Search NASA⌕ Search

SEARCH · Search NASA

Results for “Sequence Analysis, RNA”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 55 records · Page 3
All sourcesNASA NTRSDOE OSTI
DOE OSTI2022

NF-κB perturbation reveals unique immunomodulatory functions in Prx1 + fibroblasts that promote development of atopic dermatitis

Skin is composed of diverse cell populations that cooperatively maintain homeostasis. Up-regulation of the nuclear factor κB (NF-κB) pathway may lead to the development of chronic inflammatory disorders of the skin, but its role during the early events remains unclear. Here, through analysis of single-cell RNA sequencing data via iterative random forest leave one out prediction, an explainable artificial intelligence method, we identified an immunoregulatory role for a unique paired related homeobox-1 (Prx1) + fibroblast subpopulation. Disruption of Ikkb–NF-κB under homeostatic conditions in these fibroblasts paradoxically induced skin inflammation due to the overexpression of C-C motif chemokine ligand 11 (CCL11; or eotaxin-1) characterized by eosinophil infiltration and a subsequent T H 2 immune response. Because the inflammatory phenotype resembled that seen in human atopic dermatitis (AD), we examined human AD skin samples and found that human AD fibroblasts also overexpressed CCL11 and that perturbation of Ikkb–NF-κB in primary human dermal fibroblasts up-regulated CCL11. Monoclonal antibody treatment against CCL11 was effective in reducing the eosinophilia and T H 2 inflammation in a mouse model. Together, the murine model and human AD specimens point to dysregulated Prx1 + fibroblasts as a previously unrecognized etiologic factor that may contribute to the pathogenesis of AD and suggest that targeting CCL11 may be a way to treat AD-like skin lesions.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2024

Protein N -Glycans in Healthy and Sclerotic Glomeruli in Diabetic Kidney Disease

Diabetes is expected to directly affect renal glycosylation; yet to date, there has not been a comprehensive evaluation of alterations in N-glycan composition in the glomeruli of patients with diabetic kidney disease (DKD). Here, we used untargeted mass spectrometry imaging to identify N-glycan structures in healthy and sclerotic glomeruli in formalin-fixed paraffin-embedded sections from needle biopsies of five patients with DKD and three healthy kidney samples. Regional proteomics was performed on glomeruli from additional biopsies from the same patients to compare the abundances of enzymes involved in glycosylation. Secondary analysis of single-nucleus RNA sequencing (snRNAseq) data were used to inform on transcript levels of glycosylation machinery in different cell types and states. We detected 120 N-glycans, and among them, we identified 12 of these protein post-translated modifications that were significantly increased in glomeruli. All glomeruli-specific N-glycans contained an N-acetyllactosamine epitope. Five N-glycan structures were highly discriminant between sclerotic and healthy glomeruli. Sclerotic glomeruli had an additional set of glycans lacking fucose linked to their core, and they did not show tetra-antennary structures that were common in healthy glomeruli. Orthogonal omics analyses revealed lower protein abundance and lower gene expression involved in synthesizing fucosylated and branched N-glycans in sclerotic podocytes. In snRNAseq and regional proteomics analyses, we observed that genes and/or proteins involved in sialylation and N-acetyllactosamine synthesis were also downregulated in DKD glomeruli, but this alteration remained undetectable by our spatial N-glycomics assay. Integrative spatial glycomics, proteomics, and transcriptomics revealed protein N-glycosylation characteristic of sclerotic glomeruli in DKD.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Long-read RNA sequencing atlas of human microglia isoforms elucidates disease-associated genetic regulation of splicing

Microglia, the innate immune cells of the central nervous system, have been genetically implicated in multiple neurodegenerative diseases. Mapping the genetics of gene expression in human microglia has identified several loci associated with disease-associated genetic variants in microglia-specific regulatory elements. However, identifying genetic effects on splicing is challenging because of the use of short sequencing reads. Here, we present the isoform-centric microglia genomic atlas (isoMiGA), which leverages long-read RNA sequencing to identify 35,879 novel microglia isoforms. We show that these isoforms are involved in stimulation response and brain region specificity. We then quantified the expression of both known and novel isoforms in a multi-ancestry meta-analysis of 555 human microglia short-read RNA sequencing samples from 391 donors, and found associations with genetic risk loci in Alzheimer’s and Parkinson’s disease. We nominate several loci that may act through complex changes in isoform and splice-site usage.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

A Genome-Scale Atlas Reveals Complex Interplay of Transcription and Translation in an Archaeon

The scale of post-transcriptional regulation and the implications of its interplay with other forms of regulation in environmental acclimation are underexplored for organisms of the domain Archaea. Here, we have investigated the scale of post-transcriptional regulation in the extremely halophilic archaeon Halobacterium salinarum NRC-1 by integrating the transcriptome-wide locations of transcript processing sites (TPSs) and SmAP1 binding, the genome-wide locations of antisense RNAs (asRNAs), and the consequences of RNase_2099C knockout on the differential expression of all genes. This integrated analysis has discovered that 54% of all protein-coding genes in the genome of this haloarchaeon are likely targeted by multiple mechanisms for putative post-transcriptional processing and regulation, with about 20% of genes likely being regulated by combinatorial schemes involving SmAP1, asRNAs, and RNase_2099C. Comparative analysis of mRNA levels (transcriptome sequencing [RNA-Seq]) and protein levels (sequential window acquisition of all theoretical fragment ion spectra mass spectrometry [SWATH-MS]) for 2,579 genes over four phases of batch culture growth in complex medium generated additional evidence for the conditional post-transcriptional regulation of 7% of all protein-coding genes. We demonstrate that post-transcriptional regulation may act to fine-tune specialized and rapid acclimation to stressful environments, e.g., as a switch to turn on gas vesicle biogenesis to promote vertical relocation under anoxic conditions and modulate the frequency of transposition by insertion sequence (IS) elements of the IS200/IS605, IS4, and ISH3 families. Findings from this study are provided as an atlas in a public Web resource (https://halodata.systemsbiology.net).

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Real-time structural motif searching in proteins using an inverted index strategy

Biochemical and biological functions of proteins are the product of both the overall fold of the polypeptide chain, and, typically, structural motifs made up of smaller numbers of amino acids constituting a catalytic center or a binding site that may be remote from one another in amino acid sequence. Detection of such structural motifs can provide valuable insights into the function(s) of previously uncharacterized proteins. Technically, this remains an extremely challenging problem because of the size of the Protein Data Bank (PDB) archive. Existing methods depend on a clustering by sequence similarity and can be computationally slow. We have developed a new approach that uses an inverted index strategy capable of analyzing >170,000 PDB structures with unmatched speed. The efficiency of the inverted index method depends critically on identifying the small number of structures containing the query motif and ignoring most of the structures that are irrelevant. Our approach (implemented at motif.rcsb.org ) enables real-time retrieval and superposition of structural motifs, either extracted from a reference structure or uploaded by the user. Herein, we describe the method and present five case studies that exemplify its efficacy and speed for analyzing 3D structures of both proteins and nucleic acids.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

A robust method of nuclei isolation for single-cell RNA sequencing of solid tissues from the plant genus Populus

Single-cell transcriptome analysis has been extensively applied in humans and animal models to uncover gene expression heterogeneity between the different cell types of a tissue or an organ. It demonstrated its capability to discover key regulatory elements that determine cell fate during developmental programs. Single-cell analysis requires the isolation and labeling of the messenger RNA (mRNA) derived from each cell. These challenges were primarily addressed in mammals by developing microfluidic-based approaches. For plant species whose cells contain cell walls, these approaches have generally required the generation of isolated protoplasts. Many plant tissues’ secondary cell wall hinders enzymatic digestion required for individual protoplast isolation, resulting in an unequal representation of cell types in a protoplast population. This limitation is especially critical for cell types located in the inner layers of a tissue or the inner tissues of an organ. Consequently, single-cell RNA sequencing (scRNA-seq) studies using microfluidic approaches in plants have mainly been restricted to Arabidopsis roots, for which well-established procedures of protoplast isolation are available. Here we present a simple alternative approach to generating high-quality protoplasts from plant tissue by characterizing the mRNA extracted from individual nuclei instead of whole cells. We developed the protocol using two different plant materials with varying cellular complexity levels and cell wall structure, Populus shoot apices, and more lignified stems. Using the 10× Genomics Chromium technology, we show that this procedure results in intact mRNA isolation and limited leakage, with a broad representation of individual cell transcriptomes.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2024

Proteogenomic characterization of difficult-to-treat breast cancer with tumor cells enriched through laser microdissection

Abstract Background Breast cancer (BC) is the most commonly diagnosed cancer and the leading cause of cancer death among women globally. Despite advances, there is considerable variation in clinical outcomes for patients with non-luminal A tumors, classified as difficult-to-treat breast cancers (DTBC). This study aims to delineate the proteogenomic landscape of DTBC tumors compared to luminal A (LumA) tumors. Methods We retrospectively collected a total of 117 untreated primary breast tumor specimens, focusing on DTBC subtypes. Breast tumors were processed by laser microdissection (LMD) to enrich tumor cells. DNA, RNA, and protein were simultaneously extracted from each tumor preparation, followed by whole genome sequencing, paired-end RNA sequencing, global proteomics and phosphoproteomics. Differential feature analysis, pathway analysis and survival analysis were performed to better understand DTBC and investigate biomarkers. Results We observed distinct variations in gene mutations, structural variations, and chromosomal alterations between DTBC and LumA breast tumors. DTBC tumors predominantly had more mutations inTP53,PLXNB3, Zinc finger genes, and fewer mutations inSDC2,CDH1,PIK3CA,SVIL, andPTEN. Notably, Cytoband 1q21, which contains numerous cell proliferation-related genes, was significantly amplified in the DTBC tumors. LMD successfully minimized stromal components and increased RNA–protein concordance, as evidenced by stromal score comparisons and proteomic analysis. Distinct DTBC and LumA-enriched clusters were observed by proteomic and phosphoproteomic clustering analysis, some with survival differences. Phosphoproteomics identified two distinct phosphoproteomic profiles for high relapse-risk and low relapse-risk basal-like tumors, involving several genes known to be associated with breast cancer oncogenesis and progression, includingKIAA1522,DCK,FOXO3,MYO9B,ARID1A,EPRS,ZC3HAV1, andRBM14. Lastly, an integrated pathway analysis of multi-omics data highlighted a robust enrichment of proliferation pathways in DTBC tumors. Conclusions This study provides an integrated proteogenomic characterization of DTBC vs LumA with tumor cells enriched through laser microdissection. We identified many common features of DTBC tumors and the phosphopeptides that could serve as potential biomarkers for high/low relapse-risk basal-like BC and possibly guide treatment selections.

Oncology↗
DOE OSTI2022

Chromatin structure predicts survival in glioma patients

The pathological changes in epigenetics and gene regulation that accompany the progression of low-grade to high-grade gliomas are under-studied. The authors use a large set of paired atac-seq and RNA-seq data from surgically resected glioma specimens to infer gene regulatory relationships in glioma. Thirty-eight glioma patient samples underwent atac-seq sequencing and 16 samples underwent additional RNA-seq analysis. Using an atac-seq/RNA-seq correlation matrix, atac-seq peaks were paired with genes based on high correlation values (|r 2 | > 0.6). Samples clustered by IDH1 status but not by grade. Surprisingly there was a trend for IDH1 mutant samples to have more peaks. The majority of peaks are positively correlated with survival and positively correlated with gene expression. Constructing a model of the top six atac-seq peaks created a highly accurate survival prediction model (r 2 = 0.68). Four of these peaks were still significant after controlling for age, grade, pathology, IDH1 status and gender. Grade II, III, and IV (primary) samples have similar transcription factors and gene modules. However, grade IV (recurrent) samples have strikingly few peaks. Patient-derived glioma cultures showed decreased peak counts following radiation indicating that this may be radiation-induced. This study supports the notion that IDH1 mutant and IDH1 wildtype gliomas have different epigenetic landscapes and that accessible chromatin sites mapped by atac-seq peaks tend to be positively correlated with expression. The data in this study leads to a new model of treatment response wherein glioma cells respond to radiation therapy by closing open regions of DNA.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Morphological and molecular characterization of Paratylenchus beltsvillensis n. sp. (Tylenchida: Paratylenchidae) from the rhizosphere of pine tree ( Pinus virginiana Mill) in Maryland, USA

The pin nematode, Paratylechus beltsvillensis sp. collected from rhizosphere soil of a Virginia pine tree (Pinus virginiana Mill) growing in Little Paint Branch Park, Beltsville, Prince George’s County, Maryland, USA, is described and illustrated along with light and scanning electron photomicrographs. Females, males, and juveniles of this new species were recovered from soil samples using the sugar centrifugal flotation and Baermann funnel extraction methods. Morphologically, females are short, body length ranging from 245 to 267 μm, stylet from 70 to 75 μm long with anchor shaped knobs, vulva located at 70–73% and small vulval flap, spermatheca large, and ovoid filled with sperms. Lateral field with three incisures, of which the outer two are prominent. Tail slender, having a rounded tail terminus. Males without stylet and have a degenerated pharynx, spicules = 17–20 µm and gubernaculum = 5.0–5.5 µm. Both morphological observations and molecular analysis of ITS and partial 28S ribosomal RNA gene sequences indicated that the specimens collected from the soil at Beltsville Park from rhizosphere soil samples from Virginia pine represents a new pin nematode species.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

A Structural Perspective on the RNA Editing of Plant Respiratory Complexes

The last steps of respiration, a core energy-harvesting process, are carried out by a chain of multi-subunit complexes in the inner mitochondrial membrane. Several essential subunits of the respiratory complexes are RNA-edited in plants, frequently leading to changes in the encoded amino acids. While the impact of RNA editing is clear at the sequence and phenotypic levels, the underlying biochemical explanations for these effects have remained obscure. Here, we used the structures of plant respiratory complex I, complex III2 and complex IV to analyze the impact of the amino acid changes of RNA editing in terms of their location and biochemical features. Through specific examples, we demonstrate how the structural information can explain the phenotypes of RNA-editing mutants. This work shows how the structural perspective can bridge the gap between sequence and phenotype and provides a framework for the continued analysis of RNA-editing mutants in plant mitochondria and, by extension, in chloroplasts.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Targeted inhibition of MASTL kinase activity induces apoptosis in breast cancer

Microtubule-associated serine/threonine kinase-like (MASTL) (or Greatwall kinase (GWL)) is an important cell cycle regulating kinase that regulates the G2-M transition. Uncontrolled MASTL activity is implicated in breast cancer progression. To date, very few inhibitors have been reported against this protein. Here, structure-based computational modeling indicates that the natural product flavopiridol (FLV) binds strongly to MASTL and these results are validated using molecular dynamics simulation studies. Further, an in vitro kinase assay reveals an EC 50 (effective concentration) value of FLV to be 82.1 nM and a better IC 50 compared to the positive reference compound, staurosporine. FLV is found to inhibit MASTL kinase activity, arresting the cell growth in the G1 phase and inducing apoptosis in breast cancer cells. Consistent with these results differential gene expression obtained using RNA sequencing studies, and validated by RT PCR and immunoblot analysis, indicate that MASTL inhibition induces cell cycle arrest and apoptotic-related genes. Furthermore, metastasis- and inflammation- related genes are downregulated. Thus, the deregulation of MASTL signaling pathways on targeted inhibition of its kinase activity is revealed. This study lays a strong foundation for investigating FLV as a lead compound in breast cancer therapeutics.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2025

The promising role of proteomes and metabolomes in defining the single-cell landscapes of plants

The plant community has a strong track-record of RNA sequencing technology deployment, which combined with the recent advent of spatial platforms (e.g., 10x genomics), has resulted in an explosion of outstanding single cell and nuclei datasets that can be put in an in situ context within tissues (e.g., a cell atlas)1. In the genomics era, application of proteomics technologies in the plant sciences has always trailed behind that of RNA sequencing technologies, largely due to accessibility, ease-of-use and access to expertise along with depth of analysis benefits. On the other hand, the use of early analytical tools for characterizing small molecules (metabolites) from plant systems predates nucleic acid sequencing and proteomics analysis2, as the search for plant-based natural products has played a significant role in improving human health throughout history. However, the employment of proteomics and metabolomics assays for characterizing plant cell processes now remains significantly behind transcriptional approaches, even though both provide a direct functional readout of cell states and phenotypes.

Anderton, Christopher R. [BATTELLE (PACIFIC NW LAB↗
DOE OSTI2021

NASA GeneLab RNA-seq consensus pipeline: Standardized processing of short-read RNA-seq data

With the development of transcriptomic technologies, we are able to quantify precise changes in gene expression profiles from astronauts and other organisms exposed to spaceflight. Members of NASA GeneLab and GeneLab-associated analysis working groups (AWGs) have developed a consensus pipeline for analyzing short-read RNA-sequencing data from spaceflight-associated experiments. The pipeline includes quality control, read trimming, mapping, and gene quantification steps, culminating in the detection of differentially expressed genes. This data analysis pipeline and the results of its execution using data submitted to GeneLab are now all publicly available through the GeneLab database. We present here the full details and rationale for the construction of this pipeline in order to promote transparency, reproducibility, and reusability of pipeline data; to provide a template for data processing of future spaceflight-relevant datasets; and to encourage cross-analysis of data from other databases with the data available in GeneLab.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

RNA language models predict mutations that improve RNA function

Structured RNA lies at the heart of many central biological processes, from gene expression to catalysis. RNA structure prediction is not yet possible due to a lack of high-quality reference data associated with organismal phenotypes that could inform RNA function. We present GARNET (Gtdb Acquired RNa with Environmental Temperatures), a new database for RNA structural and functional analysis anchored to the Genome Taxonomy Database (GTDB). GARNET links RNA sequences to experimental and predicted optimal growth temperatures of GTDB reference organisms. Using GARNET, we develop sequence- and structure-aware RNA generative models, with overlapping triplet tokenization providing optimal encoding for a GPT-like model. Leveraging hyperthermophilic RNAs in GARNET and these RNA generative models, we identify mutations in ribosomal RNA that confer increased thermostability to the Escherichia coli ribosome. The GTDB-derived data and deep learning models presented here provide a foundation for understanding the connections between RNA sequence, structure, and function.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Taxogenomic analysis of Pichia senei sp. nov. and new insights into hybridization events in the Pichia cactophila species complex

Three strains of a novel yeast species were isolated from necrotic cactus tissues of Cereus saddianus and Micranthocereus dolichospermaticus and from phytotelmata of Bromelia karatas. DNA sequence analysis of the Internal Transcribed Spacer (ITS) region and D1/D2 domains of the large subunit ribosomal RNA, along with whole genome phylogenomic analysis, showed that this yeast is most closely related to Pichia insulana, Pichia cactophila, and Pichia inconspicua. The new species differs by 10–13 nucleotide substitutions from these species in D1/D2 sequences and exhibits <90% genome-wide average nucleotide identity to them. The name Pichia senei sp. nov. is proposed for the novel species, which is homothallic and produces asci with one to four hat-shaped ascospores. The holotype is CBS 16311 (MycoBank MB 858723). Taxogenomic analyses of the P. cactophila species complex, including P. senei, provide new insights about the hybridizations events that shaped this group. Pichia insulana and P. inconspicua are identified as the parental lineages that originated P. cactophila, and P. senei also appears closely related to one of the progenitors of P. inconspicua. We assess phylogeny, heterozygosity, and ploidy to explore the processes shaping diversity, showing how genomic data support yeast species delimitation and reveal complex hybridization.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

A high-resolution single-molecule sequencing-based Arabidopsis transcriptome using novel methods of Iso-seq analysis

Accurate and comprehensive annotation of transcript sequences is essential for transcript quantification and differential gene and transcript expression analysis. Single-molecule long-read sequencing technologies provide improved integrity of transcript structures including alternative splicing, and transcription start and polyadenylation sites. However, accuracy is significantly affected by sequencing errors, mRNA degradation, or incomplete cDNA synthesis. We present a new and comprehensive Arabidopsis thaliana Reference Transcript Dataset 3 (AtRTD3). AtRTD3 contains over 169,000 transcripts—twice that of the best current Arabidopsis transcriptome and including over 1500 novel genes. Seventy-eight percent of transcripts are from Iso-seq with accurately defined splice junctions and transcription start and end sites. We develop novel methods to determine splice junctions and transcription start and end sites accurately. Mismatch profiles around splice junctions provide a powerful feature to distinguish correct splice junctions and remove false splice junctions. Stratified approaches identify high-confidence transcription start and end sites and remove fragmentary transcripts due to degradation. AtRTD3 is a major improvement over existing transcriptomes as demonstrated by analysis of an Arabidopsis cold response RNA-seq time-series. AtRTD3 provides higher resolution of transcript expression profiling and identifies cold-induced differential transcription start and polyadenylation site usage. AtRTD3 is the most comprehensive Arabidopsis transcriptome currently. It improves the precision of differential gene and transcript expression, differential alternative splicing, and transcription start/end site usage analysis from RNA-seq data. The novel methods for identifying accurate splice junctions and transcription start/end sites are widely applicable and will improve single-molecule sequencing analysis from any species.

transcription start and end sites↗