Search NASA⌕ Search

SEARCH · Search NASA

Results for “inducible expression”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 73 records · Page 4
All sourcesNASA NTRSDOE OSTI
DOE OSTI2026

YAP1 Dysfunction Promotes Molecular Properties Linked to Breast Cancer Susceptibility

YAP1 is a cotranscription factor that promotes malignant and stem cell properties in cancer. We previously found that YAP1 dysregulation is associated with aging in human mammary epithelia. With increased age, YAP1 expression changes in luminal epithelial cells, the prospective breast cancer cell of origin. Because age is a significant risk factor for breast cancer, we tested whether YAP1 dysregulation acted early in cancer progression by conferring cellular states associated with increased cancer susceptibility. In this study, we find that with increased age and genetic risk for developing cancer, human breast tissues showed significantly increased YAP1 expression, and cultured primary human mammary epithelial cells (HMEC) showed significantly increased expression of both YAP1 and its transcriptional targets. Increased YAP1 expression in cultured HMEC induced gene expression changes associated with increased cancer susceptibility, such as genes associated with stem cell states, increased telomerase activity, breast cancer progression, and increased age and genetic breast cancer risk. Furthermore, overexpression of YAP1 in post-stasis HMEC—finite lifespan cells that have bypassed a retinoblastoma-mediated senescence barrier—promoted properties related to increased growth potential. We found that YAP1 dysregulation in finite epithelial cells allows for access to gene programs and functions that are typically thought to be restricted to stem cells. We hypothesize that YAP1 acts early in breast cancer progression, long before the development of a tumor, to impose cancer-susceptible molecular states.

YAP1↗
NASA NTRS2009

Changes of Gene Expression in the Apoptosis Pathway in Lncap and PC3 Cells Exposed to X-Rays or Protons

Radio-resistant or recurrent prostate cancer represents a serious health risk for approximately 20%-30% of patients treated with primary radiation therapy for clinically localized prostate cancer. In our current studies, we investigated the expressions of apoptosis related gene expression profile (84 genes) in two distinct prostate cell lines Lncap (P53+ and AR+) and PC3 (P53- and AR-) before and after exposure to X-rays or protons, using cDNA PCR arrays. In Lncap cells, 10Gy X-ray radiation significantly induced the expression of 19 out of 84 genes at 4h after irradiation. The changed genes were mostly in death and death receptor domain families, TNF ligand and receptor families, and apoptotic group of the BCL2 family, especially in P53 related genes, such as FAS, BAX, BAK1 and GADD45A. In PC3, X-rays only induced the expression of 3 genes, including an increased expression of BIRC3. There was no difference of the X-ray mediated cell killing in both cell lines using the cell cycle analysis. However, these X-ray-induced gene expression differences between PC3 and Lncap may explain the phenotype of PC3 cells that shows more tolerant not only to radiation, but also to other apoptosis inducing and sensitizing reagents. To compare the effectiveness of cell killing with X-rays, we also exposed PC3 cells to 10Gy protons at the Bragg peak region. Protons did not induce more apoptosis than X-rays for the same dose. In comparison to X-rays, protons significantly altered expressions of 13 genes in PC3, which included decreased expressions of anti-apoptosis genes (BCL2 and BCL2L2), and increased expressions of death and death receptor domain family genes, TNF ligand and receptor family and several kinases (FAS, DAPK1 and RIPK2). These data suggest that proton treatment is more effective in influencing the apoptosis pathways in PC3 cells than X-rays, thus protons may be more effective in the treatment of specific prostate tumor.

Zhang, Ye↗
DOE OSTI2020

Host cells and methods using a repressor polypeptide and an inducible promoter for gene expression

The present invention provides for a system comprising (a) a first nucleic acid comprising a nucleotide sequence encoding a nucleotide sequence of interest operatively linked to a promoter comprising a repressor polypeptide binding site, and (b) a second nucleic acid comprising a nucleotide sequence encoding a repressor polypeptide having at least 70% amino acid identity with EilR, SmvR, KmrR, RcdA, or QacR; wherein expression of the nucleotide sequence of interest from the promoter is induced by the presence of a hydrophobic inducer, such as a hydrophobic cation inducer, such as a triarylmethane, acridine, phenazine, phenothiazine, or xanthene.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2022

Host cells and methods using a repressor polypeptide and an inducible promoter for gene expression

The present invention provides for a system comprising (a) a first nucleic acid comprising a nucleotide sequence encoding a nucleotide sequence of interest operatively linked to a promoter comprising a repressor polypeptide binding site, and (b) a second nucleic acid comprising a nucleotide sequence encoding a repressor polypeptide having at least 70% amino acid identity with EilR, SmvR, KmrR, RcdA, or QacR; wherein expression of the nucleotide sequence of interest from the promoter is induced by the presence of a hydrophobic inducer, such as a hydrophobic cation inducer, such as a triarylmethane, acridine, phenazine, phenothiazine, or xanthene.

Ruegg, Thomas L.↗
NASA NTRS1997

Cyclic strain is a weak inducer of prostacyclin synthase expression in bovine aortic endothelial cells

Recent studies indicate that hemodynamic forces such as cyclic strain and shear stress can increase prostacyclin (PGI2) secretion by endothelial cells (EC) but the effect of these forces on prostacyclin synthase (PGIS) gene expression remains unclear and is the focus of this study. Bovine aortic EC were seeded onto type I collagen coated flexible membranes and grown to confluence. The membranes and attached EC were subjected to 10% average strain at 60 cpm (0.5 sec deformation alternating with 0.5 sec relaxation) for up to 5 days. PGIS gene expression was determined by Northern blot analysis and protein level by Western blot analysis. The effect of cyclic strain on the PGIS promoter was determined by the transfection of a 1-kb human PGIS gene promoter construct coupled to a luciferase reporter gene into EC, followed by determination of luciferase activity. PGIS gene expression increased 1.7-fold in EC subjected to cyclic strain for 24 hr. Likewise, EC transfected with a pGL3B-PGIS (-1070/-10) construct showed an approximate 1.3-fold elevation in luciferase activity in EC subjected to cyclic strain for 3, 4, 8, and 12 hr. The weak stimulation of PGIS gene expression by cyclic strain was reflected in an inability to detect alterations in PGIS protein levels in EC subjected to cyclic strain for as long as 5 days. These data suggest that strain-induced stimulation of PGIS gene expression plays only a minor role in the ability of cyclic strain to stimulate PGI2 release in EC. These findings coupled with our earlier demonstration of a requisite addition of exogenous arachidonate in order to observe strain-induced PGI2 release, implicates a mechanism that more likely involves strain-induced stimulation of PGIS activity.

Non-NASA Center↗
DOE OSTI2026

MassIVE MSV000100641 - Multilayered regulation by RNA thermometers enables precise control of Cas9 expression in E. coli: Cas9-based genome editing technologies can rapidly generate mutations to probe a diverse array of mutant genotypes. However, aberrant Cas9 nuclease translation and activity can occur despite the use of inducible promoters to control expression, leading to extensive cell death. This background killing caused by promoter leakiness severely limits the application of Cas9 for generating mutant libraries because of the potential for population skew. We demonstrate the utility of temperature sensitive RNA elements as a layer of post-transcriptional regulation to reduce the impact of promoter leak. We observe significant temperature-dependent increases in cell survival when certain RNA thermometers (RNATs) are placed upstream of the cas9 coding sequence. We also show that the most highly repressing RNAT, hsp17rep, significantly reduces population skew with a library of characterized guide RNAs in Escherichia coli. This strategy should be applicable to all bacterial Cas9-based methods and technologies.

Explore the source record for details and available documents.

Alexander, William G. [Oak Ridge National Laborato↗
DOE OSTI2021

Protective effect of SIRT6 on cholesterol crystal-induced endothelial dysfunction via regulating ACE2 expression

Highlights: • ACE2 was involved in CC-induced endothelial dysfunction. • SIRT1 and SIRT6 contributed to regulating the protein expression of ACE2 in CC-stimulated endothelial cells. • SIRT6 regulated ACE2 with intranuclear p-ATF2, but not affecting p-ATF2 expression in the cytoplasm. Sirtuins are a family of highly conserved nicotinamide adenine dinucleotide (NAD{sup +})-dependent enzymes. Among the sirtuins, SIRT1 and SIRT6 participate in the regulation of endothelial functions and play significant roles in the physiological and pathological processes of cardiovascular diseases (CVD). Recently, our study found that minute cholesterol crystals (CC) can be endocytosed by endothelial cells and further impair endothelial functions. Since previous studies have reported that angiotensin-converting enzyme (ACE2) involves Angiotensin (Ang) II-induced inflammation in endothelial cells, this study was designed to investigate the role of SIRT1 and SIRT6 in CC-induced variation of ACE2 expression and the related mechanism between SIRT6 and ACE2. We found that ACE2 is involved in CC-induced endothelial dysfunction, which inhibits decreases in nitric oxide (NO) level and endothelial nitric oxide synthase (eNOS) activity and increases in inflammatory factors and adhesion molecules. Besides, SIRT1 and SIRT6 regulated the protein expression of ACE2 in CC-stimulated human umbilical vein endothelial cells (HUVECs). Moreover, bioinformatics analysis from the Enrichr database indicated that activating transcription factor 2 (ATF2), is highly correlated with genes that significantly upregulated after infection with the SIRT6 adenovirus vector. In CC-induced HUVECs, ACE2 expression was up-regulated in cells transfected with ATF2 siRNA. However, further mechanism studies revealed that overexpression of SIRT6 decreases the accumulation of p-ATF2 in the nucleus, but did not affect p-ATF2 expression in the cytoplasm. Taken together, these data indicated that SIRT6 regulates ACE2 might via inhibiting the accumulation of nucleus p-ATF2 in CC-induced endothelial dysfunction.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2022

Functional Divergence in a Multi-gene Family Is a Key Evolutionary Innovation for Anaerobic Growth in Saccharomyces cerevisiae

The amplification and diversification of genes into large multi-gene families often mark key evolutionary innovations, but this process often creates genetic redundancy that hinders functional investigations. When the model budding yeast Saccharomyces cerevisiae transitions to anaerobic growth conditions, the cell massively induces the expression of seven serine/threonine-rich anaerobically-induced cell wall mannoproteins (anCWMPs): TIP1, TIR1, TIR2, TIR3, TIR4, DAN1, and DAN4. Here, we show that these genes likely derive evolutionarily from a single ancestral anCWMP locus, which was duplicated and translocated to new genomic contexts several times both prior to and following the budding yeast whole genome duplication (WGD) event. Based on synteny and their phylogeny, we separate the anCWMPs into four gene subfamilies. To resolve prior inconclusive genetic investigations of these genes, we constructed a set of combinatorial deletion mutants to determine their contributions toward anaerobic growth in S. cerevisiae. We found that two genes, TIR1 and TIR3, were together necessary and sufficient for the anCWMP contribution to anaerobic growth. Overexpressing either gene alone was insufficient for anaerobic growth, implying that they encode non-overlapping functional roles in the cell during anaerobic growth. We infer from the phylogeny of the anCWMP genes that these two important genes derive from an ancient duplication that predates the WGD event, whereas the TIR1 subfamily experienced gene family amplification after the WGD event. Taken together, the genetic and molecular evidence suggests that one key anCWMP gene duplication event, several auxiliary gene duplication events, and functional divergence underpin the evolution of anaerobic growth in budding yeasts.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

CsbZIP2-miR9748-CsNPF4.4 Module Mediates High Temperature Tolerance of Cucumber Through Jasmonic Acid Pathway

High temperature stress seriously affects the growth of cucumber seedlings, and even leads to a decline in yield and quality. miRNAs have been shown to be involved in regulating the response to stress in plants, but little is known about its effects on cucumber high temperature stress tolerance. Here, we found that high temperature stress induced the expression of miR9748 in cucumber. Overexpression of cucumber miR9748 in Arabidopsis improved high temperature tolerance. Transcriptome analysis revealed that miR9748 might mediate high temperature tolerance through plant hormone signal pathway. 5′ RNA ligase-mediated rapid amplification of cDNA ends (5′ RLM-RACE) and transient transformation technology demonstrated that CsNPF4.4 was the target gene of miR9748. CsNPF4.4 overexpression plants decreased high temperature tolerance accompanied by reducing the content of jasmonic acid (JA), but alleviated by foliar application of methyl jasmonate, indicating that CsNPF4.4 negatively regulated high temperature stress tolerance through inhibition JA signal pathway. Furthermore, high temperature stress also increased the expression level of CsbZIP2 . Yeast one-hybrid and dual-luciferase assays showed that CsbZIP2 directly bound to the promoter of MIR9748 to induce its expression. Taken together, our results indicated that CsbZIP2 directly regulated miR9748 expression to cleave CsNPF4.4 to mediate high temperature tolerance through JA pathway.

Li, Lan↗
NASA NTRS2001

Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis

The use of plants as integral components of life support systems remains a cornerstone of strategies for long-term human habitation of space and extraterrestrial colonization. Spaceflight experiments over the past few decades have refined the hardware required to grow plants in low-earth orbit and have illuminated fundamental issues regarding spaceflight effects on plant growth and development. Potential incipient hypoxia, resulting from the lack of convection-driven gas movement, has emerged as a possible major impact of microgravity. We developed transgenic Arabidopsis containing the alcohol dehydrogenase (Adh) gene promoter linked to the beta-glucuronidase (GUS) reporter gene to address specifically the possibility that spaceflight induces the plant hypoxia response and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. The staining patterns resulting from a 5-d mission on the orbiter Columbia during mission STS-93 indicate that the Adh/GUS reporter gene was activated in roots during the flight. However, the patterns of expression were not identical to terrestrial control inductions. Moreover, although terrestrial hypoxia induces Adh/GUS expression in the shoot apex, no apex staining was observed in the spaceflight plants. This indicates that either the normal hypoxia response signaling is impaired in spaceflight or that spaceflight inappropriately induces Adh/GUS activity for reasons other than hypoxia.

manned↗
DOE OSTI2021

Serum amyloid A1: Innocent bystander or active participant in cell migration in triple-negative breast cancer?

Highlights: • SAA1 knockdown reduced cell viability in triple-negative breast cancer cells. • SAA1 knockdown induced a S to G{sub 2}/M cell cycle shift in MDA-MB-231 cells. • SAA1 silencing inhibited cell migration in MDA-MB-231 and HCC70 cells. • SAA1 silencing altered epithelial-to-mesenchymal transition markers in MDA-MB-231 cells. The Serum Amyloid A (SAA) family of proteins is associated with various pathological conditions, including cancer. However, their role in cancer is incompletely understood. Here, we investigated the role of SAA1 in cell cycle regulation, apoptosis, survival signaling, metabolism, and metastasis in models of triple-negative breast cancer (TNBC), using RNAi. Our data show that in untransformed epithelial cells (MCF12A), the knockdown of SAA1 induces the expression of cell cycle regulators (MCM2, p53), the activation of DNA repair (PARP synthesis), and survival signaling (NFκB). In contrast, knockdown of SAA1 in the TNBC cell line (MDA-MB-231) induced the expression p16 and shifted cells in the cell cycle from the S to G{sub 2}/M phase, without the activation of DNA repair. Moreover, in SAA1-deficient MDA-MB-231 and HCC70 cells, metabolism (NADH oxidation) continually increased while cell migration (% wound closure and the rate of wound closure) decreased. However, silencing of SAA1 altered epithelial and mesenchymal markers in MCF12A (E-cadherin, Laminin 1β, Vimentin) and MDA-MB-231 (α-Smooth muscle actin) cells, associated with the metastatic program of epithelial-mesenchymal transition. Nonetheless, our data provide evidence that SAA1 could potentially serve as a therapeutic target in TNBC.

60 APPLIED LIFE SCIENCES↗
NASA NTRS2001

Genetic and chemical reductions in protein phosphatase activity alter auxin transport, gravity response, and lateral root growth

Auxin transport is required for important growth and developmental processes in plants, including gravity response and lateral root growth. Several lines of evidence suggest that reversible protein phosphorylation regulates auxin transport. Arabidopsis rcn1 mutant seedlings exhibit reduced protein phosphatase 2A activity and defects in differential cell elongation. Here we report that reduced phosphatase activity alters auxin transport and dependent physiological processes in the seedling root. Root basipetal transport was increased in rcn1 or phosphatase inhibitor-treated seedlings but showed normal sensitivity to the auxin transport inhibitor naphthylphthalamic acid (NPA). Phosphatase inhibition reduced root gravity response and delayed the establishment of differential auxin-induced gene expression across a gravity-stimulated root tip. An NPA treatment that reduced basipetal transport in rcn1 and cantharidin-treated wild-type plants also restored a normal gravity response and asymmetric auxin-induced gene expression, indicating that increased basipetal auxin transport impedes gravitropism. Increased auxin transport in rcn1 or phosphatase inhibitor-treated seedlings did not require the AGR1/EIR1/PIN2/WAV6 or AUX1 gene products. In contrast to basipetal transport, root acropetal transport was normal in phosphatase-inhibited seedlings in the absence of NPA, although it showed reduced NPA sensitivity. Lateral root growth also exhibited reduced NPA sensitivity in rcn1 seedlings, consistent with acropetal transport controlling lateral root growth. These results support the role of protein phosphorylation in regulating auxin transport and suggest that the acropetal and basipetal auxin transport streams are differentially regulated.

NASA Discipline Plant Biology↗
NASA NTRS2005

Bacillus subtilis spore survival and expression of germination-induced bioluminescence after prolonged incubation under simulated Mars atmospheric pressure and composition: implications for planetary protection and lithopanspermia

Bacterial endospores in the genus Bacillus are considered good models for studying interplanetary transfer of microbes by natural or human processes. Although spore survival during transfer itself has been the subject of considerable study, the fate of spores in extraterrestrial environments has received less attention. In this report we subjected spores of a strain of Bacillus subtilis, containing luciferase resulting from expression of an sspB-luxAB gene fusion, to simulated martian atmospheric pressure (7-18 mbar) and composition (100% CO(2)) for up to 19 days in a Mars simulation chamber. We report here that survival was similar between spores exposed to Earth conditions and spores exposed up to 19 days to simulated martian conditions. However, germination-induced bioluminescence was lower in spores exposed to simulated martian atmosphere, which suggests sublethal impairment of some endogenous spore germination processes.

Mars↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS2000

Ca(2+) regulates fluid shear-induced cytoskeletal reorganization and gene expression in osteoblasts

Osteoblasts subjected to fluid shear increase the expression of the early response gene, c-fos, and the inducible isoform of cyclooxygenase, COX-2, two proteins linked to the anabolic response of bone to mechanical stimulation, in vivo. These increases in gene expression are dependent on shear-induced actin stress fiber formation. Here, we demonstrate that MC3T3-E1 osteoblast-like cells respond to shear with a rapid increase in intracellular Ca(2+) concentration ([Ca(2+)](i)) that we postulate is important to subsequent cellular responses to shear. To test this hypothesis, MC3T3-E1 cells were grown on glass slides coated with fibronectin and subjected to laminar fluid flow (12 dyn/cm(2)). Before application of shear, cells were treated with two Ca(2+) channel inhibitors or various blockers of intracellular Ca(2+) release for 0. 5-1 h. Although gadolinium, a mechanosensitive channel blocker, significantly reduced the [Ca(2+)](i) response, neither gadolinium nor nifedipine, an L-type channel Ca(2+) channel blocker, were able to block shear-induced stress fiber formation and increase in c-fos and COX-2 in MC3T3-E1 cells. However, 1, 2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid-AM, an intracellular Ca(2+) chelator, or thapsigargin, which empties intracellular Ca(2+) stores, completely inhibited stress fiber formation and c-fos/COX-2 production in sheared osteoblasts. Neomycin or U-73122 inhibition of phospholipase C, which mediates D-myo-inositol 1,4,5-trisphosphate (IP(3))-induced intracellular Ca(2+) release, also completely suppressed actin reorganization and c-fos/COX-2 production. Pretreatment of MC3T3-E1 cells with U-73343, the inactive isoform of U-73122, did not inhibit these shear-induced responses. These results suggest that IP(3)-mediated intracellular Ca(2+) release is required for modulating flow-induced responses in MC3T3-E1 cells.

Non-NASA Center↗
NASA NTRS2001

Vascular defense responses in rice: peroxidase accumulation in xylem parenchyma cells and xylem wall thickening

The rice bacterial blight pathogen Xanthomonas oryzae pv. oryzae is a vascular pathogen that elicits a defensive response through interaction with metabolically active rice cells. In leaves of 12-day-old rice seedlings, the exposed pit membrane separating the xylem lumen from the associated parenchyma cells allows contact with bacterial cells. During resistant responses, the xylem secondary walls thicken within 48 h and the pit diameter decreases, effectively reducing the area of pit membrane exposed for access by bacteria. In susceptible interactions and mock-inoculated controls, the xylem walls do not thicken within 48 h. Xylem secondary wall thickening is developmental and, in untreated 65-day-old rice plants, the size of the pit also is reduced. Activity and accumulation of a secreted cationic peroxidase, PO-C1, were previously shown to increase in xylem vessel walls and lumen. Peptide-specific antibodies and immunogold-labeling were used to demonstrate that PO-C1 is produced in the xylem parenchyma and secreted to the xylem lumen and walls. The timing of the accumulation is consistent with vessel secondary wall thickening. The PO-C1 gene is distinct but shares a high level of similarity with previously cloned pathogen-induced peroxidases in rice. PO-C1 gene expression was induced as early as 12 h during resistant interactions and peaked between 18 and 24 h after inoculation. Expression during susceptible interactions was lower than that observed in resistant interactions and was undetectable after infiltration with water, after mechanical wounding, or in mature leaves. These data are consistent with a role for vessel secondary wall thickening and peroxidase PO-C1 accumulation in the defense response in rice to X. oryzae pv. oryzae.

NASA Discipline Plant Biology↗