Search NASA⌕ Search

SEARCH · Search NASA

Results for “specification”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 73 records · Page 4
All sourcesNASA NTRSDOE OSTI
DOE OSTI2021

Pith–specific lignification in Nicotiana attenuata as a defense against a stem–boring herbivore

Plants have developed tissue-specific defense strategies in response to various herbivores with different feeding habits. Although defense responses to leaf-chewing insects have been well studied, little is known about stem-specific responses, particularly in the pith, to stem-boring herbivores. To understand the stem-specific defense, we first conducted a comparative transcriptomic analysis of the wild tobacco Nicotiana attenuata before and after attack by the leaf-chewing herbivore Manduca sexta and the stem borer Trichobaris mucorea. When the stem-boring herbivore attacked, lignin-associated genes were upregulated specifically in the inner parenchymal cells of the stem, the pith; lignin also accumulated highly in the attacked pith. Silencing the lignin biosynthetic gene cinnamyl alcohol dehydrogenase enhanced the performance of the stem-boring herbivore but had no effect on the growth of the leaf-chewing herbivore. Two-dimensional nuclear magnetic resonance results revealed that lignified pith contains feruloyltyramine as an unusual lignin component in the cell wall, as a response against stem-boring herbivore attack. Pith-specific lignification induced by the stem-boring herbivore was modulated by both jasmonate and ethylene signaling. Furthermore, these results suggest that lignin provides a stem-specific inducible barrier, protecting plants against stem-boring insects.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

To image, or not to image: class-specific diffractive cameras with all-optical erasure of undesired objects

Abstract Privacy protection is a growing concern in the digital era, with machine vision techniques widely used throughout public and private settings. Existing methods address this growing problem by, e.g., encrypting camera images or obscuring/blurring the imaged information through digital algorithms. Here, we demonstrate a camera design that performs class-specific imaging of target objects with instantaneous all-optical erasure of other classes of objects. This diffractive camera consists of transmissive surfaces structured using deep learning to perform selective imaging of target classes of objects positioned at its input field-of-view. After their fabrication, the thin diffractive layers collectively perform optical mode filtering to accurately form images of the objects that belong to a target data class or group of classes, while instantaneously erasing objects of the other data classes at the output field-of-view. Using the same framework, we also demonstrate the design of class-specific permutation and class-specific linear transformation cameras, where the objects of a target data class are pixel-wise permuted or linearly transformed following an arbitrarily selected transformation matrix for all-optical class-specific encryption, while the other classes of objects are irreversibly erased from the output image. The success of class-specific diffractive cameras was experimentally demonstrated using terahertz (THz) waves and 3D-printed diffractive layers that selectively imaged only one class of the MNIST handwritten digit dataset, all-optically erasing the other handwritten digits. This diffractive camera design can be scaled to different parts of the electromagnetic spectrum, including, e.g., the visible and infrared wavelengths, to provide transformative opportunities for privacy-preserving digital cameras and task-specific data-efficient imaging.

47 OTHER INSTRUMENTATION↗
DOE OSTI2025

Calcium is associated with specific soil organic carbon decomposition products at Blodgett Forest Research Center, Georgetown, California as analysed with scanning transmission X-ray microscopy carbon near-edge X-ray absorption fine structure spectroscopy

This data is from the paper calcium is associated with specific soil organic carbon decomposition products, published in SOIL. DOI: https://doi.org/10.5194/soil-11-381-2025, 2025.This file contains CSVs with spectral data and bulk soil data and there is no specific program required to open this data. The data includes Scanning transmission X-ray microscopy carbon near-edge X-ray absorption fine structure spectroscopy. data from the measurement of samples from the Whole-soil Warming project, run by the Belowground Biogeochemistry team at Blodgett Forest Research Center, Georgetown, California run by the University of California, Berkeley. It also includes bulk soil chemical properties. The University of California's Blodgett Forest Research Station (Forest) is situated in the Sierra Nevada foothills (1370 m a.s.l.) near Georgetown, California. The samples were collected from here: 38.912013, -120.661469, https://maps.app.goo.gl/291bCJ1zVqUhgktz6. The Forest soils were characterised as Alfisols, which are equivalent to Dystric Cambisols (IUSS Working Group WRB, 2015), and formed in granitic parent materials, in a temperate climate, under thinned, mixed-coniferous forest (Fig. S3; Gaudinski et al., 2009). With these analyses we aimed to answer the question, is calcium associated with a specific type of organic matter enriched in aromatic and phenolic carbon at the microscale in samples from Blodgett Forest Research Center? and how does this specific type of carbon respond to experiments targetted at removing and adding calcium to the soils, specifically cation exchange and incubation after calcium addition? Abstract from the paper can be found below: Calcium (Ca) may contribute to the preservation of soil organic carbon (SOC) in more ecosystems than previously thought. Here we provide evidence that Ca is co-located with SOC compounds that are enriched in aromatic and phenolic groups, across different acidic soil-types and locations with different ecosystem properties, differing in terms of climate, parent material, soil type, and vegetation. In turn, this co-localised fraction of Ca-SOC is removed through cation-exchange, and the association is then only re-established during decomposition in the presence of Ca (Ca addition incubation). Thus, highlighting a causative link between decomposition and the co-location of Ca with a characteristic fraction of SOC. Decomposition increases the relative proportion of negatively charged functional groups, which can increase the propensity for the association between SOC and Ca, and in turn, this association inhibits dissolved organic carbon export or further decomposition. We propose that this mechanism could be driven by Ca hotspots on the microscale shifting local decomposition processes and thereby explaining the colocation of Ca with SOC of a specific composition across different acidic soil environments. Incorporating this biogeochemical process into Earth System Models could improve our understanding, predictions, and management of carbon dynamics in soils, and account for their response to Ca-rich amendments.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2020

Uncovering the basis of protein-protein interaction specificity with a combinatorially complete library

Protein-protein interaction specificity is often encoded at the primary sequence level. However, the contributions of individual residues to specificity are usually poorly understood and often obscured by mutational robustness, sequence degeneracy, and epistasis. Using bacterial toxin-antitoxin systems as a model, we screened a combinatorially complete library of antitoxin variants at three key positions against two toxins. This library enabled us to measure the effect of individual substitutions on specificity in hundreds of genetic backgrounds. These distributions allow inferences about the general nature of interface residues in promoting specificity. We find that positive and negative contributions to specificity are neither inherently coupled nor mutually exclusive. Further, a wild-type antitoxin appears optimized for specificity as no substitutions improve discrimination between cognate and non-cognate partners. By comparing crystal structures of paralogous complexes, we provide a rationale for our observations. Collectively, this work provides a generalizable approach to understanding the logic of molecular recognition.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

3D Printed eutectic aluminum alloy has facility for site-specific properties

Additive manufacturing (AM) has the ability to print structures with site-specific properties. Existing AM approaches for site-specific properties are, however, based on complex processing-microstructure relationships in conventional alloys that were not designed for this purpose. Here, in this work, we report a straightforward approach for achieving site-specific properties that takes advantage of eutectic solidification characteristics. We demonstrate that the yield strength of a eutectic Al-Cu-Ce-Zr alloy can be tuned by varying the laser scan speed in concert with hatch spacing in laser powder bed fusion AM. A faster speed increases solidification rate resulting in finer eutectic spacing and higher strength. The hatch spacing is reduced at faster speeds to ensure overlap between melt pools which become smaller with increasing scan speed. The yield strength and its anisotropy relative to build direction are further tunable with a heat treatment. The scan speed-eutectic spacing-strength relationship is successfully applied to print a complex pattern of site-specific hardness in the alloy. The generalized principle of using AM for a eutectic alloy to create site-specific properties and anisotropy in properties is demonstrated.

36 MATERIALS SCIENCE↗
DOE OSTI2026

Novel Cell-Type-Specific Drought-Responsive Proteins in Root Tips of Field-Grown Perennial Switchgrass

The root-tip region of plants, including the root cap, forms the most basal terminal of the root and exhibits a high degree of cellular complexity in terms of morphology, cytological function, and interaction with environmental cues in the soil. Cells in this region follow a developmental trajectory, transitioning from stem cells to meristematic cells, and ultimately to fully differentiated cell types. However, our understanding of root-tip cell-type specific proteomic responses to abiotic stresses, such as drought, particularly under field conditions, remains limited. This study aimed to identify spatially resolved, cell type-specific proteomes in switchgrass (Panicum virgatum) root tips under drought stress. Root tips were collected from seven-year-old, field-grown switchgrass ‘Alamo’ plants excavated under both well-watered and long-term drought conditions. Cell type-specific proteins were identified using laser capture microdissection (LCM) coupled with nanoPOTS (Nanodroplet Processing in One Pot for Trace Samples) and nano-LC-MS proteomics analysis. Five distinct cell types were targeted: (1) cells in the quiescent center and stem cell niche (QuC), (2) protodermal epidermal cells (PEC) in the meristematic zone, (3) epidermal cells in the transition and elongation zones above the root cap (Epi), (4) peripheral root cap cells (PRC), forming 2–3 layers below the PEC and 1–2 layers above the root border cells, and (5) columella root cap cells (Col) comprising of the columella initials and a single underlying layer of cells undergoing active growth. Principal component analysis (PCA) revealed clear separation among the five targeted cell types, confirming distinct proteomic profiles. Proteins predominantly enriched in each cell type were linked to distinct cellular functions, with QuC cells showing involvement in chromosomal behavior, DNA replication, and mitosis—key processes for stem cell niche regulation. Drought stress resulted in alterations of proteostasis, as evidenced by significant decreases in ribosomal proteins and increases in protein synthesis inhibitors. Moreover, drought stress induced unique cell-type–specific proteins involved in phytohormone biosynthesis and signaling pathways, including auxin, cytokinin, and jasmonic acid. In particular, QuC cells were more highly enriched in proteins associated with DNA repair and mitotic processes. Metabolic pathways related to amino acids, carbohydrates, and lipids were differentially affected in a cell-type–dependent manner, whereas general stress-responsive proteins exhibited consistent changes across all five cell types. Overall, this study provides unique spatially resolved, cell-type-specific proteomic profiles in root tips, representing a significant advancement in our understanding of the cellular mechanisms underlying plant responses to drought stress in natural field conditions.

perennial grass↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Design Basis Document / Owner’s Technical Specification for Nitrate Salt Systems in CSP Projects (Final Technical Report)

The number of commercial coal, gas, and nuclear projects built over the past 100 years number in the thousands. As such, there is a large database, available to a wide range of commercial engineering contractors, on proven designs. In essence, unsuccessful designs have, through generations of iterations, been identified and then deleted from further consideration. In contrast, the number of commercial parabolic trough projects using nitrate salt for the thermal storage media is perhaps 60. Further, the number of commercial central receiver projects using nitrate salt as the working fluid is on the order of 20, including estimates for China. Given the relative immaturity of salt technology, and commercial pressures to successfully bid new solar projects into a mature electricity market, solar projects often promise more than has been delivered. The Design Basis Document / Owner’s Technical Specification is a first step in the iteration process. The report describes the successful features of commercial projects, outlines a range equipment and system failures in projects that didn’t operate as intended, and provides a draft set of design changes intended to correct the known problems. The product of the study is 3 volumes of technical material; one volume is on parabolic trough technologies; a second is on central receiver technologies, and the third is on potential design changes to parabolic trough and central receiver projects. The 3 volumes, which total some 590 pages, can be found at https://www.solardynllc.com/csp-plant-technologies. One of the principal topics in the report is the use of functional or prescriptive specifications. Functional specifications describe what the equipment needs to do, consistent with the minimum legal requirements of the local jurisdictions. The details of how this is to be accomplished is developed by the engineering contractor. Prescriptive specifications, which are developed by the Owner, prescribe to the engineering contractor how the functional requirements are to be met. This arrangement ensures that the favorable experience from a previous project is repeated. One example is the design code for the hot salt tank in central receiver projects. The closest design basis is API Standard 650 Welded Steel Tanks for Oil Storage. However, the maximum design temperature in API 650 is 260 °C. As such, solar projects have typically adopted a hybrid Code approach, in which allowable material stresses are taken from ASME Section II Materials. Further, since the tanks experience daily changes in temperature and in (static) pressure, and since portions of the tank can operate at stresses beyond the elastic range, the low cycle fatigue life of the tank is conducted using the rules of Section VIII Division 2. However, in a recent study by NREL, the principal damage mechanism was identified as creep rather than fatigue. Further, design stresses permitted under Section VIII Division 2, corresponding to a fatigue life of 30 years, result in projected creep lifetimes of only 2 to 5 years. An alternate design approach, prescribed by the Owner, would be based on Code sections intended for high temperature service in the creep regime. A candidate is Section III Division 5. Granted, this is a nuclear code section, and it’s use would not likely be mandated by local jurisdictions. However, the effects of creep have been deemed to be of sufficient importance that one nuclear project developer, and one central receiver project developer, have stipulated in the tank design specification that the equipment be designed to the requirements of Section III Division 5.

14 SOLAR ENERGY↗
DOE OSTI2022

Removal of Non-Specifically Bound Proteins Using Rayleigh Waves Generated on ST-Quartz Substrates

Label-free biosensors are plagued by the issue of non-specific protein binding which negatively affects sensing parameters such as sensitivity, selectivity, and limit-of-detection. In the current work, we explore the possibility of using the Rayleigh waves in ST-Quartz devices to efficiently remove non-specifically bound proteins via acoustic streaming. A coupled-field finite element (FE) fluid structure interaction (FSI) model of a surface acoustic wave (SAW) device based on ST-Quartz substrate in contact with a liquid loading was first used to predict trends in forces related to SAW-induced acoustic streaming. Based on model predictions, it is found that the computed SAW body force is sufficient to overcome adhesive forces between particles and a surface while lift and drag forces prevent reattachment for a range of SAW frequencies. We further performed experiments to validate the model predictions and observe that the excitation of Rayleigh SAWs removed non-specifically bound (NSB) antigens and antibodies from sensing and non-sensing regions, while rinsing and blocking agents were ineffective. An amplified RF signal applied to the device input disrupted the specific interactions between antigens and their capture antibody as well. ST-quartz allows propagation of Rayleigh and leaky SH-SAW waves in orthogonal directions. Thus, the results reported here could allow integration of three important biosensor functions on a single chip, i.e., removal of non-specific binding, mixing, and sensing in the liquid phase.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

SPC-2772 Rev 2 General Build to Print Fabrication Specification for Nuclear Use Items

This specification is for use with Safety Significant structures, systems, and components. The scope is for build to print fabrication including, but not limited to, machining, forming, welding, cutting, assembling, etc. Specific scope and associated requirements will be identified in drawings and/or additional procurement documents. ASME B31 fabrication is not included in the scope of this specification. Any conflict between this specification and referenced Codes and Standards, or any supplementary specifications in the procurement documents requires written clarification from the Contractor prior to proceeding with any work. Any deviation from the procurement documents requires approval by the Contractor with the change request process.

21 - SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLAN↗
DOE OSTI2024

SPC-70843 Rev 0 MARVEL Control Drum Actuator Fabrication Specification

Idaho National Laboratory (INL) is developing a microreactor to produce electrical power utilizing a small nuclear core and Stirling engines under the Microreactor Application Research Validation and Evaluation (MARVEL) program. This procurement specification defines the requirements for fabrication of components that make up the control drum (CD) actuators. This specification outlines the requirements for fabrication, acknowledging that specific elements will integrate into final assemblies, while others will be delivered as standalone components. The Subcontractor is not responsible for the CD actuator’s final assembly. Any conflict between this specification and referenced Codes and Standards, or any supplementary specifications in the procurement documents requires written clarification from the Contractor prior to proceeding with any work. Any deviation from the procurement documents requires approval by the Contractor with the change request process.

21 - SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLAN↗
DOE OSTI2023

A promising intersection of excited‐state‐specific methods from quantum chemistry and quantum Monte Carlo

Abstract We present a discussion of recent progress in excited‐state‐specific quantum chemistry and quantum Monte Carlo alongside a demonstration of how a combination of methods from these two fields can offer reliably accurate excited state predictions across singly excited, doubly excited, and charge transfer states. Both of these fields have seen important advances supporting excited state simulation in recent years, including the introduction of more effective excited‐state‐specific optimization methods, improved handling of complicated wave function forms, and ways of explicitly balancing the quality of wave functions for ground and excited states. To emphasize the promise that exists at this intersection, we provide demonstrations using a combination of excited‐state‐specific complete active space self‐consistent field theory, selected configuration interaction, and state‐specific variance minimization. These demonstrations show that combining excited‐state‐specific quantum chemistry and variational Monte Carlo can be more reliably accurate than either equation of motion coupled cluster theory or multi‐reference perturbation theory, and that it can offer new clarity in cases where existing high‐level methods do not agree. This article is categorized under: Electronic Structure Theory > Ab Initio Electronic Structure Methods Software > Quantum Chemistry

Otis, Leon↗
DOE OSTI2022

Investigation of Remanufacturing Methods Utilizing Mechanically-Generated and Gas-Atomized Feedstock Production for Directed Energy Deposition Processing Through Specific Energy Consumption Modeling

The goal of this work was to assess the energy consumption of a novel remanufacturing method that utilizes mechanically-generated feedstock for directed energy deposition. Gas-atomization is the state-of-the-art production process for directed energy deposition feedstock, and for this work was incorporated into a remanufacturing process path to provide a comparison method. Specific energy consumption models of remanufacturing utilizing both of these proposed process paths were developed and applied to a case study to investigate energy saving opportunities for future manufacturing paradigms. The energy modelling was done in three stages. First, the mechanically-generated feedstock production energy consumption model was generated from experimental observation. Second, the gas-atomized feedstock production energy consumption model was generated from a combination of experimental observation, reported estimates from the manufacturer, and data found in the literature. Lastly, the energy consumption model of directed energy deposition was derived from experimental observation and compares favorably with reported estimates in the literature. With the models, the specific energy consumption in the two process paths were compared and their application was demonstrated by estimating the energy consumption to remanufacture a bracket. The two feedstock production methods had similar specific energy consumptions. The specific energy consumption of the directed energy deposition process was the greatest component in the respective remanufacturing paths by an order of magnitude; increasing deposition rate is the most important factor for lowering the overall specific energy consumption. The analyzed remanufacturing technologies were estimated to consume less energy than replacement when repairing up to approximately 15% of the original part’s mass.

42 ENGINEERING↗
DOE OSTI2024

Molecular basis for dual functions in pilus assembly modulated by the lid of a pilus-specific sortase

The biphasic assembly of Gram-positive pili begins with the covalent polymerization of distinct pilins catalyzed by a pilus-specific sortase, followed by the cell wall anchoring of the resulting polymers mediated by the housekeeping sortase. In Actinomyces oris, the pilus-specific sortase SrtC2 not only polymerizes FimA pilins to assemble type 2 fimbriae with CafA at the tip, but it can also act as the anchoring sortase, linking both FimA polymers and SrtC1-catalyzed FimP polymers (type 1 fimbriae) to peptidoglycan when the housekeeping sortase SrtA is inactive. To date, the structure-function determinants governing the unique substrate specificity and dual enzymatic activity of SrtC2 have not been illuminated. Here, we present the crystal structure of SrtC2 solved to 2.10-Å resolution. SrtC2 harbors a canonical sortase fold and a lid typical for class C sortases and additional features specific to SrtC2. Structural, biochemical, and mutational analyses of SrtC2 reveal that the extended lid of SrtC2 modulates its dual activity. Specifically, we demonstrate that the polymerizing activity of SrtC2 is still maintained by alanine-substitution, partial deletion, and replacement of the SrtC2 lid with the SrtC1 lid. Strikingly, pilus incorporation of CafA is significantly reduced by these mutations, leading to compromised polymicrobial interactions mediated by CafA. In a srtA mutant, the partial deletion of the SrtC2 lid reduces surface anchoring of FimP polymers, and the lid-swapping mutation enhances this process, while both mutations diminish surface anchoring of FimA pili. Evidently, the extended lid of SrtC2 enables the enzyme the cell wall-anchoring activity in a substrate-selective fashion.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2024

How Beneficial Is Pretraining on a Narrow Domain-Specific Corpus for Information Extraction about Photocatalytic Water Splitting?

Language models trained on domain-specific corpora have been employed to increase the performance in specialized tasks. However, little previous work has been reported on how specific a “domain-specific” corpus should be. Here, we test a number of language models trained on varyingly specific corpora by employing them in the task of extracting information from photocatalytic water splitting. We find that more specific corpora can benefit performance on downstream tasks. Furthermore, PhotocatalysisBERT, a pretrained model from scratch on scientific papers on photocatalytic water splitting, demonstrates improved performance over previous work in associating the correct photocatalyst with the correct photocatalytic activity during information extraction, achieving a precision of 60.8(+11.5)% and a recall of 37.2(+4.5)%.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2020

Engineering sensitivity and specificity of AraC-based biosensors responsive to triacetic acid lactone and orsellinic acid

Abstract We previously described the design of triacetic acid lactone (TAL) biosensor ‘AraC-TAL1’, based on the AraC regulatory protein. Although useful as a tool to screen for enhanced TAL biosynthesis, this variant shows elevated background (leaky) expression, poor sensitivity and relaxed inducer specificity, including responsiveness to orsellinic acid (OA). More sensitive biosensors specific to either TAL or OA can aid in the study and engineering of polyketide synthases that produce these and similar compounds. In this work, we employed a TetA-based dual-selection to isolate new TAL-responsive AraC variants showing reduced background expression and improved TAL sensitivity. To improve TAL specificity, OA was included as a ‘decoy’ ligand during negative selection, resulting in the isolation of a TAL biosensor that is inhibited by OA. Finally, to engineer OA-specific AraC variants, the iterative protein redesign and optimization computational framework was employed, followed by 2 rounds of directed evolution, resulting in a biosensor with 24-fold improved OA/TAL specificity, relative to AraC-TAL1.

Wang, Zhiqing↗
DOE OSTI2023

The Challenges and Solutions of Meeting the Assembly Specifications for the 4.5 m Long MQXFA Magnets for the Hi-Luminosity LHC

The U.S. High-Luminosity LHC Accelerator Upgrade Project (HL-LHC AUP) has, in the recent years, developed assembly specifications for the 4.5 m long MQXFA magnets, which are 150 mm aperture high-field Nb 3 Sn low-β quadrupole magnets that are being built for the CERN Hi-Luminosity LHC (HL-LHC) upgrade. While the specifications were based on lessons learned from the LHC Accelerator Research Program (LARP) effort and the MQXFS and MQXFA prototype magnets, the experience gained from having both MQXFA07 and MQXFA08 magnets not meeting performance specifications during cold testing actually catalyzed a better understanding of the impact of the target assembly specifications and a subsequent refinement of the same. This paper summarizes a body of assembly data from the Pre-Series (MQXFA03-MQXFA07) and Series magnets (MQXFA08-MQXFA11) that have been built to date, and discusses the processes employed to successfully face the challenge of ensuring that the assembly specifications are met for the duration of the project.

43 PARTICLE ACCELERATORS↗
DOE OSTI2025

The three cellulose synthase isoforms for secondary cell wall make specific contributions to microfibril synthesis

Cellulose is synthesized at the plasma membrane by the cellulose synthase complex, a structure that contains three distinct isoforms of the catalytic subunit, cellulose synthase A (CESA). The division into three subunits appears early in land plant evolution and is highly conserved, particularly for the secondary cell wall. However, what if any unique roles each isoform plays in the complex remain unclear. Here, we assessed the contributions of specific isoforms to microfibril synthesis. First, we expressed CESA isoforms of the primary cell wall or the moss Physcomitrium patens in Arabidopsis thaliana backgrounds missing a secondary cell wall CESA. While the primary cell wall isoforms rescued the cesa knockout phenotype with partial isoform specificity, those from the moss rescued with fewer restrictions. Then, we recreated various CESA missense mutations in all three of the secondary cell wall isoforms; while results are consistent with isoform specificity, they are difficult to interpret further without molecular structures. Finally, we show that catalytically inactive CESA isoforms restore growth and cellulose content in the corresponding knockout in an isoform-specific manner; along with partial rescue of the growth and cellulose content of the inflorescence stem, the replacement lines have fiber cells with partially disorganized microfibrils and secondary cell wall cellulose with narrow crystal width. Generally, effects were more pronounced in lines where CESA8 was inactivated compared with inactivating CESA4 or 7, which tended to have similar phenotypes to each other. Here, we account for these results with a model for cellulose synthase structure with the isoforms assigned specific localization within the cellulose synthase complex.

59 BASIC BIOLOGICAL SCIENCES↗