SEARCH · Search NASA
Results for “LEAVES”
Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
Structural organization of the spongy mesophyll
Summary Many plant leaves have two layers of photosynthetic tissue: the palisade and spongy mesophyll. Whereas palisade mesophyll consists of tightly packed columnar cells, the structure of spongy mesophyll is not well characterized and often treated as a random assemblage of irregularly shaped cells. Using micro‐computed tomography imaging, topological analysis, and a comparative physiological framework, we examined the structure of the spongy mesophyll in 40 species from 30 genera with laminar leaves and reticulate venation. A spectrum of spongy mesophyll diversity encompassed two dominant phenotypes: first, an ordered, honeycomblike tissue structure that emerged from the spatial coordination of multilobed cells, conforming to the physical principles of Euler’s law; and second, a less‐ordered, isotropic network of cells. Phenotypic variation was associated with transitions in cell size, cell packing density, mesophyll surface‐area‐to‐volume ratio, vein density, and maximum photosynthetic rate. These results show that simple principles may govern the organization and scaling of the spongy mesophyll in many plants and demonstrate the presence of structural patterns associated with leaf function. This improved understanding of mesophyll anatomy provides new opportunities for spatially explicit analyses of leaf development, physiology, and biomechanics.
Ecosystem consequences of introducing plant growth promoting rhizobacteria to managed systems and potential legacy effects
The rapidly growing industry of crop biostimulants leverages the application of plant growth promoting rhizobacteria (PGPR) to promote plant growth and health. However, introducing nonnative rhizobacteria may impact other aspects of ecosystem functioning and have legacy effects; these potential consequences are largely unexplored. Nontarget consequences of PGPR may include changes in resident microbiomes, nutrient cycling, pollinator services, functioning of other herbivores, disease suppression, and organic matter persistence. Importantly, we lack knowledge of whether these ecosystem effects may manifest in adjacent ecosystems. The introduced PGPR can leave a functional legacy whether they persist in the community or not. Legacy effects include shifts in resident microbiomes and their temporal dynamics, horizontal transfer of genes from the PGPR to resident taxa, and changes in resident functional groups and interaction networks. Ecosystem functions may be affected by legacies PGPR leave following niche construction, such as when PGPR alter soil pH that in turn alters biogeochemical cycling rates. Here, we highlight new research directions to elucidate how introduced PGPR impact resident microbiomes and ecosystem functions and their capacity for legacy effects.
Fermentation‐mediated growth, signaling, and defense in plants
Summary While traditionally considered important mainly in hypoxic roots during flooding, upregulation of fermentation pathways in plants has recently been described as an evolutionarily conserved drought survival strategy, with acetate signaling mediating reprograming of transcription and cellular carbon and energy metabolism from roots to leaves. The amount of acetate produced directly correlates with survival through potential mechanisms including defense gene activation, biosynthesis of primary and secondary metabolites, and aerobic respiration. Here, we review root ethanolic fermentation responses to hypoxia during saturated soil conditions and summarize studies highlighting acetate fermentation under aerobic conditions coupled with respiration during growth and drought responses. Recent work is discussed demonstrating long‐distance transport of acetate via the transpiration stream as a respiratory substrate. While maintenance and growth respiration are often modeled separately in terrestrial models, here we propose the concept of ‘Defense Respiration’ fueled by acetate fermentation in which upregulation of acetate fermentation contributes acetate substrate for alternative energy production via aerobic respiration, biosynthesis of primary and secondary metabolites, and the acetylation of proteins involved in defense gene regulation. Finally, we highlight new frontiers in leaf‐atmosphere emission measurements as a potential way to study acetate fermentation responses of individual leaves, branches, ecosystems, and regions.
Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar
Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.
Constitutive down‐regulation of liguleless alleles in sorghum drives increased productivity and water use efficiency
Plant architecture influences the microenvironment throughout the canopy layer. Plants with a more erect leaf architecture allow for an increase in planting densities and allow more light to reach lower canopy leaves. This is predicted to increase crop carbon assimilation. Frictional resistance to wind reduces air movement in the lower canopy, resulting in higher humidity. By increasing the proportion of canopy photosynthesis in the more humid lower canopy, gains in the efficiency of water use might be expected, although this may be slightly offset by the more open erectophile form canopy. An anatomical feature in members of the Poaceae family that impacts leaf angle is the articulated junction of the sheath and blade, which also bares the ligule and auricles. Mutants, which lack ligules and auricles, show no articulation at this junction, resulting in leaves that are near vertical. In maize, these phenotypes termed liguleless result from null mutations of genes: ZmLG1 (Zm00001eb67740) and ZmLG2 (Zm00001eb147220). In sorghum, SbiRTx430.06G264300 (SbLG1) and SbiRTx430.03G392300 (SbLG2) are annotated as the respective maize homologues. A hair-pin element designed to down-regulate both SbLG1 and SbLG2 was introduced into the grain sorghum genotype RTx430. Derived transgenic events harbouring the hair-pin failed to develop ligules and displayed reduced leaf angles to the vertical, but less vertical than in null mutations. Under field settings, plots sown with these sorghum events having an erect architecture phenotype displayed an increase in photosynthesis in lower canopy levels, which led to increases in above-ground biomass and seed yield, without an increase in water use.
Multisite Field Evaluation of Oil Accumulation and Agronomic Performance in Grain and Sweet Sorghums Engineered for Lipid Hyperaccumulation
Oil sorghum (OS) has been developed by engineering grain (TX430) and sweet (Ramada) genetic backgrounds to accumulate triacylglycerols (TAG) in vegetative tissues as an energy-dense feedstock for sustainable aviation fuel (SAF) and other biofuels. This study evaluated two TX430 OS lines (TxHO-2, TxHO-3) and two Ramada OS lines (RmHO-1, RmHO-2) alongside wild-type (WT) lines in NE and IL over 2 years (2023–2024) to quantify genotype × environment effects on agronomic performance and TAG accumulation. Across four environments, TX430 OS lines showed average TAG concentrations of 15.0 g kg −1 in leaves and 12.8 g kg −1 in stems, approximately 19-fold higher than WT. Ramada OS lines accumulated 26.1 g kg −1 in leaves and 12.3 g kg −1 in stems, approximately 25-fold and 13-fold increases over WT, respectively. OS lines in TX430 exhibited an 18% reduction in biomass (8.4 vs. 9.9 Mg ha −1 for WT), while Ramada OS lines had similar WT biomass (18.3 vs. 19.9 Mg ha −1 for WT). Among TX430 OS lines, TxHO-2 achieved the highest TAG yield (190 kg ha −1 ), while RmHO-1 led the Ramada lines (335 kg ha −1 ) due to higher biomass and similar TAG concentration. Enhanced TAG accumulation increased N, P, and K removal in TX430 lines but not in Ramada lines. Structural carbohydrate and ash concentration were unaffected. Overall, results confirm vegetative lipid accumulation as a viable strategy for high-biomass sorghum, supporting its potential as a dual-purpose feedstock for SAF. Future work should focus on minimizing biomass yield penalties and improving nutrient use efficiency in oil sorghum systems.
Photosynthetic leaf area modulates tiller bud outgrowth in sorghum
Abstract Shoot branches or tillers develop from axillary buds. The dormancy versus outgrowth fates of buds depends on genetic, environmental and hormonal signals. Defoliation inhibits bud outgrowth indicating the role of leaf‐derived metabolic factors such as sucrose in bud outgrowth. In this study, the sensitivity of bud outgrowth to selective defoliation was investigated. At 6 d after planting (6 DAP ), the first two leaves of sorghum were fully expanded and the third was partially emerged. Therefore, the leaves were selectively defoliated at 6 DAP and the length of the bud in the first leaf axil was measured at 8 DAP . Bud outgrowth was inhibited by defoliation of only 2 cm from the tip of the second leaf blade. The expression of dormancy and sucrose‐starvation marker genes was up‐regulated and cell cycle and sucrose‐inducible genes was down‐regulated during the first 24 h post‐defoliation of the second leaf. At 48 h, the expression of these genes was similar to controls as the defoliated plant recovers. Our results demonstrate that small changes in photosynthetic leaf area affect the propensity of tiller buds for outgrowth. Therefore, variation in leaf area and photosynthetic activity should be included when integrating sucrose into models of shoot branching.
Efficient phloem remobilization of Zn protects apple trees during the early stages of Zn deficiency
Apple trees are extensively cultivated worldwide but are often affected by zinc (Zn) deficiency. Limited knowledge regarding Zn remobilization within fruit crops has hampered the development of efficient strategies for providing adequate amounts of Zn. In the present study, Zn distribution and remobilization were compared among apple trees cultivated under different Zn conditions. Without Zn application, plants showed visible symptoms of Zn deficiency at the shoot tips after 1 year but appeared to grow normally during the first 6 months (early stage of Zn deficiency). Compared with apple plants under sufficient Zn treatment, plants suffering from early-stage Zn deficiency showed preferential Zn distribution to young leaves and higher Zn levels in phloem, demonstrating that hidden Zn deficiency triggers a highly efficient remobilization of Zn in this species. The in vivo Zn-nicotianamine complex in phloem tissues, combined with the significant enhanced expression of MdNAS3 and MdYSL6 , suggested a positive role for nicotianamine in the phloem remobilization of Zn. These results strongly suggest that a proportion of Zn in the old leaves of apple trees can be efficiently remobilized by phloem transport to the shoot tips, partially in the form of Zn-nicotianamine, thus protecting apple trees against the early stages of Zn deficiency.
Experimental warming across a tropical forest canopy height gradient reveals minimal photosynthetic and respiratory acclimation
Abstract Tropical forest canopies cycle vast amounts of carbon, yet we still have a limited understanding of how these critical ecosystems will respond to climate warming. We implemented in situ leaf‐level + 3°C experimental warming from the understory to the upper canopy of two Puerto Rican tropical tree species, Guarea guidonia and Ocotea sintenisii . After approximately 1 month of continuous warming, we assessed adjustments in photosynthesis, chlorophyll fluorescence, stomatal conductance, leaf traits and foliar respiration. Warming did not alter net photosynthetic temperature response for either species; however, the optimum temperature of Ocotea understory leaf photosynthetic electron transport shifted upward. There was no Ocotea respiratory treatment effect, while Guarea respiratory temperature sensitivity ( Q 10 ) was down‐regulated in heated leaves. The optimum temperatures for photosynthesis ( T opt ) decreased 3–5°C from understory to the highest canopy position, perhaps due to upper canopy stomatal conductance limitations. Guarea upper canopy T opt was similar to the mean daytime temperatures, while Ocotea canopy leaves often operated above T opt . With minimal acclimation to warmer temperatures in the upper canopy, further warming could put these forests at risk of reduced CO 2 uptake, which could weaken the overall carbon sink strength of this tropical forest.
Dynamic in vivo monitoring of granum structural changes of Ctenanthe setosa (Roscoe) Eichler during drought stress and subsequent recovery
Investigating the effects of drought stress and subsequent recovery on the structure and function of chloroplasts is essential to understanding how plants adapt to environmental stressors. We investigated Ctenanthe setosa (Roscoe) Eichler, an ornamental plant that can tolerate prolonged drought periods (40 and 49 days of water withdrawal). Conventional biochemical, biophysical, physiological and (ultra)structural methods combined for the first time in a higher plant with in vivo small-angle neutron scattering (SANS) were used to characterize the alterations induced by drought stress and subsequent recovery. Upon drought stress, no significant changes occurred in the chloroplast ultrastructure, chlorophyll content, 77K fluorescence emission spectra and maximal quantum efficiency of PSII (Qy dark), but the actual quantum efficiency of PSII (Qy light) decreased, the amounts of PSI-LHCII complexes and PSII monomers declined, and that of PSII supercomplexes increased. Thickness of the leaf and of the adaxial hypodermis, chloroplast length and granum repeat distance (RD) values decreased upon drought stress, as shown by light microscopy and SANS, respectively. Because of the very slight (nm-range) changes in RD values, the large biological variability (significant differences in RD values among the leaves and studied leaf regions) and the invasive sampling required for this method, transmission electron microscopy (TEM) hardly showed significant differences. On the other side, in situ SANS analyses provided a unique insight in vivo into the fast structural recovery of the granum structure of drought-stressed leaves, which happened already 18 h after re-watering, while functional and biochemical recovery took place on a longer time scale.
Activation tagging of Arabidopsis POLYGALACTURONASE INVOLVED IN EXPANSION 2 promotes hypocotyl elongation, leaf expansion, stem lignification, mechanical stiffening, and lodging
Summary Pectin is the most abundant component of primary cell walls in eudicot plants. The modification and degradation of pectin affects multiple processes during plant development, including cell expansion, organ initiation, and cell separation. However, the extent to which pectin degradation by polygalacturonases affects stem development and secondary wall formation remains unclear. Using an activation tag screen, we identified a transgenic Arabidopsis thaliana line with longer etiolated hypocotyls, which overexpresses a gene encoding a polygalacturonase. We designated this gene as POLYGALACTURONASE INVOLVED IN EXPANSION 2 ( PGX 2 ), and the corresponding activation tagged line as PGX 2 AT . PGX 2 is widely expressed in young seedlings and in roots, stems, leaves, flowers, and siliques of adult plants. PGX 2‐ GFP localizes to the cell wall, and PGX 2 AT plants show higher total polygalacturonase activity and smaller pectin molecular masses than wild‐type controls, supporting a function for this protein in apoplastic pectin degradation. A heterologously expressed, truncated version of PGX 2 also displays polygalacturonase activity in vitro . Like previously identified PGX 1 AT plants, PGX 2 AT plants have longer hypocotyls and larger rosette leaves, but they also uniquely display early flowering, earlier stem lignification, and lodging stems with enhanced mechanical stiffness that is possibly due to decreased stem thickness. Together, these results indicate that PGX 2 both functions in cell expansion and influences secondary wall formation, providing a possible link between these two developmental processes.
Disruption of Brachypodium lichenase alters metabolism of mixed‐linkage glucan and starch
Mixed-linkage glucan, which is widely distributed in grasses, is a polysaccharide highly abundant in cell walls of grass endosperm and young vegetative tissues. Lichenases are enzymes that hydrolyze mixed-linkage glucan first identified in mixed-linkage glucan-rich lichens. In this study, we identify a gene encoding a lichenase we name Brachypodium distachyon LICHENASE 1 (BdLCH1), which is highly expressed in the endosperm of germinating seeds and coleoptiles and at lower amounts in mature shoots. RNA in situ hybridization showed that BdLCH1 is primarily expressed in chlorenchyma cells of mature leaves and internodes. Disruption of BdLCH1 resulted in an eight-fold increase in mixed-linkage glucan content in senesced leaves. Consistent with the in situ hybridization data, immunolocalization results showed that mixed-linkage glucan was not removed in chlorenchyma cells of lch1 mutants as it was in wild type and implicate the BdLCH1 enzyme in removing mixed-linkage glucan in chlorenchyma cells in mature vegetative tissues. We also show that mixed-linkage glucan accumulation in lch1 mutants was resistant to dark-induced degradation, and 8-week-old lch1 plants showed a faster rate of starch breakdown than wild type in darkness. Here our results suggest a role for BdLCH1 in modifying the cell wall to support highly metabolically active cells.
In vivo nucleic acid detection and imaging within whole plants using plasmonic nanosensors
The ability to monitor gene expression within living plants is of importance in many applications ranging from plant biology research to biofuel development; however, no method currently exists without requiring sample extraction. Herein, we report a multimodal imaging method based on plasmonic nanoprobes for in vivo imaging and biosensing of microRNA biotargets within whole plant leaves. This method integrates three different but complementary techniques: surfaceenhanced Raman scattering (SERS), X-ray fluorescence (XRF), and plasmonics-enhanced two-photon luminescence (TPL). The multimodal method utilizes plasmonic nanostars, which not only provide large Raman signal enhancement, but also allow for localization and quantification by XRF and plasmonics-enhanced TPL, owing to gold content and high two-photon luminescence cross-sections. For the sensing mechanism, inverse molecular sentinel (iMS) nanoprobes are used for SERS bioimaging of microRNA within Arabidopsis thaliana leaves to provide a dynamic SERS map of detected microRNA targets while also quantifying nanoprobe concentrations using XRF and TPL. This report lays the foundation for the use of plasmonic nanoprobes for in vivo functional imaging of nucleic acid biotargets in whole plants, a tool that will allow the study of these biotargets with previously unmet spatial and temporal resolution.
Dosimetric characterization of a multileaf collimator for a new four-dimensional image-guided radiotherapy system with a gimbaled x-ray head, MHI-TM2000
Purpose: To present the dosimetric characterization of a multileaf collimator (MLC) for a new four-dimensional image-guided radiotherapy system with a gimbaled x-ray head, MHI-TM2000. Methods: MHI-TM2000 has an x-ray head composed of an ultrasmall linear accelerator guide and a system-specific MLC. The x-ray head can rotate along the two orthogonal gimbals (pan and tilt rotations) up to {+-}2.5 deg., which swings the beam up to {+-}41.9 mm in each direction from the isocenter on the isocenter plane perpendicular to the beam. The MLC design is a single-focus type, has 30 pairs of 5 mm thick leaves at the isocenter, and produces a maximum field size of 150x150 mm{sup 2}. Leaf height and length are 110 and 260 mm, respectively. Each leaf end is circular, with a radius of curvature of 370 mm. The distance that each leaf passes over the isocenter is 77.5 mm. Radiation leakage between adjacent leaves is minimized by an interlocking tongue-and-groove (T and G) arrangement with the height of the groove part 55 mm. The dosimetric characterizations including field characteristics, leaf position accuracy, leakage, and T and G effect were evaluated using a well-commissioned 6 MV photon beam, EDR2 films (Kodak, Rochester, NY), and water-equivalent phantoms. Furthermore, the field characteristics and leaf position accuracy were evaluated under conditions of pan or tilt rotation. Results: The differences between nominal and measured field sizes were within {+-}0.5 mm. Although the penumbra widths were greater with wider field size, the maximum width was <5.5 mm even for the fully opened field. Compared to the results of field characteristics without pan or tilt rotation, the variation in field size, penumbra width, flatness, and symmetry was within {+-}1 mm/1% at the maximum pan or tilt rotational angle. The leaf position accuracy was 0.0{+-}0.1 mm, ranging from -0.3 to 0.2 mm at four gantry angles of 0 deg., 90 deg., 180 deg., and 270 deg. with and without pan or tilt rotation. The interleaf leakage was up to 0.21%, whereas the intraleaf leakage was <0.12%. T and G decreased the doses by 10.7%, on average. Conclusions: This study demonstrated that MHI-TM2000 has the capability for high leaf position accuracy and low leakage, leading to highly accurate intensity-modulated radiotherapy delivery. Furthermore, substantial changes in the dosimetric data on field characteristics and leaf position accuracy were not observed even at the maximum pan or tilt rotation.
Using an EPID for patient-specific VMAT quality assurance
Purpose: A patient-specific quality assurance (QA) method was developed to verify gantry-specific individual multileaf collimator (MLC) apertures (control points) in volumetric modulated arc therapy (VMAT) plans using an electronic portal imaging device (EPID). Methods: VMAT treatment plans were generated in an Eclipse treatment planning system (TPS). DICOM images from a Varian EPID (aS1000) acquired in continuous acquisition mode were used for pretreatment QA. Each cine image file contains the grayscale image of the MLC aperture related to its specific control point and the corresponding gantry angle information. The TPS MLC file of this RapidArc plan contains the leaf positions for all 177 control points (gantry angles). In-house software was developed that interpolates the measured images based on the gantry angle and overlays them with the MLC pattern for all control points. The 38% isointensity line was used to define the edge of the MLC leaves on the portal images. The software generates graphs and tables that provide analysis for the number of mismatched leaf positions for a chosen distance to agreement at each control point and the frequency in which each particular leaf mismatches for the entire arc. Results: Seven patients plans were analyzed using this method. The leaves with the highest mismatched rate were found to be treatment plan dependent. Conclusions: This in-house software can be used to automatically verify the MLC leaf positions for all control points of VMAT plans using cine images acquired by an EPID.
The dosimetric impact of inversely optimized arc radiotherapy plan modulation for real-time dynamic MLC tracking delivery
Purpose: Real-time dynamic multileaf collimator (MLC) tracking for management of intrafraction tumor motion can be challenging for highly modulated beams, as the leaves need to travel far to adjust for target motion perpendicular to the leaf travel direction. The plan modulation can be reduced by using a leaf position constraint (LPC) that reduces the difference in the position of adjacent MLC leaves in the plan. The purpose of this study was to investigate the impact of the LPC on the quality of inversely optimized arc radiotherapy plans and the effect of the MLC motion pattern on the dosimetric accuracy of MLC tracking delivery. Specifically, the possibility of predicting the accuracy of MLC tracking delivery based on the plan modulation was investigated. Methods: Inversely optimized arc radiotherapy plans were created on CT-data of three lung cancer patients. For each case, five plans with a single 358 deg. arc were generated with LPC priorities of 0 (no LPC), 0.25, 0.5, 0.75, and 1 (highest possible LPC), respectively. All the plans had a prescribed dose of 2 Gy x 30, used 6 MV, a maximum dose rate of 600 MU/min and a collimator angle of 45 deg. or 315 deg. To quantify the plan modulation, an average adjacent leaf distance (ALD) was calculated by averaging the mean adjacent leaf distance for each control point. The linear relationship between the plan quality [i.e., the calculated dose distributions and the number of monitor units (MU)] and the LPC was investigated, and the linear regression coefficient as well as a two tailed confidence level of 95% was used in the evaluation. The effect of the plan modulation on the performance of MLC tracking was tested by delivering the plans to a cylindrical diode array phantom moving with sinusoidal motion in the superior-inferior direction with a peak-to-peak displacement of 2 cm and a cycle time of 6 s. The delivery was adjusted to the target motion using MLC tracking, guided in real-time by an infrared optical system. The dosimetric results were evaluated using gamma index evaluation with static target measurements as reference. Results: The plan quality parameters did not depend significantly on the LPC (p {>=} 0.066), whereas the ALD depended significantly on the LPC (p < 0.001). The gamma index failure rate depended significantly on the ALD, weighted to the percentage of the beam delivered in each control point of the plan (ALD{sub w}) when MLC tracking was used (p < 0.001), but not for delivery without MLC tracking (p {>=} 0.342). The gamma index failure rate with the criteria of 2% and 2 mm was decreased from > 33.9% without MLC tracking to <31.4% (LPC 0) and <2.2% (LPC 1) with MLC tracking. Conclusions: The results indicate that the dosimetric robustness of MLC tracking delivery of an inversely optimized arc radiotherapy plan can be improved by incorporating leaf position constraints in the objective function without otherwise affecting the plan quality. The dosimetric robustness may be estimated prior to delivery by evaluating the ALD{sub w} of the plan.
Development and clinical evaluation of automatic fiducial detection for tumor tracking in cine megavoltage images during volumetric modulated arc therapy
Purpose: Real-time tracking of implanted fiducials in cine megavoltage (MV) imaging during volumetric modulated arc therapy (VMAT) delivery is complicated due to the inherent low contrast of MV images and potential blockage of dynamic leaves configurations. The purpose of this work is to develop a clinically practical autodetection algorithm for motion management during VMAT. Methods: The expected field-specific segments and the planned fiducial position from the Eclipse (Varian Medical Systems, Palo Alto, CA) treatment planning system were projected onto the MV images. The fiducials were enhanced by applying a Laplacian of Gaussian filter in the spatial domain for each image, with a blob-shaped object as the impulse response. The search of implanted fiducials was then performed on a region of interest centered on the projection of the fiducial when it was within an open field including the case when it was close to the field edge or partially occluded by the leaves. A universal template formula was proposed for template matching and normalized cross correlation was employed for its simplicity and computational efficiency. The search region for every image was adaptively updated through a prediction model that employed the 3D position of the fiducial estimated from the localized positions in previous images. This prediction model allowed the actual fiducial position to be tracked dynamically and was used to initialize the search region. The artifacts caused by electronic interference during the acquisition were effectively removed. A score map was computed by combining both morphological information and image intensity. The pixel location with the highest score was selected as the detected fiducial position. The sets of cine MV images taken during treatment were analyzed with in-house developed software written in MATLAB (The Mathworks, Inc., Natick, MA). Five prostate patients were analyzed to assess the algorithm performance by measuring their positioning accuracy during treatment. Results: The algorithm was able to accurately localize the fiducial position on MV images with success rates of more than 90% per case. The percentage of images in which each fiducial was localized in the studied cases varied between 23% and 65%, with at least one fiducial having been localized between 40% and 95% of the images. This depended mainly on the modulation of the plan and fiducial blockage. The prostate movement in the presented cases varied between 0.8 and 3.5 mm (mean values). The maximum displacement detected among all patients was of 5.7 mm. Conclusions: An algorithm for automatic detection of fiducial markers in cine MV images has been developed and tested with five clinical cases. Despite the challenges posed by complex beam aperture shapes, fiducial localization close to the field edge, partial occlusion of fiducials, fast leaf and gantry movement, and inherently low MV image quality, good localization results were achieved in patient images. This work provides a technique for enabling real-time accurate fiducial detection and tumor tracking during VMAT treatments without the use of extra imaging dose.