Search NASA⌕ Search

SEARCH · Search NASA

Results for “inducible expression”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 55 records · Page 3
All sourcesNASA NTRSDOE OSTI
DOE OSTI2026

MassIVE MSV000100641 - Multilayered regulation by RNA thermometers enables precise control of Cas9 expression in E. coli: Cas9-based genome editing technologies can rapidly generate mutations to probe a diverse array of mutant genotypes. However, aberrant Cas9 nuclease translation and activity can occur despite the use of inducible promoters to control expression, leading to extensive cell death. This background killing caused by promoter leakiness severely limits the application of Cas9 for generating mutant libraries because of the potential for population skew. We demonstrate the utility of temperature sensitive RNA elements as a layer of post-transcriptional regulation to reduce the impact of promoter leak. We observe significant temperature-dependent increases in cell survival when certain RNA thermometers (RNATs) are placed upstream of the cas9 coding sequence. We also show that the most highly repressing RNAT, hsp17rep, significantly reduces population skew with a library of characterized guide RNAs in Escherichia coli. This strategy should be applicable to all bacterial Cas9-based methods and technologies.

Explore the source record for details and available documents.

Alexander, William G. [Oak Ridge National Laborato↗
DOE OSTI2021

Protective effect of SIRT6 on cholesterol crystal-induced endothelial dysfunction via regulating ACE2 expression

Highlights: • ACE2 was involved in CC-induced endothelial dysfunction. • SIRT1 and SIRT6 contributed to regulating the protein expression of ACE2 in CC-stimulated endothelial cells. • SIRT6 regulated ACE2 with intranuclear p-ATF2, but not affecting p-ATF2 expression in the cytoplasm. Sirtuins are a family of highly conserved nicotinamide adenine dinucleotide (NAD{sup +})-dependent enzymes. Among the sirtuins, SIRT1 and SIRT6 participate in the regulation of endothelial functions and play significant roles in the physiological and pathological processes of cardiovascular diseases (CVD). Recently, our study found that minute cholesterol crystals (CC) can be endocytosed by endothelial cells and further impair endothelial functions. Since previous studies have reported that angiotensin-converting enzyme (ACE2) involves Angiotensin (Ang) II-induced inflammation in endothelial cells, this study was designed to investigate the role of SIRT1 and SIRT6 in CC-induced variation of ACE2 expression and the related mechanism between SIRT6 and ACE2. We found that ACE2 is involved in CC-induced endothelial dysfunction, which inhibits decreases in nitric oxide (NO) level and endothelial nitric oxide synthase (eNOS) activity and increases in inflammatory factors and adhesion molecules. Besides, SIRT1 and SIRT6 regulated the protein expression of ACE2 in CC-stimulated human umbilical vein endothelial cells (HUVECs). Moreover, bioinformatics analysis from the Enrichr database indicated that activating transcription factor 2 (ATF2), is highly correlated with genes that significantly upregulated after infection with the SIRT6 adenovirus vector. In CC-induced HUVECs, ACE2 expression was up-regulated in cells transfected with ATF2 siRNA. However, further mechanism studies revealed that overexpression of SIRT6 decreases the accumulation of p-ATF2 in the nucleus, but did not affect p-ATF2 expression in the cytoplasm. Taken together, these data indicated that SIRT6 regulates ACE2 might via inhibiting the accumulation of nucleus p-ATF2 in CC-induced endothelial dysfunction.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2022

Functional Divergence in a Multi-gene Family Is a Key Evolutionary Innovation for Anaerobic Growth in Saccharomyces cerevisiae

The amplification and diversification of genes into large multi-gene families often mark key evolutionary innovations, but this process often creates genetic redundancy that hinders functional investigations. When the model budding yeast Saccharomyces cerevisiae transitions to anaerobic growth conditions, the cell massively induces the expression of seven serine/threonine-rich anaerobically-induced cell wall mannoproteins (anCWMPs): TIP1, TIR1, TIR2, TIR3, TIR4, DAN1, and DAN4. Here, we show that these genes likely derive evolutionarily from a single ancestral anCWMP locus, which was duplicated and translocated to new genomic contexts several times both prior to and following the budding yeast whole genome duplication (WGD) event. Based on synteny and their phylogeny, we separate the anCWMPs into four gene subfamilies. To resolve prior inconclusive genetic investigations of these genes, we constructed a set of combinatorial deletion mutants to determine their contributions toward anaerobic growth in S. cerevisiae. We found that two genes, TIR1 and TIR3, were together necessary and sufficient for the anCWMP contribution to anaerobic growth. Overexpressing either gene alone was insufficient for anaerobic growth, implying that they encode non-overlapping functional roles in the cell during anaerobic growth. We infer from the phylogeny of the anCWMP genes that these two important genes derive from an ancient duplication that predates the WGD event, whereas the TIR1 subfamily experienced gene family amplification after the WGD event. Taken together, the genetic and molecular evidence suggests that one key anCWMP gene duplication event, several auxiliary gene duplication events, and functional divergence underpin the evolution of anaerobic growth in budding yeasts.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

CsbZIP2-miR9748-CsNPF4.4 Module Mediates High Temperature Tolerance of Cucumber Through Jasmonic Acid Pathway

High temperature stress seriously affects the growth of cucumber seedlings, and even leads to a decline in yield and quality. miRNAs have been shown to be involved in regulating the response to stress in plants, but little is known about its effects on cucumber high temperature stress tolerance. Here, we found that high temperature stress induced the expression of miR9748 in cucumber. Overexpression of cucumber miR9748 in Arabidopsis improved high temperature tolerance. Transcriptome analysis revealed that miR9748 might mediate high temperature tolerance through plant hormone signal pathway. 5′ RNA ligase-mediated rapid amplification of cDNA ends (5′ RLM-RACE) and transient transformation technology demonstrated that CsNPF4.4 was the target gene of miR9748. CsNPF4.4 overexpression plants decreased high temperature tolerance accompanied by reducing the content of jasmonic acid (JA), but alleviated by foliar application of methyl jasmonate, indicating that CsNPF4.4 negatively regulated high temperature stress tolerance through inhibition JA signal pathway. Furthermore, high temperature stress also increased the expression level of CsbZIP2 . Yeast one-hybrid and dual-luciferase assays showed that CsbZIP2 directly bound to the promoter of MIR9748 to induce its expression. Taken together, our results indicated that CsbZIP2 directly regulated miR9748 expression to cleave CsNPF4.4 to mediate high temperature tolerance through JA pathway.

Li, Lan↗
DOE OSTI2021

Serum amyloid A1: Innocent bystander or active participant in cell migration in triple-negative breast cancer?

Highlights: • SAA1 knockdown reduced cell viability in triple-negative breast cancer cells. • SAA1 knockdown induced a S to G{sub 2}/M cell cycle shift in MDA-MB-231 cells. • SAA1 silencing inhibited cell migration in MDA-MB-231 and HCC70 cells. • SAA1 silencing altered epithelial-to-mesenchymal transition markers in MDA-MB-231 cells. The Serum Amyloid A (SAA) family of proteins is associated with various pathological conditions, including cancer. However, their role in cancer is incompletely understood. Here, we investigated the role of SAA1 in cell cycle regulation, apoptosis, survival signaling, metabolism, and metastasis in models of triple-negative breast cancer (TNBC), using RNAi. Our data show that in untransformed epithelial cells (MCF12A), the knockdown of SAA1 induces the expression of cell cycle regulators (MCM2, p53), the activation of DNA repair (PARP synthesis), and survival signaling (NFκB). In contrast, knockdown of SAA1 in the TNBC cell line (MDA-MB-231) induced the expression p16 and shifted cells in the cell cycle from the S to G{sub 2}/M phase, without the activation of DNA repair. Moreover, in SAA1-deficient MDA-MB-231 and HCC70 cells, metabolism (NADH oxidation) continually increased while cell migration (% wound closure and the rate of wound closure) decreased. However, silencing of SAA1 altered epithelial and mesenchymal markers in MCF12A (E-cadherin, Laminin 1β, Vimentin) and MDA-MB-231 (α-Smooth muscle actin) cells, associated with the metastatic program of epithelial-mesenchymal transition. Nonetheless, our data provide evidence that SAA1 could potentially serve as a therapeutic target in TNBC.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Lignin engineering in poplar via heterologous expression of dehydroshikimate dehydratase induces distinct transcriptional and metabolic changes in the shikimate and phenylpropanoid pathways

Understanding how crops respond to such genetic modifications at the transcriptional and metabolic levels is needed to facilitate further improvement and field deployment. In this work, we gathered some fundamental knowledge on lignin-modified QsuB poplar grown in a greenhouse using RNA-seq and metabolomics.

Aromatics↗
DOE OSTI2023

Cloning and expression vectors and systems

Vectors for cloning, maintaining and expressing a wide range of coding sequences in inducible T7 expression systems in Escherichia coli expression hosts are disclosed herein. Target genes that can be stably maintained and expressed include those that specify proteins that are highly toxic to the host cell. Different configurations of vectors and expression hosts provide different rates of transcription and translation of target genes and therefore different rates of accumulation of target proteins. Methods for cloning by asymmetric ligation and co-expression of more than one target protein in a single vector are also disclosed, as are variants of BL21(DE3) having lower basal transcription by T7 RNA polymerase.

Studier, F. William↗
DOE OSTI2021

KIF18b-dependent hypomethylation of PARPBP gene promoter enhances oxaliplatin resistance in colorectal cancer

Highlights: • High expression of PARPBP promotes oxaliplatin resistance of CRC. • KIF18b induces PARPBP expression by suppressing promoter methylation. • SP1 recruits DNMT3b to methylate PARPBP promoter. • KIF18b disturbs the recruitment of DNMT3b to PARPBP promoter. As the new platinum drug oxaliplatin has been widely used in clinical treatment of colorectal cancer (CRC), oxaliplatin resistance has become a burning problem. In this study, higher expression of PARP-1 binding protein (PARPBP) was detected in oxaliplatin-resistant CRC (OR-CRC) cells than in non-resistant cells. Further research showed that kinesin family member 18 b (KIF18b) induced the overexpression of PARPBP, sustaining oxaliplatin resistance in OR-CRC cells. Through exploring the PARPBP gene promoter, we found that SP1-recruited DNMT3b methylated PARPBP promoter to suppress transcription in CRC cells, and increased KIF18b attenuated the recruitment of DNMT3b to PARPBP promoter by directly interacting with SP1 in OR-CRC cells. Clinical analysis suggested a positive relationship between KIF18b and PARPBP in CRC tissues and indicated poor prognosis in CRC patients with high level of KIF18b or PARPBP. In summary, KIF18b-induced PARPBP contributes to the resistant phenotype of OR-CRC.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2023

Efficient gene activation in plants by the MoonTag programmable transcriptional activator

Abstract CRISPR/Cas-based transcriptional activators have been developed to induce gene expression in eukaryotic and prokaryotic organisms. The main advantages of CRISPR/Cas-based systems is that they can achieve high levels of transcriptional activation and are very easy to program via pairing between the guide RNA and the DNA target strand. SunTag is a second-generation system that activates transcription by recruiting multiple copies of an activation domain (AD) to its target promoters. SunTag is a strong activator; however, in some species it is difficult to stably express. To overcome this problem, we designed MoonTag, a new activator that works on the same basic principle as SunTag, but whose components are better tolerated when stably expressed in transgenic plants. We demonstrate that MoonTag is capable of inducing high levels of transcription in all plants tested. In Setaria, MoonTag is capable of inducing high levels of transcription of reporter genes as well as of endogenous genes. More important, MoonTag components are expressed in transgenic plants to high levels without any deleterious effects. MoonTag is also able to efficiently activate genes in eudicotyledonous species such as Arabidopsis and tomato. Finally, we show that MoonTag activation is functional across a range of temperatures, which is promising for potential field applications.

42 ENGINEERING↗
DOE OSTI2021

The oncogenic role of meiosis-specific Aurora kinase C in mitotic cells

Highlights: • AURKC is expressed in meiotic cells and some cancers. • AURKC expression increases cell migration and transformation of human mitotic cells. • Deletion of AURKC in U2OS cells decreases cell migration and soft agar growth. • Transcriptome analysis reveals that AURKC alters the extracellular matrix. Aberrant expression of meiosis-specific genes in cancer has recently emerged as a driver of some cancer formation. Aurora kinase C (AURKC) is a member of the Aurora kinase family of proteins known to regulate chromosome segregation during cell divisions. AURKC is normally expressed in meiotic cells; however, elevated levels of AURKC mRNA and protein are frequently measured in cancer cells. To understand the function of AURKC in cancer cells, expression was induced in noncancerous, human retina pigmented epithelial cells. While AURKC expression did not alter cell proliferation over 72 h, it did increase cell migration and anchorage independent growth in soft agar suggesting an oncogenic role in mitotically dividing cells. To evaluate AURKC as a potential therapeutic target, a frameshift mutation in the gene was introduced in U2OS osteosarcoma cells using CRISPR-Cas9 technology resulting in a premature stop codon. Cancer cells lacking AURKC displayed no change in cell proliferation over 72 h but did migrate less and formed fewer colonies in soft agar. Whole transcriptome sequencing analysis uncovered over 400 differentially expressed genes in U2OS cells with and without AURKC. GO analysis revealed alterations in proteinaceous extracellular matrix genes including COL1A1. These data indicate that therapeutics targeting AURKC could decrease cancer cell metastasis and disease progression. Because AURKC is transcriptionally silenced in normal mitotic cells, its disruption could specifically target cancer cells limiting the toxic side effects associated with current therapeutics.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2024

Redox active plant phenolic, acetosyringone, for electrogenetic signaling

Abstract Redox is a unique, programmable modality capable of bridging communication between biology and electronics. Previous studies have shown that the E. coli redox-responsive OxyRS regulon can be re-wired to accept electrochemically generated hydrogen peroxide (H 2 O 2 ) as an inducer of gene expression. Here we report that the redox-active phenolic plant signaling molecule acetosyringone (AS) can also induce gene expression from the OxyRS regulon. AS must be oxidized, however, as the reduced state present under normal conditions cannot induce gene expression. Thus, AS serves as a “pro-signaling molecule” that can be activated by its oxidation—in our case by application of oxidizing potential to an electrode. We show that the OxyRS regulon is not induced electrochemically if the imposed electrode potential is in the mid-physiological range. Electronically sliding the applied potential to either oxidative or reductive extremes induces this regulon but through different mechanisms: reduction of O 2 to form H 2 O 2 or oxidation of AS. Fundamentally, this work reinforces the emerging concept that redox signaling depends more on molecular activities than molecular structure. From an applications perspective, the creation of an electronically programmed “pro-signal” dramatically expands the toolbox for electronic control of biological responses in microbes, including in complex environments, cell-based materials, and biomanufacturing.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Transcript profiling of plastid ferrochelatase two mutants reveals that chloroplast singlet oxygen signals lead to global changes in RNA profiles and are mediated by Plant U-Box 4

Abstract Background In response to environmental stresses, chloroplasts generate reactive oxygen species, including singlet oxygen ( 1 O 2 ), an excited state of oxygen that regulates chloroplast-to-nucleus (retrograde) signaling, chloroplast turnover, and programmed cell death (PCD). Yet, the central signaling mechanisms and downstream responses remain poorly understood. TheArabidopsis thaliana plastid ferrochelatase two(fc2) mutant conditionally accumulates 1 O 2 , and Plant U-Box 4 (PUB4), a cytoplasmic E3 ubiquitin ligase, is involved in propagating 1 O 2 signals for chloroplast turnover and cellular degradation. Thus, thefc2andfc2 pub4mutants are useful genetic tools to elucidate these signaling pathways. Previous studies have focused on the role of 1 O 2 in promoting cellular degradation infc2mutants, but its impact on retrograde signaling from mature chloroplasts (the major site of 1 O 2 production) is poorly understood. Results To gain mechanistic insights into 1 O 2 signaling pathways, we compared transcriptomes of adult wt,fc2, andfc2 pub4plants. The accumulation of 1 O 2 infc2plants broadly repressed genes involved in chloroplast function and photosynthesis, while inducing genes and transcription factors involved in abiotic and biotic stress, the biosynthesis of jasmonic acid (JA) and salicylic acid (SA), microautophagy, and senescence. Elevated JA and SA levels were observed in 1 O 2 -stressedfc2plants.pub4reversed most of this 1 O 2 -induced gene expression and reduced the JA content infc2plants. Thepub4mutation also blocked JA-induced senescence pathways in the dark. However, fc2 pub4 plantsmaintained constitutively elevated levels of SA even in the absence of bulk 1 O 2 accumulation. Conclusions Together, this work demonstrates that infc2plants, 1 O 2 leads to a robust retrograde signal that may protect cells by downregulating photosynthesis and ROS production while simultaneously mounting a stress response involving SA and JA. The induction of microautophagy and senescence pathways indicate that 1 O 2 -induced cellular degradation is a genetic response to this stress, and the bulk of this transcriptional response is modulated by the PUB4 protein. However, the effect ofpub4on hormone synthesis and signaling is complex and indicates that an intricate interplay of SA and JA are involved in promoting stress responses and programmed cell death during photo-oxidative damage.

Plant Sciences↗
DOE OSTI2022

Citrus FRIGIDA cooperates with its interaction partner dehydrin to regulate drought tolerance

SUMMARY Drought is a major environmental stress that severely affects plant growth and crop productivity. FRIGIDA ( FRI ) is a key regulator of flowering time and drought tolerance in model plants. However, little is known regarding its functions in woody plants, including citrus. Thus, we explored the functional role of the citrus FRI ortholog ( CiFRI ) under drought. Drought treatment induced CiFRI expression. CiFRI overexpression enhanced drought tolerance in transgenic Arabidopsis and citrus, while CiFRI suppression increased drought susceptibility in citrus. Moreover, transcriptomic profiling under drought conditions suggested that CiFRI overexpression altered the expression of numerous genes involved in the stress response, hormone biosynthesis, and signal transduction. Mechanistic studies revealed that citrus dehydrin likely protects CiFRI from stress‐induced degradation, thereby enhancing plant drought tolerance. In addition, a citrus brassinazole‐resistant (BZR) transcription factor family member ( CiBZR1 ) directly binds to the CiFRI promoter to activate its expression under drought conditions. CiBZR1 also enhanced drought tolerance in transgenic Arabidopsis and citrus. These findings further our understanding of the molecular mechanisms underlying the CiFRI ‐mediated drought stress response in citrus.

Xu, Yuan‐Yuan↗
DOE OSTI2024

Bioactivity Profiling of Chemical Mixtures for Hazard Characterization

Abstract The assessment and regulation of chemical toxicity to protect human health and the environment are done one chemical at a time and seldom at environmentally relevant concentrations. However, chemicals are found in the environment as mixtures, and their toxicity is largely unknown. Understanding the hazard posed by chemicals within the mixture is critical to enforce protective measures. Here, we demonstrate the application of bioactivity profiling of environmental water samples using the sentinel and ecotoxicology model species Daphnia to reveal the biomolecular response induced by exposure to real-world mixtures. We exposed a Daphnia strain to 30 sampled waters of the Chaobai River and measured the gene expression response profiles. Using a multiblock correlation analysis, we establish correlations between chemical mixtures identified in 30 water samples with gene expression patterns induced by these chemical mixtures. We identified 80 metabolic pathways putatively activated by mixtures of inorganic ions, heavy metals, polycyclic aromatic hydrocarbons, industrial chemicals, and a set of biocides, pesticides, and pharmacologically active substances. Our data-driven approach discovered both known bioactivity signatures with previously described modes of action and new pathways linked to undiscovered potential hazards. This study demonstrates the feasibility of reducing the complexity of real-world mixture toxicity to characterize the biomolecular effects of a defined number of chemical components based on gene expression monitoring of the sentinel species Daphnia.

Engineering↗
DOE OSTI2021

Dl-3-n-butylphthalide promotes neurite outgrowth of primary cortical neurons by Sonic Hedgehog signaling via upregulating Gap43

Highlights: • NBP promoted neurite outgrowth in immature primary cortical neurons. • NBP increased axon and dendrite extension in mature primary cortical neurons. • NBP promoted neuritogenesis and neuronal plasticity via Shh signaling pathway. • The Shh signaling pathway increased Gap43 expression in primary cortical neuron. • NBP promoted neurite outgrowth by Shh signaling via upregulating Gap43 expression. Neurite outgrowth is the basis for wiring during the development of the nervous system. Dl-3-n-butylphthalide (NBP) has been recognized as a promising treatment to improve behavioral, neurological and cognitive outcomes in ischemic stroke. However, little is known about the effect and mechanism of NBP on the neurite outgrowth. In this study, we used different methods to investigate the potential effects of NBP on the neurite extension and plasticity of immature and mature primary cortical neurons and explored the underlying mechanisms. Our results demonstrated that in immature and mature cortical neurons, NBP promoted the neurite length and intersections, increased neuritic arborization, elevated numbers of neurite branch and terminal points and improved neurite complexity and plasticity of neuronal development processes. Besides, our data revealed that NBP promoted neurite extension and branching partly by activating Shh signaling pathway via increasing Gap43 expression both in immature and mature primary cortical neurons. The present study provided new insights into the contribution of NBP in neuronal plasticity and unveiled a novel pathway to induce Gap43 expression in primary cortical neurons.

60 APPLIED LIFE SCIENCES↗