cas9 expression in E. coli: Cas9-based genome editing technologies can rapidly generate mutations to probe a diverse array of mutant genotypes. However, aberrant Cas9 nuclease translation and activity can occur despite the use of inducible promoters to control expression, leading to extensive cell death. This background killing caused by promoter leakiness severely limits the application of Cas9 for generating mutant libraries because of the potential for population skew. We demonstrate the utility of temperature sensitive RNA elements as a layer of post-transcriptional regulation to reduce the impact of promoter leak. We observe significant temperature-dependent increases in cell survival when certain RNA thermometers (RNATs) are placed upstream of the cas9 coding sequence. We also show that the most highly repressing RNAT, hsp17rep, significantly reduces population skew with a library of characterized guide RNAs in Escherichia coli. This strategy should be applicable to all bacterial Cas9-based methods and technologies.

Explore the source record for details and available documents.

Alexander, William G. [Oak Ridge National Laborato↗
DOE OSTI2025

Isothermal solidification for high-entropy alloy synthesis

Kinetically trapping the high-temperature states through rapid cooling solidification is widely used for the synthesis of high-entropy alloys (HEAs), especially those with intrinsically immiscible elemental combinations. However, strategies need to be developed to overcome the fundamental limitations of rapid cooling solidification in controlling the crystallinity, structure and morphology of HEAs. Here, in this study, we introduce an isothermal solidification strategy for the synthesis of HEAs by rapidly altering the metal alloy composition through liquid–liquid interface reactions at low temperatures, for example, from 25 °C to 80 °C. We use gallium (Ga)-based metal as the sacrificial reagent and mixing medium. By directing the reactions to the interfaces between the Ga-based liquid metal and an aqueous metal ion solution, the foreign metal ions can be reduced at the interfaces and incorporated into the liquid metal quickly. HEAs with various crystallinity (single crystal, mesocrystal, polycrystal and amorphous), morphology (zero, two and three dimensions) and compositions can be achieved through the isothermal solidification. Ga can be completely consumed, resulting in Ga-free HEAs. If desired, Ga can be one of the metal elements in the final products. In situ liquid phase transmission electron microscopy (TEM) studies and theoretical analysis show the isothermal solidification mechanisms. Our direct observations show the enhanced mixing of liquid metal elements and the solidification process with fluctuating nucleation dynamics. The isothermal solidification marks a powerful strategy for HEA synthesis through an unexplored pathway of kinetically trapping the high-entropy states.

Zhang, Qiubo [Lawrence Berkeley National Laborator↗
DOE OSTI2020

Optimization-based, property-preserving finite element methods for scalar advection equations and their connection to Algebraic Flux Correction

In this paper, we continue our efforts to exploit optimization and control ideas as a common foundation for the development of property-preserving numerical methods. Here we focus on a class of scalar advection equations whose solutions have fixed mass in a given Eulerian region and constant bounds in any Lagrangian volume. Our approach separates discretization of the equations from the preservation of their solution properties by treating the latter as optimization constraints. This relieves the discretization process from having to comply with additional restrictions and makes stability and accuracy the sole considerations in its design. A property-preserving solution is then sought as a state that minimizes the distance to an optimally accurate but not property-preserving target solution computed by the scheme, subject to constraints enforcing discrete proxies of the desired properties. Furthermore, we consider two such formulations in which the optimization variables are given by the nodal solution values and suitably defined nodal fluxes, respectively. A key result of the paper reveals that a standard Algebraic Flux Correction (AFC) scheme is a modified version of the second formulation obtained by shrinking its feasible set to a hypercube. In conclusion, we present numerical studies illustrating the optimization-based formulations and comparing them with AFC

97 MATHEMATICS AND COMPUTING↗
DOE OSTI2026

Facet Preferencing by Chemical Substitution Controls Semi-Hydrogenation Selectivity in Ternary Pyrite-Type Intermetallic Compounds

Intermetallic compounds serve as model catalysts for selective hydrogenation reactions, offering precise control over the active site composition(s), geometric and electronic structure. The addition of a third element to form a ternary intermetallic alters the exposed crystal facet(s), demonstrating a strategy to impart improved catalytic behavior in intermetallic catalysts. The site-specific substitution of a small fraction of Pd atoms with Au in pyrite-type PdSb 2 results in the preferential exposure of the (100) facet over the (111) facet. Electron back scattered diffraction and density functional theory calculations confirm the facet change upon the substitution of Pd with Au to form the ternary Pd 1−x Au x Sb 2 (0.075 ≤ x ≤ 0.25). The (100) facet demonstrates higher net alkene selectivity due to significantly weaker alkene binding compared to the (111) facet. Distinct from our prior work on chemical substitution to directly alter the active site composition, this work demonstrates the indirect modification of active sites via preferential facet exposure.

32 ENERGY CONSERVATION, CONSUMPTION, AND UTILIZATI↗
DOE OSTI2020

Molecular characterization of a fungal gasdermin-like protein

Programmed cell death (PCD) in filamentous fungi prevents cytoplasmic mixing following fusion between conspecific genetically distinct individuals (allorecognition) and serves as a defense mechanism against mycoparasitism, genome exploitation, and deleterious cytoplasmic elements (i.e., senescence plasmids). Recently, we identified regulator of cell death-1 ( rcd-1 ), a gene controlling PCD in germinated asexual spores in the filamentous fungus Neurospora crassa . rcd-1 alleles are highly polymorphic and fall into two haplogroups in N. crassa populations. Coexpression of alleles from the two haplogroups, rcd-1–1 and rcd-1–2 , is necessary and sufficient to trigger a cell death reaction. Here, we investigated the molecular bases of rcd-1 -dependent cell death. Based on in silico analyses, we found that RCD-1 is a remote homolog of the N-terminal pore-forming domain of gasdermin, the executioner protein of a highly inflammatory cell death reaction termed pyroptosis, which plays a key role in mammalian innate immunity. We show that RCD-1 localizes to the cell periphery and that cellular localization of RCD-1 was correlated with conserved positively charged residues on predicted amphipathic α-helices, as shown for murine gasdermin-D. Similar to gasdermin, RCD-1 binds acidic phospholipids in vitro, notably, cardiolipin and phosphatidylserine, and interacts with liposomes containing such lipids. The RCD-1 incompatibility system was reconstituted in human 293T cells, where coexpression of incompatible rcd-1–1/rcd-1–2 alleles triggered pyroptotic-like cell death. Oligomers of RCD-1 were associated with the cell death reaction, further supporting the evolutionary relationship between gasdermin and rcd-1 . This report documents an ancient transkingdom relationship of cell death execution modules involved in organismal defense.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Thermal performance sensitivity to radial power flattening considerations in Nuclear Thermal Propulsion Reactors

Nuclear thermal propulsion is currently being developed for manned Mars and Lunar missions by the National Aeronautics and Space Administration due to its increased specific impulse and significant thrust to reduce the total trip time and cost of deep space missions. To maximize the performance of the engine the exit hydrogen propellant temperature should, ideally, be uniformly distributed among all the fuel elements. Uniform exit temperatures imply that the power must be flattened as much as possible. This paper leverages decoupled neutronic and thermal-hydraulic models to assess the thermal performance and reactivity tradeoffs associated with flattening the radial power distribution by adjusting the fuel kernel loading for each fuel element within the core. The results suggest that a uniform radial power distribution for a single control drum position will not necessarily yield an optimal core design due to the higher variance in power and thus maximum fuel and exit propellant temperature as the control drums rotate out during operation. The results presented here only point to the design characteristics be considered when core-level multi-physics simulations are applied in the context of a specific mission. (authors)

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗
DOE OSTI2023

Human Factors for Advanced Reactors

Existing light water reactors in the U.S. are primarily large baseload electricity generating facilities. The concept of operations for these plants remains largely unchanged since the advent of commercial nuclear power—the main control room serves as the hub of plant activities and is staffed with multiple licensed operators who work in tandem under the shift supervisor, and staff such as field workers support the control room remotely. While newer plants have brought the advent of digital human-machine interfaces to replace earlier analog and mechanical instrumentation and controls, much of the control process remains unchanged and manual. It is simply a newer version of legacy concepts. Advanced reactors potentially bring considerable changes to the size, fuel type, automation, and staffing of nuclear power plants, necessitating a fundamental shift not just from analog to digital, but further from human to automation, from onsite to remote, from control to monitoring, and from many to few operators. Despite this multitude of parallel evolutions in reactor designs, many of the vendors developing the next generation of reactors represent smaller research and development enterprises. It is therefore not feasible to address all aspects of plant design at the same time. In particular, the competing design aspects of new reactors present a significant challenge to the development of robust and human factored systems at the plant. As vendors develop new reactor designs, much of the early focus is naturally on the fuel and reactor system technology. Looming behind these early advances is the daunting prospect of first-of-a-kind control concepts that have not yet been developed or validated. A failure to address the human element of reactor design early will lead to missed opportunities. The quickest development process is the replication of existing concepts of operations at legacy plants, even when such systems were long ago surpassed by better human-machine technologies outside the nuclear industry. Conversely, attempting to undertake novel concepts of operations late in the design life cycle of a plant could result in protracted development efforts and delays in licensing and deployment. This does not have to happen, and it is imperative that human factors be considered now, early in the design of new reactors.

99 GENERAL AND MISCELLANEOUS↗