Search NASA⌕ Search

SEARCH · Search NASA

Results for “transient gene expression”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 55 records · Page 3
All sourcesNASA NTRSDOE OSTI
DOE OSTI2021

Incorporating concentration-dependent sediment microbial activity into methylmercury production kinetics modeling

We report in anoxic environments, anaerobic microorganisms carrying the hgcAB gene cluster can mediate the transformation of inorganic mercury (Hg(II)) to monomethylmercury (MMHg). The kinetics of Hg(II) transformation to MMHg in periphyton from East Fork Poplar Creek (EFPC) in Oak Ridge, TN have previously been modeled using a transient availability model (TAM). The TAM for Hg(II) methylation combines methylation/demethylation kinetics with kinetic expressions for processes that decrease Hg(II) and MMHg availability for methylation and demethylation (multisite sorption of Hg(II) and MMHg, Hg(II) reduction/Hg(0) oxidation). In this study, the TAM is used for the first time to describe MMHg production in sediment. We assessed MMHg production in sediment microcosms using two different sediment types from EFPC: a relatively anoxic, carbon-rich sediment with higher microbial activity (higher CO 2 production from sediment) and a relatively oxic, sandy, carbon-poor sediment with lower microbial activity (lower CO 2 production from sediment). Based on 16s rRNA sequencing, the overall microbial community structure in the two sediments was retained during the incubations. However, the hgcA containing methanogenic Euryarchaeota communities differed between sediment types and their growth followed different trajectories over the course of incubations, potentially contributing to the distinct patterns of MMHg production observed. The general TAM paradigm performed well in describing MMHg production in the sediments. However, the MMHg production and ancillary data suggested the need to revise the model structure to incorporate terms for concentration-dependent microbial activity over the course of the incubations. We modified the TAM to include Monod-type kinetics for methylation and demethylation and observed an improved fit for the carbon-rich, microbially active sediment. Overall our work shows that the TAM can be applied to describe Hg(II) methylation in sediments and that including expressions accounting for concentration-dependent microbial activity can improve the accuracy of the model description of the data in some cases.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2023

Bacterium-enabled transient gene activation by artificial transcription factors for resolving gene regulation in maize

Abstract Understanding gene regulatory networks is essential to elucidate developmental processes and environmental responses. Here, we studied regulation of a maize (Zea mays) transcription factor gene using designer transcription activator-like effectors (dTALes), which are synthetic Type III TALes of the bacterial genus Xanthomonas and serve as inducers of disease susceptibility gene transcription in host cells. The maize pathogen Xanthomonas vasicola pv. vasculorum was used to introduce 2 independent dTALes into maize cells to induced expression of the gene glossy3 (gl3), which encodes a MYB transcription factor involved in biosynthesis of cuticular wax. RNA-seq analysis of leaf samples identified, in addition to gl3, 146 genes altered in expression by the 2 dTALes. Nine of the 10 genes known to be involved in cuticular wax biosynthesis were upregulated by at least 1 of the 2 dTALes. A gene previously unknown to be associated with gl3, Zm00001d017418, which encodes aldehyde dehydrogenase, was also expressed in a dTALe-dependent manner. A chemically induced mutant and a CRISPR-Cas9 mutant of Zm00001d017418 both exhibited glossy leaf phenotypes, indicating that Zm00001d017418 is involved in biosynthesis of cuticular waxes. Bacterial protein delivery of dTALes proved to be a straightforward and practical approach for the analysis and discovery of pathway-specific genes in maize.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

CRISPR/Cas9 Directed Reprogramming of iPSC for Accelerated Motor Neuron Differentiation Leads to Dysregulation of Neuronal Fate Patterning and Function

Neurodegeneration causes a significant disease burden and there are few therapeutic interventions available for reversing or slowing the disease progression. Induced pluripotent stem cells (iPSCs) hold significant potential since they are sourced from adult tissue and have the capacity to be differentiated into numerous cell lineages, including motor neurons. This differentiation process traditionally relies on cell lineage patterning factors to be supplied in the differentiation media. Genetic engineering of iPSC with the introduction of recombinant master regulators of motor neuron (MN) differentiation has the potential to shorten and streamline cell developmental programs. We have established stable iPSC cell lines with transient induction of exogenous LHX3 and ISL1 from the Tet-activator regulatory region and have demonstrated that induction of the transgenes is not sufficient for the development of mature MNs in the absence of neuron patterning factors. Comparative global transcriptome analysis of MN development from native and Lhx-ISL1 modified iPSC cultures demonstrated that the genetic manipulation helped to streamline the neuronal patterning process. However, leaky gene expression of the exogenous MN master regulators in iPSC resulted in the premature activation of genetic pathways characteristic of the mature MN function. Dysregulation of metabolic and regulatory pathways within the developmental process affected the MN electrophysiological responses.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

In planta production of the nylon precursor beta-ketoadipate

Beta-ketoadipate (βKA) is an intermediate of the βKA pathway involved in the degradation of aromatic compounds in several bacteria and fungi. Beta-ketoadipate also represents a promising chemical for the manufacturing of performance-advantaged nylons. We established a strategy for the in planta synthesis of βKA via manipulation of the shikimate pathway and the expression of bacterial enzymes from the βKA pathway. Using Nicotiana benthamiana as a transient expression system, we demonstrated the efficient conversion of protocatechuate (PCA) to βKA when plastid-targeted bacterial-derived PCA 3,4-dioxygenase (PcaHG) and 3-carboxy-cis,cis-muconate cycloisomerase (PcaB) were co-expressed with 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (AroG) and 3-dehydroshikimate dehydratase (QsuB). This metabolic pathway was reconstituted in Arabidopsis by introducing a construct (pAtβKA) with stacked pcaG, pcaH, and pcaB genes into a PCA-overproducing genetic background that expresses AroG and QsuB (referred as QsuB-2). The resulting QsuB-2 x pAtβKA stable lines displayed βKA titers as high as 0.25 % on a dry weight basis in stems, along with a drastic reduction in lignin content and improvement of biomass saccharification efficiency compared to wild-type controls, and without any significant reduction in biomass yields. Using biomass sorghum as a potential crop for large-scale βKA production, techno-economic analysis indicated that βKA accumulated at titers of 0.25 % and 4 % on a dry weight basis could be competitively priced in the range of $2.04-34.49/kg and $0.47-2.12/kg, respectively, depending on the selling price of the residual biomass recovered after βKA extraction. This study lays the foundation for a more environmentally-friendly synthesis of βKA using plants as production hosts.

Kazaz, Sami↗
DOE OSTI2023

Simultaneous carbon catabolite repression governs sugar and aromatic co-utilization in Pseudomonas putida M2

ABSTRACT Pseudomonas putida have emerged as promising biocatalysts for the conversion of sugars and aromatic compounds obtained from lignocellulosic biomass. Understanding the role of carbon catabolite repression (CCR) in these strains is critical to optimize biomass conversion to fuels and chemicals. The CCR functioning in P. putida M2, a strain capable of consuming both hexose and pentose sugars as well as aromatic compounds, was investigated by cultivation experiments, proteomics, and CRISPRi-based gene repression. Strain M2 co-utilized sugars and aromatic compounds simultaneously; however, during cultivation with glucose and aromatic compounds ( p- coumarate and ferulate) mixture, intermediates (4-hydroxybenzoate and vanillate) accumulated, and substrate consumption was incomplete. In contrast, xylose-aromatic consumption resulted in transient intermediate accumulation and complete aromatic consumption, while xylose was incompletely consumed. Proteomics analysis revealed that glucose exerted stronger repression than xylose on the aromatic catabolic proteins. Key glucose (Eda) and xylose (XylX) catabolic proteins were also identified at lower abundance during cultivation with aromatic compounds implying simultaneous catabolite repression by sugars and aromatic compounds. Reduction of crc expression via CRISPRi led to faster growth and glucose and p -coumarate uptake in the CRISPRi strains compared to the control, while no difference was observed on xylose+ p -coumarate. The increased abundances of Eda and amino acid biosynthesis proteins in the CRISPRi strain further supported these observations. Lastly, small RNAs (sRNAs) sequencing results showed that CrcY and CrcZ homologues levels in M2, previously identified in P. putida strains, were lower under strong CCR (glucose+ p -coumarate) condition compared to when repression was absent ( p -coumarate or glucose only). IMPORTANCE A newly isolated Pseudomonas putida strain, P. putida M2, can utilize both hexose and pentose sugars as well as aromatic compounds making it a promising host for the valorization of lignocellulosic biomass. Pseudomonads have developed a regulatory strategy, carbon catabolite repression, to control the assimilation of carbon sources in the environment. Carbon catabolite repression may impede the simultaneous and complete metabolism of sugars and aromatic compounds present in lignocellulosic biomass and hinder the development of an efficient industrial biocatalyst. This study provides insight into the cellular physiology and proteome during mixed-substrate utilization in P. putida M2. The phenotypic and proteomics results demonstrated simultaneous catabolite repression in the sugar-aromatic mixtures, while the CRISPRi and sRNA sequencing demonstrated the potential role of the crc gene and small RNAs in carbon catabolite repression.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Anaerobic Microbial Metabolism of Dichloroacetate

Dichloroacetate (DCA) commonly occurs in the environment due to natural production and anthropogenic releases, but its fate under anoxic conditions is uncertain. Mixed culture RM comprising “Candidatus Dichloromethanomonas elyunquensis” strain RM utilizes DCA as an energy source, and the transient formation of formate, H 2 , and carbon monoxide (CO) was observed during growth. Only about half of the DCA was recovered as acetate, suggesting a fermentative catabolic route rather than a reductive dechlorination pathway. Sequencing of 16S rRNA gene amplicons and 16S rRNA gene-targeted quantitative real-time PCR (qPCR) implicated “Candidatus Dichloromethanomonas elyunquensis” strain RM in DCA degradation. An (S)-2-haloacid dehalogenase (HAD) encoded on the genome of strain RM was heterologously expressed, and the purified HAD demonstrated the cofactor-independent stoichiometric conversion of DCA to glyoxylate at a rate of 90 ± 4.6 nkat mg -1 protein. Differential protein expression analysis identified enzymes catalyzing the conversion of DCA to acetyl coenzyme A (acetyl-CoA) via glyoxylate as well as enzymes of the Wood-Ljungdahl pathway. Glyoxylate carboligase, which catalyzes the condensation of two molecules of glyoxylate to form tartronate semialdehyde, was highly abundant in DCA-grown cells. The physiological, biochemical, and proteogenomic data demonstrate the involvement of an HAD and the Wood-Ljungdahl pathway in the anaerobic fermentation of DCA, which has implications for DCA turnover in natural and engineered environments, as well as the metabolism of the cancer drug DCA by gut microbiota.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Genome reduction improves octanoic acid production in scale down bioreactors

Microorganisms in large-scale bioreactors are exposed to heterogeneous environmental conditions due to physical mixing constraints. Nutritional gradients can lead to transient expression of energetically wasteful stress responses and as a result, can reduce the titres, rates and yields of a bioprocess at larger scales. To what extent these process parameters are impacted is often unknown and therefore bioprocess scale-up comes with major risk. Designing platform strains to account for these intermittent stresses before introducing synthesis pathways is one strategy for de-risking bioprocess development. For example, Escherichia coli strain RM214 is a derivative of wild-type MG1655 that has had several genes and whole operons removed from its genome based on their metabolic cost. In this study, we engineered E. coli strain RM214 (referred to as WG02) to produce octanoic acid from glycerol in batch-flask and fed-batch bioreactor cultivations and compared it to an octanoic acid-producing E. coli MG1655 (WG01). In batch flask cultivations, the two strains performed similarly. However, in carbon limited fed-batch bioreactor cultivations, WG02 provided a greater than 22% boost to biomass compared to WG01 while maintaining similar titres of octanoic acid. Reducing the biomass accumulation of WG02 with nitrogen limited fed-batch cultivation resulted in a 16% improvement in octanoic acid titre over WG01. Finally, in a scale-down system consisting of a stirred tank reactor (representing a well-mixed zone) and plug flow reactor (representing an intermittent carbon starvation zone), WG02 again improved octanoic acid titre by almost 18% while maintaining similar biomass concentrations as WG01.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Effects of Perfluorinated Alkyl Substances (PFAS) on Amphibian Body and Liver Conditions: Is Lipid Metabolism Being Perturbed throughout Metamorphosis?

Per- and polyfluoroalkyl substances (PFAS) may interact with peroxisome proliferator activated receptors (PPARs) and alter lipid homeostasis. Using Xenopus laevis, we investigated the effect of PFAS on (a) lipid homeostasis and whether this correlated to changes in body and hepatic condition; (b) the expression of hepatic genes regulated by PPAR; and (c) the hepatic lipidome. We chronically exposed tadpoles to 0.5 µg/L of either PFOS, PFHxS, PFOA, PFHxA, a binary mixture of PFOS and PFHxS (0.5 µg/L of each), or a control, from NF stage 52 through metamorphic climax. Growth, development, and survival were not affected, but we detected a sex-specific decrease in body condition at NF 66 (6.8%) and in hepatic condition (16.6%) across metamorphic climax for male tadpoles exposed to PFOS. We observed weak evidence for the transient downregulation of apolipoprotein-V (apoa5) at NF 62 in tadpoles exposed to PFHxA. Acyl-CoA oxidase 1 (acox1) was downregulated only in males exposed to PFHxS (Ln(Fold Change) = −0.54). We detected PFAS-specific downregulation of structural glycerophospholipids, while semi-quantitative profiling detected the upregulation in numerous glycerophospholipids, sphingomyelins, and diglycerides. Overall, our findings indicate that PFAS can induce sex-specific effects that change across larval development and metamorphosis. We demonstrate that PFAS alter lipid metabolism at environmentally relevant concentrations through divergent mechanisms that may not be related to PPARs, with an absence of effects on body condition, demonstrating the need for more molecular studies to elucidate mechanisms of PFAS-induced lipid dysregulation in amphibians and in other taxa.

Bushong, Anna (ORCID:0000000249630578)↗
DOE OSTI2024

Paternal preconception alcohol consumption increased Angiotensin II‐mediated vasoconstriction in male offspring cerebral arteries via oxidative stress‐AT1R pathway

Abstract Alcohol consumption is popular worldwidely and closely associated with cardiovascular diseases. Influences of paternal preconception alcohol consumption on offspring cerebral arteries are largely unknown. Male rats were randomly given alcohol or water before being mated with alcohol‐naive females to produce alcohol‐ and control‐sired offspring. Middle cerebral artery (MCA) was tested with a Danish Myo Technology wire myograph, patch‐clamp, IONOPTIX, immunofluorescence and quantitative PCR. Alcohol consumption enhanced angiotensin II (AngII)‐mediated constriction in male offspring MCA mainly via AT1R. PD123,319 only augmented AngII‐induced constriction in control offspring. AngII and Bay K8644 induced stronger intracellular calcium transient in vascular smooth muscle cells (VSMCs) from MCA of alcohol offspring. L‐type voltage‐dependent calcium channel (L‐Ca 2+ ) current at baseline and after AngII‐stimulation was higher in VSMCs. Influence of large‐conductance calcium‐activated potassium channel (BK C a ) was lower. Caffeine induced stronger constriction and intracellular calcium release in alcohol offspring. Superoxide anion was higher in alcohol MCA than control. Tempol and thenoyltrifluoroacetone alleviated AngII‐mediated contractions, while inhibition was significantly higher in alcohol group. The mitochondria were swollen in alcohol MCA. Despite lower Kcnma1 and Prkce expression, many genes expressions were higher in alcohol group. Hypoxia induced reactive oxygen species production and increased AT1R expression in control MCA and rat aorta smooth muscle cell line. In conclusion, this study firstly demonstrated paternal preconception alcohol potentiated AngII‐mediated vasoconstriction in offspring MCA via ROS‐AT1R. Alcohol consumption increased intracellular calcium via L‐Ca 2+ channel and endoplasmic reticulum and decreased BK Ca function. The present study provided new information for male reproductive health and developmental origin of cerebrovascular diseases.

Zhang, Ze↗
DOE OSTI2021

Transient knockdown of Anopheles stephensi LRIM1 using RNAi increases Plasmodium falciparum sporozoite salivary gland infections

Abstract Background Plasmodium falciparum (Pf) sporozoites (PfSPZ) can be administered as a highly protective vaccine conferring the highest protection seen to date. Sanaria® PfSPZ vaccines are produced using aseptically reared Anopheles stephensi mosquitoes. The bionomics of sporogonic development of P. falciparum in A. stephensi to fully mature salivary gland PfSPZ is thought to be modulated by several components of the mosquito innate immune system. In order to increase salivary gland PfSPZ infections in A. stephensi and thereby increase vaccine production efficiency, a gene knock down approach was used to investigate the activity of the immune deficiency (IMD) signaling pathway downstream effector leucine-rich repeat immune molecule 1 ( LRIM1 ), an antagonist to Plasmodium development. Methods Expression of LRIM1 in A. stephensi was reduced following injection of double stranded (ds) RNA into mosquitoes. By combining the Gal4/UAS bipartite system with in vivo expression of short hairpin (sh) RNA coding for LRIM1 reduced expression of LRIM1 was targeted in the midgut, fat body, and salivary glands. RT-qPCR was used to demonstrate fold-changes in gene expression in three transgenic crosses and the effects on P. falciparum infections determined in mosquitoes showing the greatest reduction in LRIM1 expression. Results LRIM1 expression could be reduced, but not completely silenced, by expression of LRIM1 dsRNA. Infections of P. falciparum oocysts and PfSPZ were consistently and significantly higher in transgenic mosquitoes than wild type controls, with increases in PfSPZ ranging from 2.5- to tenfold. Conclusions Plasmodium falciparum infections in A. stephensi can be increased following reduced expression of LRIM1. These data provide the springboard for more precise knockout of LRIM1 for the eventual incorporation of immune-compromised A. stephensi into manufacturing of Sanaria’s PfSPZ products.

Billingsley, Peter F. (ORCID:0000000311424813)↗
DOE OSTI2024

Target of 1 Rapamycin kinase is a positive regulator of plant fatty acid 2 and lipid synthesis

In eukaryotes, Target of Rapamycin (TOR), a conserved protein sensor kinase, integrates a diverse set of environmental cues, including growth factor signals, energy availability, and nutritional status, to direct cell growth. In plants, TOR is activated by light and sugars and regulates a wide range of cellular processes, including protein synthesis and metabolism. Fatty acid synthesis is key to membrane biogenesis that in turn, is required for cell growth. To elucidate the primary regulatory role(s) of TOR in lipid metabolism, we followed fatty acid and lipid changes in plants with altered TOR protein levels or activity for short durations, using Nicotiana benthamiana leaves, Arabidopsis seedlings and Brassica napus cell suspension cultures. Transient expression of TOR significantly elevated the levels of total fatty acids in Nicotiana benthamiana leaves, while treatment of Arabidopsis seedlings with Torin 2, a TOR specific inhibitor, for one day, caused significant reductions in fatty acids and membrane lipids. Similarly, incubating oil-producing Brassica napus suspension culture cells with Torin 2 for eight hours led to significant decreases in the levels of TFA and TAG. Taken together the results from three independent systems presented here establishes that TOR positively regulates lipid synthesis in plants, consistent with its role in animals. Furthermore, RNA-seq analysis of Torin 2-treated Arabidopsis seedlings showed that TOR promotes the upregulation of a number of genes involved in de novo fatty acid synthesis while downregulating genes involved in lipid turnover, which we propose as a mechanistic explanation for its promotion of lipid synthesis and accumulation.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Novel interaction interfaces mediate the interaction between the NEIL1 DNA glycosylase and mitochondrial transcription factor A

The maintenance of human mitochondrial DNA (mtDNA) is critical for proper cellular function as damage to mtDNA, if left unrepaired, can lead to a diverse array of pathologies. Of the pathways identified to participate in DNA repair within the mitochondria, base excision repair (BER) is the most extensively studied. Protein-protein interactions drive the step-by-step coordination required for the successful completion of this pathway and are important for crosstalk with other mitochondrial factors involved in genome maintenance. Human NEIL1 is one of seven DNA glycosylases that initiates BER in both the nuclear and mitochondrial compartments. In the current work, we scrutinized the interaction between NEIL1 and mitochondrial transcription factor A (TFAM), a protein that is essential for various aspects of mtDNA metabolism. We note, for the first time, that both the N- and C- terminal domains of NEIL1 interact with TFAM revealing a unique NEIL1 protein-binding interface. The interaction between the two proteins, as observed biochemically, appears to be transient and is most apparent at concentrations of low salt. The presence of DNA (or RNA) also positively influences the interaction between the two proteins, and molar mass estimates indicate that duplex DNA is required for complex formation at higher salt concentrations. Hydrogen deuterium exchange mass spectrometry data reveal that both proteins exchange less deuterium upon DNA binding, indicative of an interaction, and the addition of NEIL1 to the TFAM-DNA complex alters the interaction landscape. The transcriptional activity of TFAM appears to be independent of NEIL1 expression under normal cellular conditions, however, in the presence of DNA damage, we observe a significant reduction in the mRNA expression of TFAM-transcribed mitochondrial genes in the absence of NEIL1. Overall, our data indicate that the interaction between NEIL1 and TFAM can be modulated by local environment such as salt concentrations, protein availability, the presence of nucleic acids, as well as the presence of DNA damage.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Kölliker's Organ Functions as a Developmental Hub in Mouse Cochlea Regulating Spiral Limbus and Tectorial Membrane Development

Kölliker's organ is a transient developmental structure in the mouse cochlea that undergoes significant remodeling postnatally. Utilizing an epithelial-specific conditional deletion mouse model of Prdm16 (marker and regulator of Kölliker's organ), we show that Prdm16 is required for interdental cell development, and thereby the development of the limbal domain of the tectorial membrane and its medial anchorage to the spiral limbus. Additionally, we show that Kölliker's organ is involved in normal tectorial membrane collagen fibril development and maturation. Interestingly, mesenchymal cells of the spiral limbus underneath Prdm16 -deficient Kölliker's organ failed to produce interstitial matrix proteins, resulting in a hypoplastic and truncated spiral limbus, indicating a non-cell autonomous role of Prdm16 in regulating spiral mesenchymal matrix development. Single-cell RNA sequencing identified differentially expressed genes in Prdm16 -deficient Kölliker's organ suggesting a role for connective tissue growth factor (CTGF) downstream Prdm16 in epithelial-mesenchymal signaling involved in spiral limbus matrix deposition. Prdm16 -deficient mice showed a hearing deficit, as indicated by elevated auditory brainstem response thresholds at most frequencies, consistent with the cochlear structural defects. Both sexes were studied. This work establishes Prdm16 as a deafness gene in mice through its role in regulating Kölliker's organ development. Such understanding recognizes Kölliker's organ as a developmental hub regulating multiple surrounding cochlear structures.

Zhang, Hongji↗
DOE OSTI2025

Nanoparticle-mediated antagonism of sustained endosomal signaling of the calcitonin receptor-like receptor provides enhanced and persistent relief of oral cancer pain

By improving the delivery and tumor retention of chemotherapeutics, nanomedicines hold potential for cancer treatment. The usefulness of nanoparticle (NP)-encapsulated analgesics for the cancer pain treatment is comparatively unexplored. We investigated whether NPs encapsulating olcegepant (OCP), an antagonist of the calcitonin receptor-like receptor (CLR) for the calcitonin gene-related peptide (CGRP), effectively relieved oral cancer pain in mice. Because persistent endosomal CLR signaling in Schwann cells mediates craniofacial pain, we reasoned that the predisposition of NPs to accumulate in endosomes could be leveraged to effectively relieve oral cancer pain. By expressing biosensors for activated CLR, Gα proteins and β-arrestins in HEK293T and Schwann cells, we found that CGRP activates CLR signaling first at the plasma membrane and then in early, late and recycling endosomes and the cis- and trans-Golgi apparatus. We synthesized biocompatible NPs encapsulating OCP and fluorophores by integrating hydrophobic ion pairing nanoformulation with Flash NanoPrecipitation. NPs slowly released OCP and accumulated in early endosomes, leading to sustained inhibition of endosomal CLR signaling in HEK293T and Schwann cells. Oral cancers were established in mice, which led to heightened pain-like responses. After intra-tumoral injection, NPs were retained in tumors for at least one week. OCP-loaded NPs almost completely reversed allodynia and hyperalgesia for a prolonged period, whereas unencapsulated OCP had small and transient effects. The NP accumulation in endosomal sites of pain signaling, the sustained release of antagonist, and the retention of NPs in tumors explain their beneficial actions. Thus, NP-encapsulation holds promise for the relief of painful cancers that are inadequately treated by opioids.

Calcitonin gene-related peptide↗
DOE OSTI2025

Combining genome-wide association studies and expression quantitative trait nucleotide mapping with molecular and genetic validations to identify transcriptional networks regulating drought tolerance in Populus

Objectives: (i). To deploy a large-scale experimental drought trial for up to 1000 unique genotypes of Populus equipping the sites with controlled irrigation and drought treatments that are fully automated and monitored. FULLY COMPLETED (ii) To test the hypothesis that a suite of traits identified for drought tolerance in P. nigra can be measured in drought and control treatments in the wide germplasm collection of P. trichocarpa. FULLY COMPLETED (iii) To use established and novel GWAS model approaches to identify gene loci linked to drought tolerance traits on interest in P. trichocarpa. FULLY COMPLETED (iv) To undertake comparative analysis of GWAS results for drought tolerance traits in P. nigra and P. trichocarpa. PARTIALLY COMPLETED – remains active (v) Using RNAseq in P. trichocarpa, in droughted and control treatments to identify cis- and trans-regulated eQTN. FULLY COMPLETED (vi) Validate up to 50 cis-QTNs, from network hubs using transient protoplast assays. FULLY COMPLETED (vii) To establish Agrobacterium-based gene editing protocols in Populus. FULLY COMPLETED (viii) To utilize early leads from previous research to investigate at least 6 candidate genes for drought tolerance in Populus. FULLY COMPLETED (ix) To validate up to 20 candidate genes for drought tolerance in P. trichocarpa refined from the long-list tested in the transient assays for cis-acting hub gene targets. PARTIALLY COMPLETED- remains active.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2024

Dynamics and activity of an ammonia-oxidizing archaea bloom in South San Francisco Bay

Abstract Transient or recurring blooms of ammonia-oxidizing archaea (AOA) have been reported in several estuarine and coastal environments, including recent observations of AOA blooms in South San Francisco Bay. Here, we measured nitrification rates, quantified AOA abundance, and analyzed both metagenomic and metatranscriptomic data to examine the dynamics and activity of nitrifying microorganisms over the course of an AOA bloom in South San Francisco Bay during the autumn of 2018 and seasonally throughout 2019. Nitrification rates were correlated with AOA abundance in quantitative polymerase chain reaction (PCR) data, and both increased several orders of magnitude between the autumn AOA bloom and spring and summer seasons. From bloom samples, we recovered an extremely abundant, high-quality Candidatus Nitrosomarinus catalina-like AOA metagenome-assembled genome that had high transcript abundance during the bloom and expressed >80% of genes in its genome. We also recovered a putative nitrite-oxidizing bacteria metagenome-assembled genome from within the Nitrospinaceae that was of much lower abundance and had lower transcript abundance than AOA. During the AOA bloom, we observed increased transcript abundance for nitrogen uptake and oxidative stress genes in non-nitrifier metagenome-assembled genomes. This study confirms AOA are not only abundant but also highly active during blooms oxidizing large amounts of ammonia to nitrite—a key intermediate in the microbial nitrogen cycle—and producing reactive compounds that may impact other members of the microbial community.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

eYGFPuv-Assisted Transgenic Selection in Populus deltoides WV94 and Multiplex Genome Editing in Protoplasts of P. trichocarpa × P. deltoides Clone ‘52-225’

Although CRISPR/Cas-based genome editing has been widely used for plant genetic engineering, its application in the genetic improvement of trees has been limited, partly because of challenges in Agrobacterium-mediated transformation. As an important model for poplar genomics and biotechnology research, eastern cottonwood (Populus deltoides) clone WV94 can be transformed by A. tumefaciens, but several challenges remain unresolved, including the relatively low transformation efficiency and the relatively high rate of false positives from antibiotic-based selection of transgenic events. Moreover, the efficacy of CRISPR-Cas system has not been explored in P. deltoides yet. Here, we first optimized the protocol for Agrobacterium-mediated stable transformation in P. deltoides WV94 and applied a UV-visible reporter called eYGFPuv in transformation. Our results showed that the transgenic events in the early stage of transformation could be easily recognized and counted in a non-invasive manner to narrow down the number of regenerated shoots for further molecular characterization (at the DNA or mRNA level) using PCR. We found that approximately 8.7% of explants regenerated transgenic shoots with green fluorescence within two months. Next, we examined the efficacy of multiplex CRISPR-based genome editing in the protoplasts derived from P. deltoides WV94 and hybrid poplar clone ‘52-225’ (P. trichocarpa × P. deltoides clone ‘52-225’). The two constructs expressing the Trex2-Cas9 system resulted in mutation efficiency ranging from 31% to 57% in hybrid poplar clone 52-225, but no editing events were observed in P. deltoides WV94 transient assay. The eYGFPuv-assisted plant transformation and genome editing approach demonstrated in this study has great potential for accelerating the genome editing-based breeding process in poplar and other non-model plants species and point to the need for additional CRISPR work in P. deltoides.

59 BASIC BIOLOGICAL SCIENCES↗