Search NASA⌕ Search

SEARCH · Search NASA

Results for “TISSUE”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 55 records · Page 3
All sourcesNASA NTRSDOE OSTI
DOE OSTI2023

Physics guided machine learning for multi-material decomposition of tissues from dual-energy CT scans of simulated breast models with calcifications

We introduce a physics guided data-driven method for image-based multi-material decomposition for dual-energy computed tomography (CT) scans. The method is demonstrated for CT scans of virtual human phantoms containing more than two types of tissues. The method is a physics-driven supervised learning technique. We take advantage of the mass attenuation coefficient of dense materials compared to that of muscle tissues to perform a preliminary extraction of the dense material from the images using unsupervised methods. We then perform supervised deep learning on the images processed by the extracted dense material to obtain the final multi-material tissue map. The method is demonstrated on simulated breast models with calcifications as the dense material placed amongst the muscle tissues. The physics-guided machine learning method accurately decomposes the various tissues from input images, achieving a normalized root-mean-squared error of 2.75%.

Gopalakrishnan Meena, Murali↗
DOE OSTI2022

An optimized approach and inflation media for obtaining complimentary mass spectrometry-based omics data from human lung tissue

Human disease states are biomolecularly multifaceted and can span across phenotypic states, therefore it is important to understand diseases on all levels, across cell types, and within and across microanatomical tissue compartments. To obtain an accurate and representative view of the molecular landscape within human lungs, this fragile tissue must be inflated and embedded to maintain spatial fidelity of the location of molecules and minimize molecular degradation for molecular imaging experiments. Here, we evaluated agarose inflation and carboxymethyl cellulose embedding media and determined effective tissue preparation protocols for performing bulk and spatial mass spectrometry-based omics measurements. Mass spectrometry imaging methods were optimized to boost the number of annotatable molecules in agarose inflated lung samples. This optimized protocol permitted the observation of unique lipid distributions within several airway regions in the lung tissue block. Laser capture microdissection of these airway regions followed by high-resolution proteomic analysis allowed us to begin linking the lipidome with the proteome in a spatially resolved manner, where we observed proteins with high abundance specifically localized to the airway regions. We also compared our mass spectrometry results to lung tissue samples preserved using two other inflation/embedding media, but we identified several pitfalls with the sample preparation steps using this preservation method. Overall, we demonstrated the versatility of the inflation method, and we can start to reveal how the metabolome, lipidome, and proteome are connected spatially in human lungs and across disease states through a variety of different experiments.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Mapping the Spatial Distribution of Fibrillar Polymorphs in Human Brain Tissue

Alzheimer’s disease (AD) is a neurodegenerative disorder defined by the progressive formation and spread of fibrillar aggregates of Aβ peptide and tau protein. Polymorphic forms of these aggregates may contribute to disease in varying ways since different neuropathologies appear to be associated with different sets of fibrillar structures and follow distinct pathological trajectories that elicit characteristic clinical phenotypes. The molecular mechanisms underlying the spread of these aggregates in disease may include nucleation, replication, and migration all of which could vary with polymorphic form, stage of disease, and region of brain. Given the linkage between mechanisms of progression and distribution of polymorphs, mapping the distribution of fibrillar structures in situ has the potential to discriminate between mechanisms of progression. However, the means of carrying out this mapping are limited. Optical microscopy lacks the resolution to discriminate between polymorphs in situ, and higher resolution tools such as ssNMR and cryoEM require the isolation of fibrils from tissue, destroying relevant spatial information. Here, we demonstrate the use of scanning x-ray microdiffraction (XMD) to map the locations of fibrillar polymorphs of Aβ peptides and tau protein in histological thin sections of human brain tissue. Coordinated examination of serial sections by immunohistochemistry was used to aid in the interpretation of scattering patterns and to put the observations in a broader anatomical context. Scattering from lesions in tissue shown to be rich in Aβ fibrils by immunohistochemistry exhibited scattering patterns with a prototypical 4.7 Å cross-β peak, and overall intensity distribution that compared well with that predicted from high resolution structures. Scattering from lesions in tissue with extensive tau pathology also exhibited a 4.7 Å cross-β peak but with intensity distributions that were distinct from those seen in Aβ-rich regions. In summary, these observations demonstrate that XMD is a rich source of information on the distribution of fibrillar polymorphs in diseased human brain tissue. When used in coordination with neuropathological examination it has the potential to provide novel insights into the molecular mechanisms underlying disease.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Normal Tissue Injury Induced by Photon and Proton Therapies: Gaps and Opportunities

Despite technological advances in radiation therapy (RT) and cancer treatment, patients still experience adverse effects. Proton therapy (PT) has emerged as a valuable RT modality that can improve treatment outcomes. Normal tissue injury is an important determinant of the outcome; therefore, for this review, we analyzed 2 databases: (1) clinical trials registered with ClinicalTrials.gov and (2) the literature on PT in PubMed, which shows a steady increase in the number of publications. Most studies in PT registered with ClinicalTrials.gov with results available are nonrandomized early phase studies with a relatively small number of patients enrolled. From the larger database of nonrandomized trials, we listed adverse events in specific organs/sites among patients with cancer who are treated with photons and protons to identify critical issues. The present data demonstrate dosimetric advantages of PT with favorable toxicity profiles and form the basis for comparative randomized prospective trials. A comparative analysis of 3 recently completed randomized trials for normal tissue toxicities suggests that for early stage non-small cell lung cancer, no meaningful comparison could be made between stereotactic body RT and stereotactic body PT due to low accrual (NCT01511081). In addition, for locally advanced non-small cell lung cancer, a comparison of intensity modulated RT with passive scattering PT (now largely replaced by spot-scanned intensity modulated PT), PT did not provide any benefit in normal tissue toxicity or locoregional failure over photon therapy. Finally, for locally advanced esophageal cancer, proton beam therapy provided a lower total toxicity burden but did not improve progression-free survival and quality of life (NCT01512589). The purpose of this review is to inform the limitations of current trials looking at protons and photons, considering that advances in technology, physics, and biology are a continuum, and to advocate for future trials geared toward accurate precision RT that need to be viewed as an iterative process in a defined path toward delivering optimal radiation treatment. A foundational understanding of the radiobiologic differences between protons and photons in tumor and normal tissue responses is fundamental to, and necessary for, determining the suitability of a given type of biologically optimized RT to a patient or cohort.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2022

Morphological and Phenotypic Characteristics of the Bovine Nasopharyngeal Mucosa and Associated Lymphoid Tissue

The mammalian nasopharynx is an anatomically complex region of the upper respiratory tract that directly communicates with the nasal cavity, laryngopharynx, oesophagus and trachea. The nasopharyngeal mucosa contains moderate quantities of mucosa-associated lymphoid tissue (MALT) that is appropriately located for immunological sampling but also creates vulnerability to pathogens. In recent years, the nasopharynx has been inculpated in the pathogenesis of important diseases of cattle (foot-and-mouth disease) and humans (COVID-19), yet the tissue has never been described in detail in any species. In order to characterize the morphology and cellular composition of the bovine nasopharynx, samples of mucosa were collected from the nasopharynx of five 8–13-month-old steers and examined using light microscopy, immunohistochemistry and multichannel immunofluorescence. Morphologically, the nasopharyngeal epithelium was highly heterogeneous, with a continuum ranging from stratified squamous epithelium to highly attenuated, follicle-associated epithelium (FAE). Distribution of MALT was similarly regionally variable ranging from absent to clusters of multiple lymphoid follicles. Phenotypic characterization demonstrated dense distributions of dendritic cells and T lymphocytes surrounding lymphoid follicles, which comprised mostly B lymphocytes. The FAE overlaying the lymphoid follicles also contained higher numbers of dendritic cells and lymphocytes compared with the adjacent non-lymphoid epithelium, although cytotoxic T cells were notably scarce in the FAE. The bovine nasopharyngeal lymphoid tissue had comparable elements to other MALTs with specific differences that may help to elucidate the pathogenesis of infectious agents that have specific tropism for this tissue.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Dynamic and Programmable Cellular-Scale Granules Enable Tissue-like Materials

Living tissues are an integrated, multiscale architecture consisting of dense cellular ensembles and extracellular matrices (ECMs). The cells and ECMs cooperate to enable specialized mechanical properties and dynamic responsiveness. However, the mechanical properties of living tissues are difficult to replicate. A particular challenge is identification of a cell-like synthetic component, which is tightly integrated with its matrix and also responsive to external stimuli. Here, we demonstrate that cellular-scale hydrated starch granules, an underexplored component in materials science, can turn conventional hydrogels into tissue-like materials when composites are formed. By using several synchrotron-based X-ray techniques, we reveal the mechanically induced organization and training dynamics of the starch granules in the hydrogel matrix. These dynamic behaviors enable multiple tissue-like properties such as programmability, anisotropy, strain-stiffening, mechanochemistry, and self-healability.

36 MATERIALS SCIENCE↗
DOE OSTI2021

Leptin modulates gene expression in the heart, cardiomyocytes and the adipose tissue thus mitigating LPS-induced damage

Highlights: • LPS enhanced expression of the leptin gene in mouse tissues and cardiomyocytes. • Leptin downregulated pro-inflammatory genes in vivo and in cardiomyocytes after LPS treatment. • Leptin upregulated expression of antioxidant genes in vivo and in cardiomyocytes after LPS treatment. • Leptin reduced ROS levels in cardiomyocytes after LPS treatment. • Leptin acts to counteract LPS-induced damage in the heart and cardiomyocytes by modulating gene expression. • Anti-inflammatory effects of leptin in transgenic aMUPA mice overexpressing leptin surpassed that of wild type mice. Leptin is an adipokine of pleiotropic effects linked to energy metabolism, satiety, the immune response, and cardioprotection. We have recently shown that leptin causally conferred resistance to myocardial infarction-induced damage in transgenic αMUPA mice overexpressing leptin compared to their wild type (WT) ancestral mice FVB/N. Prompted by these findings, we have investigated here if leptin can counteract the inflammatory response triggered after LPS administration in tissues in vivo and in cardiomyocytes in culture. The results have shown that LPS upregulated in vivo and in vitro all genes examined here, both pro-inflammatory and antioxidant, as well as the leptin gene. Pretreating mice with leptin neutralizing antibodies further upregulated the expression of TNFα and IL-1β in the adipose tissue of both mouse types, and in the αMUPA heart. The antibodies also increased the levels of serum markers for cell toxicity in both mouse types. These results indicate that under LPS, leptin actually reduced the levels of these inflammatory-related parameters. In addition, pretreatment with leptin antibodies reduced the levels of HIF-1α and VEGF mRNAs in the heart, indicating that under LPS leptin increased the levels of these mRNAs. In cardiomyocytes, pretreatment with exogenous leptin prior to LPS reduced the expression of both pro-inflammatory genes, enhanced the expression of the antioxidant genes HO-1, SOD2 and HIF-1α, and lowered ROS staining. In addition, results obtained with leptin antibodies and the SMLA leptin antagonist indicated that endogenous and exogenous leptin can inhibit leptin gene expression. Together, these findings have indicated that under LPS, leptin concomitantly downregulated pro-inflammatory genes, upregulated antioxidant genes, and lowered ROS levels. These results suggest that leptin can counteract inflammation in the heart and adipose tissue by modulating gene expression.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2020

Control of the optical properties of gum and dentin tissue of a human tooth at laser spectral lines in the range of 200 – 800 nm

A change in the optical properties of the tissue of the gums and dentin of a human tooth is experimentally investigated in vitro with the application of a 99.5 % glycerol solution. The kinetics of the total transmittance in the spectral range of 200 – 800 nm on characteristic laser lines is studied. It is shown that the effectiveness of optical clearing, expressed as a relative increase in the total transmittance, for gum tissue in the laser radiation range of 200 – 800 nm can vary significantly (by an order of magnitude). In this case, the absolute values of optical transmittance in the UV region are relatively small due to the strong absorption by the endogenous chromophores of the studied tissues, and in the visible and NIR regions, on the contrary, they are significant, which is due to the absence of strongly absorbing chromophores. The effectiveness of dentin clearing in the entire visible and NIR spectral regions is on average 25 % for 300 minutes of immersion of the sample in a 99.5 % glycerol solution. The presented results are necessary for increasing the efficiency of laser therapy and methods for optical monitoring of morphological changes in biological tissues for the purpose of early diagnosis of diseases. (paper)

46 INSTRUMENTATION RELATED TO NUCLEAR SCIENCE AND ↗
DOE OSTI2024

Multiscale embedded printing of engineered human tissue and organ equivalents

Creating tissue and organ equivalents with intricate architectures and multiscale functional feature sizes is the first step toward the reconstruction of transplantable human tissues and organs. Existing embedded ink writing approaches are limited by achievable feature sizes ranging from hundreds of microns to tens of millimeters, which hinders their ability to accurately duplicate structures found in various human tissues and organs. In this study, a multiscale embedded printing (MSEP) strategy is developed, in which a stimuli-responsive yield-stress fluid is applied to facilitate the printing process. A dynamic layer height control method is developed to print the cornea with a smooth surface on the order of microns, which can effectively overcome the layered morphology in conventional extrusion-based three-dimensional bioprinting methods. Since the support bath is sensitive to temperature change, it can be easily removed after printing by tuning the ambient temperature, which facilitates the fabrication of human eyeballs with optic nerves and aortic heart valves with overhanging leaflets on the order of a few millimeters. The thermosensitivity of the support bath also enables the reconstruction of the full-scale human heart on the order of tens of centimeters by on-demand adding support bath materials during printing. Here, the proposed MSEP demonstrates broader printable functional feature sizes ranging from microns to centimeters, providing a viable and reliable technical solution for tissue and organ printing in the future.

3D bioprinting↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

A 1D–0D–3D coupled model for simulating blood flow and transport processes in breast tissue

In this work, we present mixed dimensional models for simulating blood flow and transport processes in breast tissue and the vascular tree supplying it. These processes are considered, to start from the aortic inlet to the capillaries and tissue of the breast. Large variations in biophysical properties and flow conditions exist in this system necessitating the use of different flow models for different geometries and flow regimes. In total, we consider four different model types. First, a system of 1D nonlinear hyperbolic partial differential equations (PDEs) is considered to simulate blood flow in larger arteries with highly elastic vessel walls. Second, we assign 1D linearized hyperbolic PDEs to model the smaller arteries with stiffer vessel walls. The third model type consists of ODE systems (0D models). It is used to model the arterioles and peripheral circulation. Finally, homogenized 3D porous media models are considered to simulate flow and transport in capillaries and tissue within the breast volume. Sink terms are used to account for the influence of the venous and lymphatic systems. Combining the four model types, we obtain two different 1D–0D–3D coupled models for simulating blood flow and transport processes: The first model results in a fully coupled 1D–0D–3D model covering the complete path from the aorta to the breast combining a generic arterial network with a patient specific breast network and geometry. The second model is a reduced one based on the separation of the generic and patient specific parts. The information from a calibrated fully coupled model is used as inflow condition for the patient specific sub-model allowing a significant computational cost reduction. Several numerical experiments are conducted to calibrate the generic model parameters and to demonstrate realistic flow simulations compared to existing data on blood flow in the human breast and vascular system. Moreover, we use two different breast vasculature and tissue data sets to illustrate the robustness of our reduced sub-model approach.

multiscale blood flow models↗
DOE OSTI2024

Label-Free In Situ Chemical Characterization of Amyloid Plaques in Human Brain Tissues

The accumulation of amyloid plaques and increased brain redox burdens are neuropathological hallmarks of Alzheimer’s disease. Altered metabolism of essential biometals is another feature of Alzheimer’s, with amyloid plaques representing sites of disturbed metal homeostasis. Despite these observations, metal-targeting disease treatments have not been therapeutically effective to date. A better understanding of amyloid plaque composition and the role of the metals associated with them is critical. To establish this knowledge, the ability to resolve chemical variations at nanometer length scales relevant to biology is essential. Here, we present a methodology for the label-free, nanoscale chemical characterization of amyloid plaques within human Alzheimer’s disease tissue using synchrotron X-ray spectromicroscopy. Our approach exploits a C–H carbon absorption feature, consistent with the presence of lipids, to visualize amyloid plaques selectively against the tissue background, allowing chemical analysis to be performed without the addition of amyloid dyes that alter the native sample chemistry. Using this approach, we show that amyloid plaques contain elevated levels of calcium, carbonates, and iron compared to the surrounding brain tissue. Chemical analysis of iron within plaques revealed the presence of chemically reduced, low-oxidation-state phases, including ferromagnetic metallic iron. The zero-oxidation state of ferromagnetic iron determines its high chemical reactivity and so may contribute to the redox burden in the Alzheimer’s brain and thus drive neurodegeneration. Ferromagnetic metallic iron has no established physiological function in the brain and may represent a target for therapies designed to lower redox burdens in Alzheimer’s disease. Additionally, ferromagnetic metallic iron has magnetic properties that are distinct from the iron oxide forms predominant in tissue, which might be exploitable for the in vivo detection of amyloid pathologies using magnetically sensitive imaging. We anticipate that this label-free X-ray imaging approach will provide further insights into the chemical composition of amyloid plaques, facilitating better understanding of how plaques influence the course of Alzheimer’s disease.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2021

Probing the subcellular nanostructure of engineered human cardiomyocytes in 3D tissue

Abstract The structural and functional maturation of human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) is essential for pharmaceutical testing, disease modeling, and ultimately therapeutic use. Multicellular 3D-tissue platforms have improved the functional maturation of hiPSC-CMs, but probing cardiac contractile properties in a 3D environment remains challenging, especially at depth and in live tissues. Using small-angle X-ray scattering (SAXS) imaging, we show that hiPSC-CMs matured and examined in a 3D environment exhibit a periodic spatial arrangement of the myofilament lattice, which has not been previously detected in hiPSC-CMs. The contractile force is found to correlate with both the scattering intensity ( R 2 = 0.44) and lattice spacing ( R 2 = 0.46). The scattering intensity also correlates with lattice spacing ( R 2 = 0.81), suggestive of lower noise in our structural measurement than in the functional measurement. Notably, we observed decreased myofilament ordering in tissues with a myofilament mutation known to lead to hypertrophic cardiomyopathy (HCM). Our results highlight the progress of human cardiac tissue engineering and enable unprecedented study of structural maturation in hiPSC-CMs.

36 MATERIALS SCIENCE↗
DOE OSTI2020

The changing mouse embryo transcriptome at whole tissue and single-cell resolution

During mammalian embryogenesis, differential gene expression gradually builds the identity and complexity of each tissue and organ system 1 . Here we systematically quantified mouse polyA-RNA from day 10.5 of embryonic development to birth, sampling 17 tissues and organs. The resulting developmental transcriptome is globally structured by dynamic cytodifferentiation, body-axis and cell-proliferation gene sets that were further characterized by the transcription factor motif codes of their promoters. We decomposed the tissue-level transcriptome using single-cell RNA-seq (sequencing of RNA reverse transcribed into cDNA) and found that neurogenesis and haematopoiesis dominate at both the gene and cellular levels, jointly accounting for one-third of differential gene expression and more than 40% of identified cell types. By integrating promoter sequence motifs with companion ENCODE epigenomic profiles, we identified a prominent promoter de-repression mechanism in neuronal expression clusters that was attributable to known and novel repressors. Focusing on the developing limb, single-cell RNA data identified 25 candidate cell types that included progenitor and differentiating states with computationally inferred lineage relationships. We extracted cell-type transcription factor networks and complementary sets of candidate enhancer elements by using single-cell RNA-seq to decompose integrative cis -element (IDEAS) models that were derived from whole-tissue epigenome chromatin data. These ENCODE reference data, computed network components and IDEAS chromatin segmentations are companion resources to the matching epigenomic developmental matrix, and are available for researchers to further mine and integrate.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Integrative analysis of the 3D genome and epigenome in mouse embryonic tissues

While a rich set of putative cis-regulatory sequences involved in mouse fetal development have been annotated recently on the basis of chromatin accessibility and histone modification patterns, delineating their role in developmentally regulated gene expression continues to be challenging. To fill this gap, here we mapped chromatin contacts between gene promoters and distal sequences across the genome in seven mouse fetal tissues and across six developmental stages of the forebrain. We identified 248,620 long-range chromatin interactions centered at 14,138 protein-coding genes and characterized their tissue-to-tissue variations and developmental dynamics. Integrative analysis of the interactome with previous epigenome and transcriptome datasets from the same tissues revealed a strong correlation between the chromatin contacts and chromatin state at distal enhancers, as well as gene expression patterns at predicted target genes. We predicted target genes of 15,098 candidate enhancers and used them to annotate target genes of homologous candidate enhancers in the human genome that harbor risk variants of human diseases. We present evidence that schizophrenia and other adult disease risk variants are frequently found in fetal enhancers, providing support for the hypothesis of fetal origins of adult diseases.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

EVAP: A two-photon imaging tool to study conformational changes in endogenous Kv2 channels in live tissues

A primary goal of molecular physiology is to understand how conformational changes of proteins affect the function of cells, tissues, and organisms. Here, we describe an imaging method for measuring the conformational changes of the voltage sensors of endogenous ion channel proteins within live tissue, without genetic modification. We synthesized GxTX-594, a variant of the peptidyl tarantula toxin guangxitoxin-1E, conjugated to a fluorophore optimal for two-photon excitation imaging through light-scattering tissue. We term this tool EVAP (Endogenous Voltage-sensor Activity Probe). GxTX-594 targets the voltage sensors of Kv2 proteins, which form potassium channels and plasma membrane–endoplasmic reticulum junctions. GxTX-594 dynamically labels Kv2 proteins on cell surfaces in response to voltage stimulation. To interpret dynamic changes in fluorescence intensity, we developed a statistical thermodynamic model that relates the conformational changes of Kv2 voltage sensors to degree of labeling. We used two-photon excitation imaging of rat brain slices to image Kv2 proteins in neurons. We found puncta of GxTX-594 on hippocampal CA1 neurons that responded to voltage stimulation and retain a voltage response roughly similar to heterologously expressed Kv2.1 protein. Our findings show that EVAP imaging methods enable the identification of conformational changes of endogenous Kv2 voltage sensors in tissue.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Small-angle X-ray microdiffraction from fibrils embedded in tissue thin sections

Small-angle X-ray scattering (SAXS) from fibrils embedded in a fixed, thin section of tissue includes contributions from the fibrils, the polymeric matrix surrounding the fibrils, other constituents of the tissue, and cross-terms due to the spatial correlation between fibrils and neighboring molecules. This complex mixture severely limits the amount of information that can be extracted from scattering studies. However, availability of micro- and nano-beams has made the measurement of scattering from very small volumes possible, which, in some cases, may be dominated by a single fibrillar constituent. In such cases, information about the predominant species may be accessible. Nevertheless, even in these cases, the correlations between the positions of fibrils and other constituents have a significant impact on the observed scattering. Here, strategies are proposed to extract partial information about fibril structure and tissue organization on the basis of SAXS from samples of this type. It is shown that the spatial correlation function of the fibril in the direction perpendicular to the fibril axis can be computed and contains information about the predominant fibril structure and the organization of the surrounding tissue matrix. This has significant advantages over approaches based on techniques developed for X-ray solution scattering. Examples of correlation calculations in different types of samples are given to demonstrate the information that can be obtained from these measurements.

36 MATERIALS SCIENCE↗
DOE OSTI2024

Characterization of sub-micrometre-sized voids in fixed human brain tissue using scanning X-ray microdiffraction

Using a 5 µm-diameter X-ray beam, we collected scanning X-ray microdiffraction in both the small-angle (SAXS) and the wide-angle (WAXS) regimes from thin sections of fixed human brain tissue from Alzheimer's subjects. The intensity of scattering in the SAXS regime of these patterns exhibits essentially no correlation with the observed intensity in the WAXS regime, indicating that the structures responsible for these two portions of the diffraction patterns, which reflect different length scales, are distinct. SAXS scattering exhibits a power-law behavior in which the log of intensity decreases linearly with the log of the scattering angle. The slope of the log–log curve is roughly proportional to the intensity in the SAXS regime and, surprisingly, inversely proportional to the intensity in the WAXS regime. We interpret these observations as being due to the presence of sub-micrometre-sized voids formed during dehydration of the fixed tissue. The SAXS intensity is due largely to scattering from these voids, while the WAXS intensity derives from the secondary structures of macromolecular material surrounding the voids. The ability to detect and map the presence of voids within thin sections of fixed tissue has the potential to provide novel information on the degradation of human brain tissue in neurodegenerative diseases.

Chemistry↗