Search NASA⌕ Search

SEARCH · Search NASA

Results for “sequence analysis”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 649 records · Page 36
All sourcesNASA NTRSDOE OSTI
DOE OSTI2024

Description of Pegethrix niliensis sp. nov., a Novel Cyanobacterium from the Nile River Basin, Egypt: A Polyphasic Analysis and Comparative Study of Related Genera in the Oculatellales Order

In this paper, we examine the filamentous cyanobacterial strain NILCB16 and describe it as a new species within the genus Pegethrix. The original population was sampled from a mat growing in an irrigation canal in the Nile River, Egypt. Initially classified under Plectonema or Planktolyngbya, the strain is a potential producer of the toxins microcystin and β-N-Methylamino-L-Alanine (BMAA). Additionally, we reviewed the taxonomic relationships between the Oculatellales genera. To describe the new species, we conducted a polyphasic study, encompassing 16S rRNA gene phylogenetic analyses performed using both Maximum Likelihood and Bayesian methods, sequence identity (p-distance) analysis, 16S-23S ITS secondary structures, and morphological and habitat comparisons. The phylogenetic analysis revealed that strain NILCB16 clustered within the Pegethrix clade with strong phylogenetic support, but in a distinct position from other species in the genus. The strain shared a maximum 16S rRNA gene identity of 97.3% with P. qiandaoensis and 96.1% with the type species, P. bostrychoides. Morphologically, NILCB16 can be differentiated from other species in the genus by its lack of false branching. Our phylogenetic analyses also show that Pegethrix, Cartusia, Elainella, and Maricoleus are clustered with strong phylogenetic support. They exhibit high 16S rRNA gene identity and are morphologically indistinguishable, suggesting they could potentially be merged into a single genus in the future.

Hentschke, Guilherme Scotta (ORCID:000000034396024↗
DOE OSTI2019

Syntgen: a system to generate temporal networks with user-specified topology

Abstract In the last few years, the study of temporal networks has progressed markedly. The evolution of clusters of nodes (or communities) is one of the major focus of these studies. However, the time dimension increases complexity, introducing new constructs and requiring novel and enhanced algorithms. In spite of recent improvements, the relative scarcity of timestamped representations of empiric networks, with known ground truth, hinders algorithm validation. A few approaches have been proposed to generate synthetic temporal networks that conform to static topological specifications while in general adopting an ad hoc approach to temporal evolution. We believe there is still a need for a principled synthetic network generator that conforms to problem domain topological specifications from a static as well as temporal perspective. Here, we present such a system. The unique attributes of our system include accepting arbitrary node degree and cluster size distributions and temporal evolution under user control, while supporting tunable joint distribution and temporal correlation of node degrees. Theoretical contributions include the analysis of conditions for graphic sequences of inter- and intracluster node degrees and cluster sizes and the development of a heuristic to search for the cluster membership of nodes that minimizes the shared information distance between clusterings. Our work shows that this system is capable of generating networks under user controlled topology with up to thousands of nodes and hundreds of clusters with strong topology adherence. Much larger networks are possible with relaxed requirements. The generated networks support algorithm validation as well as problem domain analysis.

Pereira, Luis Ramada↗
DOE OSTI2026

Protocol for applying a network-enabled gene discovery pipeline to non-model plant species

Identifying upstream regulators of key genes is essential for understanding gene regulatory mechanisms and translating these insights into functional targets. Here, we present a protocol for applying the network-enabled gene discovery pipeline (NEEDLE) to non-model plant species. We describe steps for environment setup, data preparation, computational analysis, expected outputs, and parameter considerations. NEEDLE integrates RNA sequencing (RNA-seq) processing, weighted gene co-expression analysis (WGCNA), Gene Network Inference with Ensemble of trees (GENIE3), and promoter conservation analysis to prioritize candidate transcriptional regulators.

Plant Sciences↗
DOE OSTI2015

Archaeal and bacterial communities across a chronosequence of drained lake basins in arctic alaska

We examined patterns in soil microbial community composition across a successional gradient of drained lake basins in the Arctic Coastal Plain. Analysis of 16S rRNA gene sequences revealed that methanogens closely related to Candidatus ‘Methanoflorens stordalenmirensis’ were the dominant archaea, comprising >50% of the total archaea at most sites, with particularly high levels in the oldest basins and in the top 57 cm of soil (active and transition layers). Bacterial community composition was more diverse, with lineages from OP11, Actinobacteria, Bacteroidetes, and Proteobacteria found in high relative abundance across all sites. Notably, microbial composition appeared to converge in the active layer, but transition and permafrost layer communities across the sites were significantly different to one another. Microbial biomass using fatty acid-based analysis indicated that the youngest basins had increased abundances of gram-positive bacteria and saprotrophic fungi at higher soil organic carbon levels, while the oldest basins displayed an increase in only the gram-positive bacteria. While this study showed differences in microbial populations across the sites relevant to basin age, the dominance of Candidatus ‘M. stordalenmirensis’ across the chronosequence indicates the potential for changes in local carbon cycling, depending on how these methanogens and associated microbial communities respond to warming temperatures.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2017

Diversity and Structure of Diazotrophic Communities in Mangrove Rhizosphere, Revealed by High-Throughput Sequencing

Diazotrophic communities make an essential contribution to the productivity through providing new nitrogen. However, knowledge of the roles that both mangrove tree species and geochemical parameters play in shaping mangove rhizosphere diazotrophic communities is still elusive. Here, a comprehensive examination of the diversity and structure of microbial communities in the rhizospheres of three mangrove species, Rhizophora apiculata , Avicennia marina , and Ceriops tagal , was undertaken using high-throughput sequencing of the 16S rRNA and nifH genes. Our results revealed a great diversity of both the total microbial composition and the diazotrophic composition specifically in the mangrove rhizosphere. Deltaproteobacteria and Gammaproteobacteria were both ubiquitous and dominant, comprising an average of 45.87 and 86.66% of total microbial and diazotrophic communities, respectively. Sulfate-reducing bacteria belonging to the Desulfobacteraceae and Desulfovibrionaceae were the dominant diazotrophs. Community statistical analyses suggested that both mangrove tree species and additional environmental variables played important roles in shaping total microbial and potential diazotroph communities in mangrove rhizospheres. In contrast to the total microbial community investigated by analysis of 16S rRNA gene sequences, most of the dominant diazotrophic groups identified by nifH gene sequences were significantly different among mangrove species. The dominant diazotrophs of the family Desulfobacteraceae were positively correlated with total phosphorus, but negatively correlated with the nitrogen to phosphorus ratio. Finally, the Pseudomonadaceae were positively correlated with the concentration of available potassium, suggesting that diazotrophs potentially play an important role in biogeochemical cycles, such as those of nitrogen, phosphorus, sulfur, and potassium, in the mangrove ecosystem.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Standardized phylogenetic and molecular evolutionary analysis applied to species across the microbial tree of life

There is growing interest in reconstructing phylogenies from the copious amounts of genome sequencing projects that target related viral, bacterial or eukaryotic organisms. To facilitate the construction of standardized and robust phylogenies for disparate types of projects, we have developed a complete bioinformatic workflow, with a web-based component to perform phylogenetic and molecular evolutionary (PhaME) analysis from sequencing reads, draft assemblies or completed genomes of closely related organisms. Furthermore, the ability to incorporate raw data, including some metagenomic samples containing a target organism (e.g. from clinical samples with suspected infectious agents), shows promise for the rapid phylogenetic characterization of organisms within complex samples without the need for prior assembly.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2015

A draft genome of field pennycress ( Thlaspi arvense ) provides tools for the domestication of a new winter biofuel crop

Field pennycress (Thlaspi arvense L.) is being domesticated as a new winter cover crop and biofuel species for the Midwestern United States that can be double-cropped between corn and soybeans. A genome sequence will enable the use of new technologies to make improvements in pennycress. To generate a draft genome, a hybrid sequencing approach was used to generate 47 Gb of DNA sequencing reads from both the Illumina and PacBio platforms. These reads were used to assemble 6,768 genomic scaffolds. The draft genome was annotated using the MAKER pipeline, which identified 27,390 predicted protein-coding genes, with almost all of these predicted peptides having significant sequence similarity to Arabidopsis proteins. A comprehensive analysis of pennycress gene homologues involved in glucosinolate biosynthesis, metabolism, and transport pathways revealed high sequence conservation compared with other Brassicaceae species, and helps validate the assembly of the pennycress gene space in this draft genome. Additional comparative genomic analyses indicate that the knowledge gained from years of basic Brassicaceae research will serve as a powerful tool for identifying gene targets whose manipulation can be predicted to result in improvements for pennycress.

09 BIOMASS FUELS↗
DOE OSTI2016

REFLECTION OF PROPAGATING SLOW MAGNETO-ACOUSTIC WAVES IN HOT CORONAL LOOPS: MULTI-INSTRUMENT OBSERVATIONS AND NUMERICAL MODELING

Slow MHD waves are important tools for understanding coronal structures and dynamics. In this paper, we report a number of observations from the X-Ray Telescope (XRT) on board HINODE and Solar Dynamic Observatory /Atmospheric Imaging Assembly (AIA) of reflecting longitudinal waves in hot coronal loops. To our knowledge, this is the first report of this kind as seen from the XRT and simultaneously with the AIA. The wave appears after a micro-flare occurs at one of the footpoints. We estimate the density and temperature of the loop plasma by performing differential emission measure (DEM) analysis on the AIA image sequence. The estimated speed of propagation is comparable to or lower than the local sound speed, suggesting it to be a propagating slow wave. The intensity perturbation amplitude, in every case, falls very rapidly as the perturbation moves along the loop and eventually vanishes after one or more reflections. To check the consistency of such reflection signatures with the obtained loop parameters, we perform a 2.5D MHD simulation, which uses the parameters obtained from our observation as inputs, and perform forward modeling to synthesize AIA 94 Å images. Analyzing the synthesized images, we obtain the same properties of the observables as for the real observation. From the analysis we conclude that a footpoint heating can generate a slow wave which then reflects back and forth in the coronal loop before fading. Our analysis of the simulated data shows that the main agent for this damping is anisotropic thermal conduction.

79 ASTRONOMY AND ASTROPHYSICS↗
DOE OSTI2021

Prevalence of gp160 polymorphisms known to be related to decreased susceptibility to temsavir in different subtypes of HIV-1 in the Los Alamos National Laboratory HIV Sequence Database

Fostemsavir, a prodrug of the gp120-directed attachment inhibitor temsavir, is indicated for use in heavily treatment-experienced individuals with MDR HIV-1. Reduced susceptibility to temsavir in the clinic maps to discrete changes at amino acid positions in gp160: S375, M426, M434 and M475.To query the Los Alamos National Laboratory (LANL) HIV Sequence Database for the prevalence of polymorphisms at gp160 positions of interest. Full-length gp160 sequences (N = 7560) were queried for amino acid polymorphisms relative to the subtype B consensus at positions of interest; frequencies were reported for all sequences and among subtypes/circulating recombinant forms (CRFs) with ≥10 isolates in the database. Among 239 subtypes in the database, the 5 most prevalent were B (n = 2651, 35.1%), C (n = 1626, 21.5%), CRF01_AE (n = 674, 8.9%), A1 (n = 273, 3.6%) and CRF02_AG (n = 199, 2.6%). Among all 7560 sequences, the most prevalent amino acids at positions of interest (S 375 , 73.5%; M 426 , 82.1%; M 434 , 88.2%; M 475 , 89.9%) were the same as the subtype B consensus. Specific polymorphisms with the potential to decrease temsavir susceptibility (S 375 H/I/M/N/T/Y, M 426 L/P, M 434 I/K and M475I) were found in <10% of isolates of subtypes D, G, A6, BC, F1, CRF07_BC, CRF08_BC, 02A, CRF06_cpx, F2, 02G and 02B. S 375 H and M 475 I were predominant among CRF01_AE (S375H, 99.3%; M 475 I, 76.3%; consistent with previously reported low temsavir susceptibility of this CRF) and 01B (S 375 H, 71.7%; M 475 I, 49.5%). Analysis of the LANL HIV Sequence Database found a low prevalence of gp160 amino acid polymorphisms with the potential to reduce temsavir susceptibility overall and among most of the common subtypes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Machine-Learning-Based Analysis of the Guy-Greenbrier, Arkansas Earthquakes: A Tale of Two Sequences

Here, we revisited the June 2010 to October 2011 Guy-Greenbrier earthquake sequence in central Arkansas using PhaseNet, a deep neural network trained to pick P and S arrival times. We applied PhaseNet to continuous waveform data and used phase association and hypocenter relocation to locate nearly 90,000 events. Our catalog suggests that the sequence consists of two adjacent earthquake sequences on the same fault and that the second sequence may be associated with the wastewater disposal well to the west of the Guy-Greenbrier Fault, rather than the wells to the north and the east that were previously implicated. We find that each sequence is composed of many small clusters that exhibit diffusion along the fault at shorter timescales. Our study demonstrates that machine-learning-based earthquake catalog development is now feasible and will yield new insights into earthquake behavior.

58 GEOSCIENCES↗
DOE OSTI2023

SSGUI v1.0

SSGUI is a web-based application that integrates the integrative genomics browser (IGV) with upstream alignment pipelines enabling rapid analysis of a batch of next-generation sequencing (NGS) samples. The input to SSGUI is an NGS file system directory that is organized by experiment and reference sequence. The output is an online dashboard containing various sequencing statistics for each sample and an integrated IGV plugin enabling rapid analysis of aligned NGS reads.

Kulawik, Mark↗
DOE OSTI2025

Microreactor Assembly Transportation Cask Model Description for Criticality Safety Validation Basis Assessment

Criticality safety analyses are completed on a transportation cask used for microreactor assembly shipment to provide an example of model and analysis to industry for reproducing this type of study on their microreactor fuel shipment. The fuel assembly considered is based on a gas-cooled microreactor (GC-MR), which utilizes HALEU fuel in the form of TRISO particles and utilizes various design options considered in industry designs. Various versions of this GC-MR assembly were studied, with and without YH2 moderator, providing similar conclusions. The shipment cask design is revised based on an existing design ES-3100, developed by Y-12 for the transport of highly enriched uranium (HEU), but is enlarged to hold the GC-MR fuel assembly. Criticality safety analysis for the cask/GC-MR fuel assembly package was performed using the CSAS6 sequence of SCALE6.3.2, utilizing the ENDF/B-VII.1 based continuous energy neutron library, and the analysis strictly follows the guideline from NRC reference reports. Different scenarios, e.g. normal operation, undamaged cask with water flooded, damaged cask with optimal water moderation, have been analyzed and it could be concluded the package would always have a large margin of subcriticality even packed in an infinite array. Sensitivity and similarity analyses are also performed using the TSUNAMI sequence of SCALE6.3.2, and the similarity analysis uses all the experiments from the ICSBEP Handbook with Intermediate and Mixed Enriched Uranium (IEU) and Low Enriched Uranium (LEU) systems together with additional ones that are sponsored by the DNCSH program. These similarity analyses indicate that dry cases have no similar benchmark experiments (ck values greater than 0.8), which may become problematic if more assemblies are shipped together (or a fully loaded core is shipped) and margin to criticality is reduced. However, the damaged cask models with flooded assemblies exhibited similarities to many experiments with ck values greater than 0.8.

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗
DOE OSTI2026

Microreactor Assembly Transportation Cask Model Description for Criticality Safety Validation Basis Assessment (Rev. 3)

Criticality safety analyses are completed on a transportation cask used for microreactor assembly shipment to provide an example of model and analysis to industry for reproducing this type of study on their microreactor fuel shipment. The fuel assembly considered is based on a gas-cooled microreactor (GC-MR), which utilizes HALEU fuel in the form of TRISO particles and utilizes various design options considered in industry designs. Various versions of this GC-MR assembly were studied, with and without YH 2 moderator, providing similar conclusions. The shipment cask design is revised based on an existing ES-3100 design, developed by Y-12 for the transport of highly enriched uranium (HEU), but is enlarged to hold the GC-MR fuel assembly. Criticality safety analysis for the cask/GC-MR fuel assembly package was performed using the CSAS6 sequence of SCALE6.3.2, utilizing the ENDF/B-VII.1 based continuous energy neutron library, and the analysis strictly follows the guideline from NRC reference reports. Different scenarios, e.g. normal operation, undamaged cask with water flooded, damaged cask with optimal water moderation, have been analyzed and it could be concluded the package would always have a large margin of subcriticality even packed in an infinite array. Sensitivity and similarity analyses are also performed using the TSUNAMI sequence of SCALE6.3.2, and the similarity analysis uses all the experiments from the ICSBEP Handbook with Highly Enriched Uranium (HEU), Intermediate and Mixed Enriched Uranium (IEU) and Low Enriched Uranium (LEU) systems, together with additional ones that are sponsored by the DNCSH program, and selected IRPhEP experiments using TRISO fuel and graphite moderator. These similarity analyses indicate that the dry nominal design has no similar benchmark experiments (ck values greater than 0.8), which may become problematic if more assemblies are shipped together (or a fully loaded core is shipped) and margin to criticality is reduced. However, the cask models with flooded assemblies exhibited similarities to many experiments with c k values greater than 0.8.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Transfer of beef bacterial communities onto food-contact surfaces

Introduction Food spoilage and pathogenic bacteria on food-contact surfaces, especially biofilm-forming strains, can transfer to meats during processing. The objectives of this study were to survey the bacterial communities of beef cuts that transfer onto two commonly used food-contact surfaces, stainless steel (SS) and high-density polyethylene (HDPE) and identify potentially biofilm-forming strains. Methods Top round, flank, chuck, and ground beef were purchased from 3 retail stores. SS and HDPE coupons (approximately 2cm × 5cm) were placed on beef portions (3h, 10°C), after which, the coupons were submerged halfway in PBS (24h, 10°C). Bacteria from the beef cuts and coupon surfaces ( n = 3) were collected, plated on tryptic soy agar plates and incubated (5 days, 25°C). Bacterial isolates were identified by 16S rRNA gene amplicon sequencing and assayed for biofilm formation using a crystal violet binding (CV) assay (72h, 10°C). Additionally, beef and coupon samples were collected for bacterial community analysis by 16S rRNA gene amplicon sequencing. Results and discussion Sixty-one of 972 beef isolates, 29 of 204 HDPE isolates, and 30 of 211 SS isolates were strong biofilm-formers (Absorbance>1.000 at 590 nm in the CV assay). Strong-binding isolates identified were of the genera Pseudomonas , Acinetobacter , Psychrobacter , Carnobacterium , and Brochothrix . Coupon bacterial communities among stores and cuts were distinct ( p < 0.001, PERMANOVA), but there was no distinction between the communities found on HDPE or SS coupons ( p > 0.050, PERMANOVA). The bacterial communities identified on the coupons may help determine the communities capable of transferring and colonizing onto surfaces, which can subsequently cross-contaminate foods.

Guron, Giselle K. P.↗
DOE OSTI2025

The role of soil chemical properties and microbial communities on Dendrocalamus brandisii bamboo shoot quality, Yunnan Province, China

Objective To explore the effects of soil nutrients and microbial communities on the quality of Dendrocalamus brandisii shoots in different regions, providing a scientific basis for their development and utilization. Methods Using seven different geographic sources of D. brandisii from Yunnan Province as research subjects, this study employs chemical analysis and high-throughput sequencing to reveal the relationship between soil nutrients, microbial functional groups, and the nutritional quality of bamboo shoots. Results The results indicate that there are significant differences in soil nutrient content among the regions ( p < 0.05), with bamboo shoots from Baoshan Changning (CN) exhibiting the best overall nutritional quality. The key factors influencing bacterial community changes include pH, available phosphorus (AP), and available potassium (AK). In contrast, the main factors affecting fungal community changes are pH, soil organic matter (SOM), available potassium (AK), and total nitrogen (TN). This version maintains clarity and logical flow, making it easier for readers to understand the different factors influencing bacterial and fungal community changes. The diversity indices of soil microbial communities among different sources of Dendrocalamus brandisii show significant differences ( p < 0.05). The dominant groups in the seven regions include Proteobacteria, Acidobacteriota, Actinobacteriota, Chloroflexi, Ascomycota, and Basidiomycota. The soil microbial community in Baoshan Changning (CN) shows significant structural differences compared to the other six regions, with the highest relative abundances of Chloroflexi and Acidobacteriota. In contrast, the highest relative abundance of Proteobacteria is found in Honghe Shiping (SP), while Actinobacteriota has the highest relative abundance in Yuxi Xinping (XP). RDA analysis indicates that soil nutrients (SOM, pH, AP, TN) affect the water content, soluble sugar, and crude fat of bamboo shoots. Additionally, the bacterial communities including Actinobacteriota, Chloroflexi, Patescibacteria, GAL15, and Cyanobacteria influence the water content, soluble sugar, ash content, protein, and lignin of bamboo shoots. Discussion In the fungal community, Basidiomycota, Kickxellomycota, Mucoromycota, unclassified-k-Fungi, and Glomeromycota affect the water content and tannin levels in bamboo shoots. In summary, soil nutrients and soil microorganisms are interconnected and work together to influence the quality of bamboo shoots.

Chen, Qian↗
DOE OSTI2024

High throughput, accurate gene annotation through AI and HPC-enabled structural analysis

With the advances in next generation sequencing technologies, the number of sequenced genomes is growing exponentially, resulting in a technology bottleneck for the translation of sequence information into usable hypotheses about the function of each gene. We have proposed leveraging our leadership high-performance computing (HPC) resources to help break this annotation bottleneck. Here we design an HPC-based framework to infer gene function from gene sequence by incorporating information about protein structure and interactions predicted by deep learning approaches. Accurate functional prediction and gene annotation using computational methods will facilitate breakthroughs in the genomic sciences essential to understanding and harnessing life processes in bacteria, fungi and plants. The development and applications of the state-of-the-art deep neural networks to protein structural modeling, interaction prediction, sequence comparison, and quality assessment of protein structural models will be made possible by leadership computational resources. These HPC-enabled bioinformatics and molecular modeling tools will provide powerful insights into molecular functions of genes.

59 BASIC BIOLOGICAL SCIENCES↗