Search NASA⌕ Search

SEARCH · Search NASA

Results for “Vascularization”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 523 records · Page 29
All sourcesNASA NTRSDOE OSTI
DOE OSTI2023

Evaluation of quantitative synchrotron radiation micro-X-ray fluorescence in rice grain

Concentrations of nutrients and contaminants in rice grain affect human health, specifically through the localization and chemical form of elements. Methods to spatially quantify the concentration and speciation of elements are needed to protect human health and characterize elemental homeostasis in plants. Here, an evaluation was carried out using quantitative synchrotron radiation microprobe X-ray fluorescence (SR-µXRF) imaging by comparing average rice grain concentrations of As, Cu, K, Mn, P, S and Zn measured with rice grain concentrations from acid digestion and ICP-MS analysis for 50 grain samples. Better agreement was found between the two methods for high-Z elements. Regression fits between the two methods allowed quantitative concentration maps of the measured elements. These maps revealed that most elements were concentrated in the bran, although S and Zn permeated into the endosperm. Arsenic was highest in the ovular vascular trace (OVT), with concentrations approaching 100 mg kg –1 in the OVT of a grain from a rice plant grown in As-contaminated soil. Quantitative SR-µXRF is a useful approach for comparison across multiple studies but requires careful consideration of sample preparation and beamline characteristics.

73 NUCLEAR PHYSICS AND RADIATION PHYSICS↗
DOE OSTI2024

Paternal preconception alcohol consumption increased Angiotensin II‐mediated vasoconstriction in male offspring cerebral arteries via oxidative stress‐AT1R pathway

Abstract Alcohol consumption is popular worldwidely and closely associated with cardiovascular diseases. Influences of paternal preconception alcohol consumption on offspring cerebral arteries are largely unknown. Male rats were randomly given alcohol or water before being mated with alcohol‐naive females to produce alcohol‐ and control‐sired offspring. Middle cerebral artery (MCA) was tested with a Danish Myo Technology wire myograph, patch‐clamp, IONOPTIX, immunofluorescence and quantitative PCR. Alcohol consumption enhanced angiotensin II (AngII)‐mediated constriction in male offspring MCA mainly via AT1R. PD123,319 only augmented AngII‐induced constriction in control offspring. AngII and Bay K8644 induced stronger intracellular calcium transient in vascular smooth muscle cells (VSMCs) from MCA of alcohol offspring. L‐type voltage‐dependent calcium channel (L‐Ca 2+ ) current at baseline and after AngII‐stimulation was higher in VSMCs. Influence of large‐conductance calcium‐activated potassium channel (BK C a ) was lower. Caffeine induced stronger constriction and intracellular calcium release in alcohol offspring. Superoxide anion was higher in alcohol MCA than control. Tempol and thenoyltrifluoroacetone alleviated AngII‐mediated contractions, while inhibition was significantly higher in alcohol group. The mitochondria were swollen in alcohol MCA. Despite lower Kcnma1 and Prkce expression, many genes expressions were higher in alcohol group. Hypoxia induced reactive oxygen species production and increased AT1R expression in control MCA and rat aorta smooth muscle cell line. In conclusion, this study firstly demonstrated paternal preconception alcohol potentiated AngII‐mediated vasoconstriction in offspring MCA via ROS‐AT1R. Alcohol consumption increased intracellular calcium via L‐Ca 2+ channel and endoplasmic reticulum and decreased BK Ca function. The present study provided new information for male reproductive health and developmental origin of cerebrovascular diseases.

Zhang, Ze↗
DOE OSTI2020

High expression of PSF1 promotes drug resistance and cell cycle transit in leukemia cells

Abstract Escape of cancer cells from chemotherapy is a problem in the management of cancer patients. Research on chemotherapy resistance has mainly focused on the heterogeneity of cancer cells, multiple gene mutations, and quiescence of malignant cancer cells. However, some studies have indicated that interactions between cancer cells and vascular cells promote resistance to chemotherapy. Here, we established mouse leukemia models using the cell lines THP‐1 or MEG‐1. These were derived from acute and chronic myeloid leukemias, respectively, and highly expressed DNA replication factor PSF1, a member of the GINS complex. We found that, after anti‐cancer drug administration, surviving GFP‐positive leukemia cells in the bone marrow were located adjacent to blood vessels, as previously reported in a subcutaneous solid tumor transplantation model. Treating THP‐1 and MEG‐1 cells with anti‐cancer drugs in vitro revealed that those most strongly expressing PSF1 were most chemoresistant, suggesting that PSF1 induces not only cell cycle progression but also facilitates cell survival. Indeed, when PSF1 expression was suppressed by shRNA, the growth rate was reduced and cell death was enhanced in both cell lines. Furthermore, PSF1 knockdown in leukemia cells led to a change in their location at a distance from the blood vessels in a bone marrow transplantation model. These findings potentially reflect a mechanism of escape of leukemic cells from chemotherapy and suggest that PSF1 may be a possible therapeutic target to enhance the effect of chemotherapy.

Hsieh, Han‐Yun↗
DOE OSTI2024

Design of an Ara h 2 hypoallergen from conformational epitopes

Abstract Introduction Adverse reactions are relatively common during peanut oral immunotherapy. To reduce the risk to the patient, some researchers have proposed modifying the allergen to reduce IgE reactivity, creating a putative hypoallergen. Analysis of recently cloned human IgG from patients treated with peanut immunotherapy suggested that there are three common conformational epitopes for the major peanut allergen Ara h 2. We sought to test if structural information on these epitopes could indicate mutagenesis targets for designing a hypoallergen and evaluated the reduction in IgE binding via immunochemistry and a mouse model of passive cutaneous anaphylaxis (PCA). Methods X‐ray crystallography characterized the conformational epitopes in detail, followed by mutational analysis of key residues to modify monoclonal antibody (mAb) and serum IgE binding, assessed by ELISA and biolayer interferometry. A designed Ara h 2 hypoallergen was tested for reduced vascularization in mouse PCA experiments using pooled peanut allergic patient serum. Results A ternary crystal structure of Ara h 2 in complex with patient antibodies 13T1 and 13T5 was determined. Site‐specific mutants were designed that reduced 13T1, 13T5, and 22S1 mAbs binding by orders of magnitude. By combining designed mutations from the three major conformational bins, a hexamutant (Ara h 2 E46R, E89R, E97R, E114R, Q146A, R147E) was created that reduced IgE binding in serum from allergic patients. Further, in the PCA model where mice were primed with peanut allergic patient serum, reactivity upon allergen challenge was significantly decreased using the hexamutant. Conclusion These studies demonstrate that prior knowledge of common conformational epitopes can be used to engineer reduced IgE reactivity, an important first step in hypoallergen design.

Allergy↗
DOE OSTI2024

In vitro evidence that the vasorelaxant effects of 2‐nitro‐1‐phenyl‐1‐propanol on rat coronary arteries involve cyclic nucleotide pathways

Abstract The synthetic nitro‐alcohol 2‐nitro‐1‐phenyl‐1‐propanol (NPP) has endothelium‐independent relaxing properties in isolated preparations of rat aorta and mesenteric artery. In this study, we investigated whether the vasodilator effects occur in coronary vessels and explored whether hyperpolarization is involved in the underlying mechanism of NPP‐induced smooth muscle relaxation. The relaxing responses were studied in isolated preparations of the left anterior descending coronary (ADC) and the septal coronary (SC) arteries, which had been previously maintained under sustained contraction induced by the thromboxane A 2 analogue U‐46619. Administered cumulatively, NPP elicited concentration‐dependent vasorelaxation with similar potency in both vessels. The relaxant effect remained unaffected by the nitric oxide synthase inhibitor L‐NAME, the protein kinase C inhibitor bisindolylmaleimide IV and the Rho‐associated protein kinase inhibitor Y‐27632. However, it was significantly diminished by the adenylyl cyclase inhibitor MDL‐12,330A, the guanylyl cyclase inhibitor ODQ, as well as the K + channel inhibitors tetraethylammonium and CsCl. In ADC preparations impaled with intracellular micropipettes, NPP hyperpolarized the vascular preparation. When the isolated preparation was precontracted by 5‐hydroxytryptamine or 80 mM KCl, NPP‐induced relaxation with lower pharmacological potency compared to the vessels contracted by U‐46619. In conclusion, NPP exhibits vasorelaxant effects on rat coronary arteries, likely involving pathways that include cyclic nucleotide production and membrane hyperpolarization.

Vasconcelos‐Silva, Alfredo Augusto↗
DOE OSTI2023

Climate drivers alter nitrogen availability in surface peat and decouple N 2 fixation from CH 4 oxidation in the Sphagnum moss microbiome

Peat mosses (Sphagnum spp.) are keystone species in boreal peatlands, where they dominate net primary productivity and facilitate the accumulation of carbon in thick peat deposits. Sphagnum mosses harbor a diverse assemblage of microbial partners, including N 2 -fixing (diazotrophic) and CH 4 -oxidizing (methanotrophic) taxa that support ecosystem function by regulating transformations of carbon and nitrogen. In this work, we investigate the response of the Sphagnum phytobiome (plant + constituent microbiome + environment) to a gradient of experimental warming (+0°C to +9°C) and elevated CO 2 (+500 ppm) in an ombrotrophic peatland in northern Minnesota (USA). By tracking changes in carbon (CH 4 , CO 2 ) and nitrogen (NH 4 -N) cycling from the belowground environment up to Sphagnum and its associated microbiome, we identified a series of cascading impacts to the Sphagnum phytobiome triggered by warming and elevated CO 2 . Under ambient CO 2 , warming increased plant-available NH 4 -N in surface peat, excess N accumulated in Sphagnum tissue, and N 2 fixation activity decreased. Elevated CO 2 offset the effects of warming, disrupting the accumulation of N in peat and Sphagnum tissue. Methane concentrations in porewater increased with warming irrespective of CO 2 treatment, resulting in a ~10× rise in methanotrophic activity within Sphagnum from the +9°C enclosures. Warming's divergent impacts on diazotrophy and methanotrophy caused these processes to become decoupled at warmer temperatures, as evidenced by declining rates of methane-induced N 2 fixation and significant losses of keystone microbial taxa. In addition to changes in the Sphagnum microbiome, we observed ~94% mortality of Sphagnum between the +0°C and +9°C treatments, possibly due to the interactive effects of warming on N-availability and competition from vascular plant species. Collectively, these results highlight the vulnerability of the Sphagnum phytobiome to rising temperatures and atmospheric CO 2 concentrations, with significant implications for carbon and nitrogen cycling in boreal peatlands.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2021

Bioenergy sorghum’s deep roots: A key to sustainable biomass production on annual cropland

Abstract Bioenergy sorghum has high biomass yield potential, drought resilience, good nitrogen use efficiency, and a root system that contributes to the accumulation of soil organic carbon. In this study, field grown bioenergy sorghum root systems were analyzed during the growing season to characterize their depth, biomass, morphology, anatomy, and gene expression profiles. Bioenergy sorghum roots grew continuously during a 155‐day growing season producing ~175 nodal roots, accumulating ~7 Mg of dry biomass per hectare, and reaching >2 m deep in the soil profile. Nodal roots within 20 cm of the stem were 1–5 mm in diameter, whereas roots deeper in soil profiles were enriched in lateral roots with small diameters (~30–500 µm) enabling growth through soil macropores. In older field‐grown plants, roots with intact endodermal, vascular and inner root tissues were surrounded by degraded or aerenchyma‐filled epidermal and cortical cell layers. Transcriptome analysis of nodal, surface, and deep roots identified >2,500 differentially expressed genes involved in root growth, transport, adaptation, defense, and AMF–root interaction. Deep roots (180–240 cm) differentially expressed genes that regulate lateral root growth. Surface roots (0–20 cm) located mid‐row differentially expressed genes involved in nitrate transport, whereas ammonium transport genes were expressed in surface and deep roots and genes involved in phosphate transport were expressed in nodal, surface, and deep roots. Overall, bioenergy sorghum's long growing season enables root systems to grow deeper and accumulate more biomass than annual grain crops such as maize, attributes that could help restore annual cropland soil organic carbon levels and improve soil productivity. Deep roots active in nutrient transport are positioned to take‐up fertilizer leached deep into soil profiles mitigating potential nutrient run‐off. Bioenergy sorghum's large and deep root system is a key to sustainable production of biofuels, biopower, and bioproducts on annual cropland.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Peatland microbial community responses to plant functional group and drought are depth-dependent

Peatlands store one-third of Earth's soil carbon, the stability of which is uncertain due to climate change-driven shifts in hydrology and vegetation, and consequent impacts on microbial communities that mediate decomposition. Peatland carbon cycling varies over steep physicochemical gradients characterizing vertical peat profiles. However, it is unclear how drought-mediated changes in plant functional groups (PFGs) and water table (WT) levels affect microbial communities at different depths. We combined a multiyear mesocosm experiment with community sequencing across a 70-cm depth gradient, to test the hypotheses that vascular PFGs (Ericaceae vs. sedges) and WT (high vs. low) structure peatland microbial communities in depth-dependent ways. Several key results emerged. (i) Both fungal and prokaryote (bacteria and archaea) community structure shifted with WT and PFG manipulation, but fungi were much more sensitive to PFG whereas prokaryotes were much more sensitive to WT. (ii) PFG effects were largely driven by Ericaceae, although sedge effects were evident in specific cases (e.g., methanotrophs). (iii) Treatment effects varied with depth: the influence of PFG was strongest in shallow peat (0-10, 10-20 cm), whereas WT effects were strongest at the surface and middle depths (0-10, 30-40 cm), and all treatment effects waned in the deepest peat (60-70 cm). Furthermore, our results underline the depth-dependent and taxon-specific ways that plant communities and hydrologic variability shape peatland microbial communities, pointing to the importance of understanding how these factors integrate across soil profiles when examining peatland responses to climate change.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Cytokinin signaling localized in phloem noncell‐autonomously regulates cambial activity during secondary growth of Populus stems

Summary The regulation of cytokinin on secondary vascular development has been uncovered by modulating cytokinin content. However, it remains unclear how cytokinin enriched in developing secondary phloem regulates cambium activity in poplar. Here, we visualized the gradient distribution of cytokinin with a peak in the secondary phloem of poplar stem via immunohistochemical imaging, and determined the role of phloem‐located cytokinin signaling during wood formation. We generated transgenic poplar harboring cytokinin oxidase/dehydrogenase ( CKX)2 , a gene encoding a cytokinin degrading enzyme, driven by the phloem‐specific CLE41b promoter, indicating that the disruption of the cytokinin gradient pattern restricts the cambial activity. The RNA interference‐based knockdown of the histidine kinase ( HK ) genes encoding cytokinin receptors specifically in secondary phloem significantly compromised the division activity of cambial cells, whereas the phloem‐specific expression of a type‐B response regulator (RR) transcription factor stimulated cambial proliferation, providing evidence for the noncell‐autonomous regulation of local cytokinin signaling on the cambial activity. Moreover, the cambium‐specific knockdown of HK s also led to restricted cambial activity, and the defects were aggravated by the reduced cytokinin accumulation. Our results showed that local cytokinin signaling in secondary phloem regulates cambial activity noncell‐autonomously, and coordinately with its local signaling in cambium.

Fu, Xiaokang↗
DOE OSTI2021

Do woody vines use gelatinous fibers to climb?

Many plant movements are facilitated by contractile cells called gelatinous fibers (G-fibers), but how G-fibers function in the climbing movements of woody vines remains underexplored. In this report, we compare the presence and distribution of G-fibers in the stems of stem-twiners, which wrap around supports, with non-stem-twiners, which attach to supports via tendrils or adventitious roots. An examination of 164 species spanning the vascular plant phylogeny reveals that G-fibers are common in stem-twiners but scarce in non-stem-twiners, suggesting that G-fibers are preferentially formed in the organ responsible for movement. When present, G-fibers are in the xylem, phloem, pericycle, and/or cortex. We discuss the hypothesis that G-fibers are foundational to plant movement and highlight research opportunities concerning G-fiber development and function.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Genetic control of photoprotection and photosystem II operating efficiency in plants

Summary Photoprotection against excess light via nonphotochemical quenching (NPQ) is indispensable for plant survival. However, slow NPQ relaxation under low light conditions can decrease yield of field‐grown crops up to 40%. Using semi‐high‐throughput assay, we quantified the kinetics of NPQ and photosystem II operating efficiency (ΦPSII) in a replicated field trial of more than 700 maize ( Zea mays ) genotypes across 2 yr. Parametrized kinetics data were used to conduct genome‐wide association studies. For six candidate genes involved in NPQ and ΦPSII kinetics in maize the loss of function alleles of orthologous genes in Arabidopsis ( Arabidopsis thaliana ) were characterized: two thioredoxin genes, and genes encoding a transporter in the chloroplast envelope, an initiator of chloroplast movement, a putative regulator of cell elongation and stomatal patterning, and a protein involved in plant energy homeostasis. Since maize and Arabidopsis are distantly related, we propose that genes involved in photoprotection and PSII function are conserved across vascular plants. The genes and naturally occurring functional alleles identified here considerably expand the toolbox to achieving a sustainable increase in crop productivity.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Tomato deploys defence and growth simultaneously to resist bacterial wilt disease

Abstract Plant disease limits crop production, and host genetic resistance is a major means of control. Plant pathogenic Ralstonia causes bacterial wilt disease and is best controlled with resistant varieties. Tomato wilt resistance is multigenic, yet the mechanisms of resistance remain largely unknown. We combined metaRNAseq analysis and functional experiments to identify core Ralstonia ‐responsive genes and the corresponding biological mechanisms in wilt‐resistant and wilt‐susceptible tomatoes. While trade‐offs between growth and defence are common in plants, wilt‐resistant plants activated both defence responses and growth processes. Measurements of innate immunity and growth, including reactive oxygen species production and root system growth, respectively, validated that resistant plants executed defence‐related processes at the same time they increased root growth. In contrast, in wilt‐susceptible plants roots senesced and root surface area declined following Ralstonia inoculation. Wilt‐resistant plants repressed genes predicted to negatively regulate water stress tolerance, while susceptible plants repressed genes predicted to promote water stress tolerance. Our results suggest that wilt‐resistant plants can simultaneously promote growth and defence by investing in resources that act in both processes. Infected susceptible plants activate defences, but fail to grow and so succumb to Ralstonia , likely because they cannot tolerate the water stress induced by vascular wilt.

Meline, Valerian↗
DOE OSTI2023

Leaves as bottlenecks: The contribution of tree leaves to hydraulic resistance within the soil–plant–atmosphere continuum

Within vascular plants, the partitioning of hydraulic resistance along the soil-to-leaf continuum affects transpiration and its response to environmental conditions. In trees, the fractional contribution of leaf hydraulic resistance (R leaf ) to total soil-to-leaf hydraulic resistance (R total ), or fR leaf (= R leaf /R total ), is thought to be large, but this has not been tested comprehensively. Here, we compiled a multi-biome dataset of fR leaf using new and previously published measurements of pressure differences within trees in situ. Across 80 samples, fR leaf averaged 0.51 (95% confidence interval [CI] = 0.46-0.57) and it declined with tree height. We also used the allometric relationship between field-based measurements of soil-to-leaf hydraulic conductance and laboratory-based measurements of leaf hydraulic conductance to compute the average fR leaf for 19 tree samples, which was 0.40 (95% CI = 0.29-0.56). The in-situ technique produces a more accurate descriptor of fR leaf because it accounts for dynamic leaf hydraulic conductance. Both approaches demonstrate the outsized role of leaves in controlling tree hydrodynamics. A larger fR leaf may play a role in protecting stems from loss of hydraulic conductance. Thus, the decline in fR leaf with tree height would contribute to greater drought vulnerability in taller trees and potentially to their observed disproportionate drought mortality.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2024

Systemic stomatal responses in plants: Coordinating development, stress, and pathogen defense under a changing climate

To successfully survive, develop, grow and reproduce, multicellular organisms must coordinate their molecular, physiological, developmental and metabolic responses among their different cells and tissues. This process is mediated by cell-to-cell, vascular and/or volatile communication, and involves electric, chemical and/or hydraulic signals. Within this context, stomata serve a dual role by coordinating their responses to the environment with their neighbouring cells at the epidermis, but also with other stomata present on other parts of the plant. As stomata represent one of the most important conduits between the plant and its above-ground environment, as well as directly affect photosynthesis, respiration and the hydraulic status of the plant by controlling its gas and vapour exchange with the atmosphere, coordinating the overall response of stomata within and between different leaves and tissues plays a cardinal role in plant growth, development and reproduction. Here, we discuss different examples of local and systemic stomatal coordination, the different signalling pathways that mediate them, and the importance of systemic stomatal coordination to our food supply, ecosystems and weather patterns, under our changing climate. Importantly, we further discuss the potential biotechnological implications of regulating systemic stomatal responses for enhancing agricultural productivity in a warmer and CO 2 -rich environment.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Inoculated biocrust cover and functions diverged over a gradient of soil textures and water availability

Restoring biological crust (biocrust) in disturbed drylands is challenging due to the difficult environmental conditions, such as limited soil moisture, low soil nutrients, and extreme temperatures, that impede growth. Understanding how the key components of biocrust—mosses, lichens, and cyanobacteria—react to different environmental factors informs the optimal timing, locations, and species composition for biocrust reintroduction, thereby increasing the likelihood of establishment. Here, we inoculated soils with a diverse range of biocrust organisms, analogous to seeding an area with diverse vascular plant seeds, and varied environmental conditions to observe how these changes influenced the development and functions of reintroduced biocrust. We found that by manipulating soil texture and time spent wet, we can change the proportional cover of biocrust within a restoration‐like setting. Specifically, we found that 4 months after inoculation, finer textured soils that received more water become dominated by moss cover, while coarser textured soils with less water remained dominated by cyanobacteria cover, and the interactions between texture and time spent wet strongly influenced cover. We found biocrust morphological group cover had a small, but detectable, effect on ecosystem functions (soil stability and nitrogenase activity, a proxy for nitrogen fixation), but that environmental conditions had a stronger impact on the functions we measured. Manipulative experiments in controlled environments, like this one, can help elucidate the mechanisms underlying the establishment rate and patterns of biocrusts post‐inoculation, and inform implementation of inoculations in the field.

Environmental Sciences & Ecology↗
DOE OSTI2024

Cell‐type‐specific transcriptomics uncovers spatial regulatory networks in bioenergy sorghum stems

SUMMARY Bioenergy sorghum is a low‐input, drought‐resilient, deep‐rooting annual crop that has high biomass yield potential enabling the sustainable production of biofuels, biopower, and bioproducts. Bioenergy sorghum's 4–5 m stems account for ~80% of the harvested biomass. Stems accumulate high levels of sucrose that could be used to synthesize bioethanol and useful biopolymers if information about cell‐type gene expression and regulation in stems was available to enable engineering. To obtain this information, laser capture microdissection was used to isolate and collect transcriptome profiles from five major cell types that are present in stems of the sweet sorghum Wray. Transcriptome analysis identified genes with cell‐type‐specific and cell‐preferred expression patterns that reflect the distinct metabolic, transport, and regulatory functions of each cell type. Analysis of cell‐type‐specific gene regulatory networks (GRNs) revealed that unique transcription factor families contribute to distinct regulatory landscapes, where regulation is organized through various modes and identifiable network motifs. Cell‐specific transcriptome data was combined with known secondary cell wall (SCW) networks to identify the GRNs that differentially activate SCW formation in vascular sclerenchyma and epidermal cells. The spatial transcriptomic dataset provides a valuable source of information about the function of different sorghum cell types and GRNs that will enable the engineering of bioenergy sorghum stems, and an interactive web application developed during this project will allow easy access and exploration of the data ( https://mc‐lab.shinyapps.io/lcm‐dataset/ ).

09 BIOMASS FUELS↗
DOE OSTI2024

An alternate route for cellulose microfibril biosynthesis in plants

Similar to cellulose synthases (CESAs), cellulose synthase–like D (CSLD) proteins synthesize β-1,4-glucan in plants. CSLDs are important for tip growth and cytokinesis, but it was unknown whether they form membrane complexes in vivo or produce microfibrillar cellulose. We produced viable CESA-deficient mutants of the moss Physcomitrium patens to investigate CSLD function without interfering CESA activity. Microscopy and spectroscopy showed that CESA-deficient mutants synthesize cellulose microfibrils that are indistinguishable from those in vascular plants. Correspondingly, freeze-fracture electron microscopy revealed rosette-shaped particle assemblies in the plasma membrane that are indistinguishable from CESA-containing rosette cellulose synthesis complexes (CSCs). Our data show that proteins other than CESAs, most likely CSLDs, produce cellulose microfibrils in P. patens protonemal filaments. The data suggest that the specialized roles of CSLDs in cytokinesis and tip growth are based on differential expression and different interactions with microtubules and possibly Ca 2+ , rather than structural differences in the microfibrils they produce.

59 BASIC BIOLOGICAL SCIENCES↗