Search NASA⌕ Search

SEARCH · Search NASA

Results for “Sequence Analysis, RNA”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 73 records · Page 4
All sourcesNASA NTRSDOE OSTI
NASA NTRS2004

gyrB as a phylogenetic discriminator for members of the Bacillus anthracis-cereus-thuringiensis group

Bacillus anthracis, the causative agent of the human disease anthrax, Bacillus cereus, a food-borne pathogen capable of causing human illness, and Bacillus thuringiensis, a well-characterized insecticidal toxin producer, all cluster together within a very tight clade (B. cereus group) phylogenetically and are indistinguishable from one another via 16S rDNA sequence analysis. As new pathogens are continually emerging, it is imperative to devise a system capable of rapidly and accurately differentiating closely related, yet phenotypically distinct species. Although the gyrB gene has proven useful in discriminating closely related species, its sequence analysis has not yet been validated by DNA:DNA hybridization, the taxonomically accepted "gold standard". We phylogenetically characterized the gyrB sequences of various species and serotypes encompassed in the "B. cereus group," including lab strains and environmental isolates. Results were compared to those obtained from analyses of phenotypic characteristics, 16S rDNA sequence, DNA:DNA hybridization, and virulence factors. The gyrB gene proved more highly differential than 16S, while, at the same time, as analytical as costly and laborious DNA:DNA hybridization techniques in differentiating species within the B. cereus group.

Phylogeny↗
NASA NTRS1989

The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

Non-NASA Center↗
NASA NTRS2004

Microbial Characterization During the Early Habitation of the International Space Station

An evaluation of the microbiota from air, water, and surface samples provided a baseline of microbial characterization onboard the International Space Station (ISS) to gain insight into bacterial and fungal contamination during the initial stages of construction and habitation. Using 16S genetic sequencing and rep-PCR, 63 bacterial strains were isolated for identification and fingerprinted for microbial tracking. Of the bacterial strains that were isolated and fingerprinted, 19 displayed similarity to each other. The use of these molecular tools allowed for the identification of bacteria not previously identified using automated biochemical analysis and provided a clear indication of the source of several ISS contaminants. Strains of Bradyrhizobium and Sphingomonas unable to be identified using sequencing were identified by comparison of rep-PCR DNA fingerprints. Distinct DNA fingerprints for several strains of Methylobacterium provided a clear indication of the source of an ISS water supply contaminant. Fungal and bacterial data acquired during monitoring do not suggest there is a current microbial hazard to the spacecraft, nor does any trend indicate a potential health risk. Previous spacecraft environmental analysis indicated that microbial contamination will increase with time and will require continued surveillance. Copyright 2004 Springer-Verlag.

Fungi/genetics↗
DOE OSTI2026

Protocol for applying a network-enabled gene discovery pipeline to non-model plant species

Identifying upstream regulators of key genes is essential for understanding gene regulatory mechanisms and translating these insights into functional targets. Here, we present a protocol for applying the network-enabled gene discovery pipeline (NEEDLE) to non-model plant species. We describe steps for environment setup, data preparation, computational analysis, expected outputs, and parameter considerations. NEEDLE integrates RNA sequencing (RNA-seq) processing, weighted gene co-expression analysis (WGCNA), Gene Network Inference with Ensemble of trees (GENIE3), and promoter conservation analysis to prioritize candidate transcriptional regulators.

Plant Sciences↗
NASA NTRS2019

Radiation Stability Evaluation of Protein-Based Nanopores for Mars and Europa Missions

Exploration of our Solar System has revealed a number of locations that are now habitable or could have supported life in the past. One approach to finding life involves detection of informational polymers like deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) that are definitive biosignatures for life as we know it. Alternatively, structural variants of DNA and RNA, collectively termed xenonucleic acids (XNAs) have been shown in the laboratory to behave similarly. Nanopore-based sequencers differ from traditional sequencing technologies in that they do not explicitly require synthesis of DNA before or during analysis. Because of this, nanopore sequencers have been used for the direct sequencing of RNA, and could be used for the detection and analysis of other charged polymers. Here we describe results of exposing the MinION hardware, flow cells, and key reagents to ionizing radiation at doses relevant to Mars and Europa missions (10 to 3000 silicon-equivalent gray).

Burton, Aaron S.↗
DOE OSTI2021

Community RNA-Seq: multi-kingdom responses to living versus decaying roots in soil

Abstract Roots are a primary source of organic carbon input in most soils. The consumption of living and detrital root inputs involves multi-trophic processes and multiple kingdoms of microbial life, but typical microbial ecology studies focus on only one or two major lineages. We used Illumina shotgun RNA sequencing to conduct PCR-independent SSU rRNA community analysis (“community RNA-Seq”) and simultaneously assess the bacteria, archaea, fungi, and microfauna surrounding both living and decomposing roots of the annual grass, Avena fatua. Plants were grown in 13CO2-labeled microcosms amended with 15N-root litter to identify the preferences of rhizosphere organisms for root exudates (13C) versus decaying root biomass (15N) using NanoSIMS microarray imaging (Chip-SIP). When litter was available, rhizosphere and bulk soil had significantly more Amoebozoa, which are potentially important yet often overlooked top-down drivers of detritusphere community dynamics and nutrient cycling. Bulk soil containing litter was depleted in Actinobacteria but had significantly more Bacteroidetes and Proteobacteria. While Actinobacteria were abundant in the rhizosphere, Chip-SIP showed Actinobacteria preferentially incorporated litter relative to root exudates, indicating this group’s more prominent role in detritus elemental cycling in the rhizosphere. Our results emphasize that decomposition is a multi-trophic process involving complex interactions, and our methodology can be used to track the trajectory of carbon through multi-kingdom soil food webs.

Nuccio, Erin E. (ORCID:000000030189183X)↗
DOE OSTI2022

A Pilot Study of Whole-Blood Transcriptomic Analysis to Identify Genes Associated with Repetitive Low-Level Blast Exposure in Career Breachers

Repetitive low-level blast exposure is one of the major occupational health concerns among US military service members and law enforcement. This study seeks to identify gene expression using microRNA and RNA sequencing in whole-blood samples from experienced breachers and unexposed controls. We performed experimental RNA sequencing using Illumina’s HiSeq 2500 Sequencing System, and microRNA analysis using NanoString Technology nCounter miRNA expression panel in whole-blood total RNA samples from 15 experienced breachers and 14 age-, sex-, and race-matched unexposed controls. We identified 10 significantly dysregulated genes between experienced breachers and unexposed controls, with FDR corrected <0.05: One upregulated gene, LINC00996 (long intergenic non-protein coding RNA 996); and nine downregulated genes, IGLV3-16 (immunoglobulin lambda variable 3-16), CD200 (CD200 molecule), LILRB5 (leukocyte immunoglobulin-like receptor B5), ZNF667-AS1 (ZNF667 antisense RNA 1), LMOD1 (leiomodin 1), CNTNAP2 (contactin-associated protein 2), EVPL (envoplakin), DPF3 (double PHD fingers 3), and IGHV4-34 (immunoglobulin heavy variable 4-34). The dysregulated gene expressions reported here have been associated with chronic inflammation and immune response, suggesting that these pathways may relate to the risk of lasting neurological symptoms following high exposures to blast over a career.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

NF-κB perturbation reveals unique immunomodulatory functions in Prx1 + fibroblasts that promote development of atopic dermatitis

Skin is composed of diverse cell populations that cooperatively maintain homeostasis. Up-regulation of the nuclear factor κB (NF-κB) pathway may lead to the development of chronic inflammatory disorders of the skin, but its role during the early events remains unclear. Here, through analysis of single-cell RNA sequencing data via iterative random forest leave one out prediction, an explainable artificial intelligence method, we identified an immunoregulatory role for a unique paired related homeobox-1 (Prx1) + fibroblast subpopulation. Disruption of Ikkb–NF-κB under homeostatic conditions in these fibroblasts paradoxically induced skin inflammation due to the overexpression of C-C motif chemokine ligand 11 (CCL11; or eotaxin-1) characterized by eosinophil infiltration and a subsequent T H 2 immune response. Because the inflammatory phenotype resembled that seen in human atopic dermatitis (AD), we examined human AD skin samples and found that human AD fibroblasts also overexpressed CCL11 and that perturbation of Ikkb–NF-κB in primary human dermal fibroblasts up-regulated CCL11. Monoclonal antibody treatment against CCL11 was effective in reducing the eosinophilia and T H 2 inflammation in a mouse model. Together, the murine model and human AD specimens point to dysregulated Prx1 + fibroblasts as a previously unrecognized etiologic factor that may contribute to the pathogenesis of AD and suggest that targeting CCL11 may be a way to treat AD-like skin lesions.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2024

Protein N -Glycans in Healthy and Sclerotic Glomeruli in Diabetic Kidney Disease

Diabetes is expected to directly affect renal glycosylation; yet to date, there has not been a comprehensive evaluation of alterations in N-glycan composition in the glomeruli of patients with diabetic kidney disease (DKD). Here, we used untargeted mass spectrometry imaging to identify N-glycan structures in healthy and sclerotic glomeruli in formalin-fixed paraffin-embedded sections from needle biopsies of five patients with DKD and three healthy kidney samples. Regional proteomics was performed on glomeruli from additional biopsies from the same patients to compare the abundances of enzymes involved in glycosylation. Secondary analysis of single-nucleus RNA sequencing (snRNAseq) data were used to inform on transcript levels of glycosylation machinery in different cell types and states. We detected 120 N-glycans, and among them, we identified 12 of these protein post-translated modifications that were significantly increased in glomeruli. All glomeruli-specific N-glycans contained an N-acetyllactosamine epitope. Five N-glycan structures were highly discriminant between sclerotic and healthy glomeruli. Sclerotic glomeruli had an additional set of glycans lacking fucose linked to their core, and they did not show tetra-antennary structures that were common in healthy glomeruli. Orthogonal omics analyses revealed lower protein abundance and lower gene expression involved in synthesizing fucosylated and branched N-glycans in sclerotic podocytes. In snRNAseq and regional proteomics analyses, we observed that genes and/or proteins involved in sialylation and N-acetyllactosamine synthesis were also downregulated in DKD glomeruli, but this alteration remained undetectable by our spatial N-glycomics assay. Integrative spatial glycomics, proteomics, and transcriptomics revealed protein N-glycosylation characteristic of sclerotic glomeruli in DKD.

60 APPLIED LIFE SCIENCES↗
NASA NTRS1992

A partial phylogenetic analysis of the "flavobacter-bacteroides" phylum: basis for taxonomic restructuring

On the basis of small subunit rRNA sequence analyses five major subgroups within the flavobacteria-bacteroides phylum have been defined. These are tentatively designated the cytophaga subgroup (comprising largely Cytophaga species), the flavobacter subgroup (comprising the true flavobacteria and the polyphyletic genus Weeksella), the bacteroides subgroup (comprising the bacteroides and certain cytophaga-like bacteria), the sphingobacter subgroup (which contains the known sphingolipid-producing members of the phylum), and the saprospira subgroup (comprising particular species of Flexibacter, Flavobacterium, Haliscomenobacter, and, of course, the genus Saprospira). These groupings are given not only by evolutionary distance analysis, but can be defined and distinguished on the basis of a simple small subunit rRNA signatures.

NASA Discipline Exobiology↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Long-read RNA sequencing atlas of human microglia isoforms elucidates disease-associated genetic regulation of splicing

Microglia, the innate immune cells of the central nervous system, have been genetically implicated in multiple neurodegenerative diseases. Mapping the genetics of gene expression in human microglia has identified several loci associated with disease-associated genetic variants in microglia-specific regulatory elements. However, identifying genetic effects on splicing is challenging because of the use of short sequencing reads. Here, we present the isoform-centric microglia genomic atlas (isoMiGA), which leverages long-read RNA sequencing to identify 35,879 novel microglia isoforms. We show that these isoforms are involved in stimulation response and brain region specificity. We then quantified the expression of both known and novel isoforms in a multi-ancestry meta-analysis of 555 human microglia short-read RNA sequencing samples from 391 donors, and found associations with genetic risk loci in Alzheimer’s and Parkinson’s disease. We nominate several loci that may act through complex changes in isoform and splice-site usage.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

A Genome-Scale Atlas Reveals Complex Interplay of Transcription and Translation in an Archaeon

The scale of post-transcriptional regulation and the implications of its interplay with other forms of regulation in environmental acclimation are underexplored for organisms of the domain Archaea. Here, we have investigated the scale of post-transcriptional regulation in the extremely halophilic archaeon Halobacterium salinarum NRC-1 by integrating the transcriptome-wide locations of transcript processing sites (TPSs) and SmAP1 binding, the genome-wide locations of antisense RNAs (asRNAs), and the consequences of RNase_2099C knockout on the differential expression of all genes. This integrated analysis has discovered that 54% of all protein-coding genes in the genome of this haloarchaeon are likely targeted by multiple mechanisms for putative post-transcriptional processing and regulation, with about 20% of genes likely being regulated by combinatorial schemes involving SmAP1, asRNAs, and RNase_2099C. Comparative analysis of mRNA levels (transcriptome sequencing [RNA-Seq]) and protein levels (sequential window acquisition of all theoretical fragment ion spectra mass spectrometry [SWATH-MS]) for 2,579 genes over four phases of batch culture growth in complex medium generated additional evidence for the conditional post-transcriptional regulation of 7% of all protein-coding genes. We demonstrate that post-transcriptional regulation may act to fine-tune specialized and rapid acclimation to stressful environments, e.g., as a switch to turn on gas vesicle biogenesis to promote vertical relocation under anoxic conditions and modulate the frequency of transposition by insertion sequence (IS) elements of the IS200/IS605, IS4, and ISH3 families. Findings from this study are provided as an atlas in a public Web resource (https://halodata.systemsbiology.net).

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Real-time structural motif searching in proteins using an inverted index strategy

Biochemical and biological functions of proteins are the product of both the overall fold of the polypeptide chain, and, typically, structural motifs made up of smaller numbers of amino acids constituting a catalytic center or a binding site that may be remote from one another in amino acid sequence. Detection of such structural motifs can provide valuable insights into the function(s) of previously uncharacterized proteins. Technically, this remains an extremely challenging problem because of the size of the Protein Data Bank (PDB) archive. Existing methods depend on a clustering by sequence similarity and can be computationally slow. We have developed a new approach that uses an inverted index strategy capable of analyzing >170,000 PDB structures with unmatched speed. The efficiency of the inverted index method depends critically on identifying the small number of structures containing the query motif and ignoring most of the structures that are irrelevant. Our approach (implemented at motif.rcsb.org ) enables real-time retrieval and superposition of structural motifs, either extracted from a reference structure or uploaded by the user. Herein, we describe the method and present five case studies that exemplify its efficacy and speed for analyzing 3D structures of both proteins and nucleic acids.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

A robust method of nuclei isolation for single-cell RNA sequencing of solid tissues from the plant genus Populus

Single-cell transcriptome analysis has been extensively applied in humans and animal models to uncover gene expression heterogeneity between the different cell types of a tissue or an organ. It demonstrated its capability to discover key regulatory elements that determine cell fate during developmental programs. Single-cell analysis requires the isolation and labeling of the messenger RNA (mRNA) derived from each cell. These challenges were primarily addressed in mammals by developing microfluidic-based approaches. For plant species whose cells contain cell walls, these approaches have generally required the generation of isolated protoplasts. Many plant tissues’ secondary cell wall hinders enzymatic digestion required for individual protoplast isolation, resulting in an unequal representation of cell types in a protoplast population. This limitation is especially critical for cell types located in the inner layers of a tissue or the inner tissues of an organ. Consequently, single-cell RNA sequencing (scRNA-seq) studies using microfluidic approaches in plants have mainly been restricted to Arabidopsis roots, for which well-established procedures of protoplast isolation are available. Here we present a simple alternative approach to generating high-quality protoplasts from plant tissue by characterizing the mRNA extracted from individual nuclei instead of whole cells. We developed the protocol using two different plant materials with varying cellular complexity levels and cell wall structure, Populus shoot apices, and more lignified stems. Using the 10× Genomics Chromium technology, we show that this procedure results in intact mRNA isolation and limited leakage, with a broad representation of individual cell transcriptomes.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2024

Proteogenomic characterization of difficult-to-treat breast cancer with tumor cells enriched through laser microdissection

Abstract Background Breast cancer (BC) is the most commonly diagnosed cancer and the leading cause of cancer death among women globally. Despite advances, there is considerable variation in clinical outcomes for patients with non-luminal A tumors, classified as difficult-to-treat breast cancers (DTBC). This study aims to delineate the proteogenomic landscape of DTBC tumors compared to luminal A (LumA) tumors. Methods We retrospectively collected a total of 117 untreated primary breast tumor specimens, focusing on DTBC subtypes. Breast tumors were processed by laser microdissection (LMD) to enrich tumor cells. DNA, RNA, and protein were simultaneously extracted from each tumor preparation, followed by whole genome sequencing, paired-end RNA sequencing, global proteomics and phosphoproteomics. Differential feature analysis, pathway analysis and survival analysis were performed to better understand DTBC and investigate biomarkers. Results We observed distinct variations in gene mutations, structural variations, and chromosomal alterations between DTBC and LumA breast tumors. DTBC tumors predominantly had more mutations inTP53,PLXNB3, Zinc finger genes, and fewer mutations inSDC2,CDH1,PIK3CA,SVIL, andPTEN. Notably, Cytoband 1q21, which contains numerous cell proliferation-related genes, was significantly amplified in the DTBC tumors. LMD successfully minimized stromal components and increased RNA–protein concordance, as evidenced by stromal score comparisons and proteomic analysis. Distinct DTBC and LumA-enriched clusters were observed by proteomic and phosphoproteomic clustering analysis, some with survival differences. Phosphoproteomics identified two distinct phosphoproteomic profiles for high relapse-risk and low relapse-risk basal-like tumors, involving several genes known to be associated with breast cancer oncogenesis and progression, includingKIAA1522,DCK,FOXO3,MYO9B,ARID1A,EPRS,ZC3HAV1, andRBM14. Lastly, an integrated pathway analysis of multi-omics data highlighted a robust enrichment of proliferation pathways in DTBC tumors. Conclusions This study provides an integrated proteogenomic characterization of DTBC vs LumA with tumor cells enriched through laser microdissection. We identified many common features of DTBC tumors and the phosphopeptides that could serve as potential biomarkers for high/low relapse-risk basal-like BC and possibly guide treatment selections.

Oncology↗
NASA NTRS2023

Uncovering Unique Molecular Adaptations in the Arabidopsis Thaliana Cvi-0 Ecotype

This research proposal aims to investigate the unique molecular adaptations exhibited by Arabidopsis Thaliana, specifically focusing on the Cape Verde Islands (Cvi-0) ecotype, in response to microgravity conditions. The study examines data from NASA’s Open Science Data Repository and applies a multifaceted RNAseq analysis pipeline using tools in the UseGalaxy.org open platform. Through transcriptomic analysis, differential gene expression patterns were identified in Cvi-0, revealing an absence of heat shock protein (HSP) upregulation and an upregulation of Rubisco Activase (RCA) and chloroplast-related pathways. To test the hypothesis that these adaptations may contribute to Cvi-0’s increased adaptability in microgravity, a three-fold experimental design is proposed. Four experimental groups will be cultivated under simulated microgravity and ground control conditions, including Cvi-0, Col-0, and genetically modified Col-0 with silenced HSP genes, and genetically modified Col-0 with upregulated RCA gene. Growth parameters will be measured to assess plant resilience, and RNA sequencing will provide transcriptomic data for pathway analysis. Anticipated outcomes include improved markers of plant health (mass, growth, etc.) of Cvi-0 in simulated microgravity and enhanced resilience in genetically altered Col-0 variants, providing insights into potential mechanisms of adaptation. This research would bear significance for space agriculture, nutrition for extended space missions, and sustainable terrestrial crop enhancement. Moreover, the insights gained could reshape crop engineering on Earth, enhancing robustness to climate induced stresses and bolstering global food security. The proposal’s trajectory blends scientific curiosity with practical applicability, forging a path towards sustainable food production and improving human exploration beyond our planet.

GL4HS↗