Search NASA⌕ Search

SEARCH · Search NASA

Results for “sequence analysis”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 757 records · Page 42
All sourcesNASA NTRSDOE OSTI
NASA NTRS2014

Rapid Polymer Sequencer

Solid-state nanopore-based analysis of nucleic acid polymers is revolutionary. No other technique can determine information content in single molecules of genetic material at the speed of 1 subunit per microsecond. Because individual molecules are counted, the output is intrinsically quantitative. The nanopore approach is more generalized than any other method and in principle may be used to analyze any polymer molecule, including proteins. The approach to the development of a solid-state nanopore device is novel in the use of nanofabrication, nanoelectronic components, and high-speed signal acquisition. A novel geometry of the solid-state nanopore (less than 5 nm in length and 5 nm in diameter) will enable 1 to 5 nucleotide resolution measurements. This means that maximum resolution will be improved at least 100-fold compared to biological ion-channel measurements. The solid-state nanopore sensor will be made to enable sequencing DNA at a much faster rate than presently possible without the need for extensive sample preparation procedures, such as enzymatic amplification and labeling reactions. It will analyze electronic properties of individual subunits of DNA or RNA, to obtain linear composition of each genetic polymer molecule.

technology opportunity↗
DOE OSTI2017

Diversity and Structure of Diazotrophic Communities in Mangrove Rhizosphere, Revealed by High-Throughput Sequencing

Diazotrophic communities make an essential contribution to the productivity through providing new nitrogen. However, knowledge of the roles that both mangrove tree species and geochemical parameters play in shaping mangove rhizosphere diazotrophic communities is still elusive. Here, a comprehensive examination of the diversity and structure of microbial communities in the rhizospheres of three mangrove species, Rhizophora apiculata , Avicennia marina , and Ceriops tagal , was undertaken using high-throughput sequencing of the 16S rRNA and nifH genes. Our results revealed a great diversity of both the total microbial composition and the diazotrophic composition specifically in the mangrove rhizosphere. Deltaproteobacteria and Gammaproteobacteria were both ubiquitous and dominant, comprising an average of 45.87 and 86.66% of total microbial and diazotrophic communities, respectively. Sulfate-reducing bacteria belonging to the Desulfobacteraceae and Desulfovibrionaceae were the dominant diazotrophs. Community statistical analyses suggested that both mangrove tree species and additional environmental variables played important roles in shaping total microbial and potential diazotroph communities in mangrove rhizospheres. In contrast to the total microbial community investigated by analysis of 16S rRNA gene sequences, most of the dominant diazotrophic groups identified by nifH gene sequences were significantly different among mangrove species. The dominant diazotrophs of the family Desulfobacteraceae were positively correlated with total phosphorus, but negatively correlated with the nitrogen to phosphorus ratio. Finally, the Pseudomonadaceae were positively correlated with the concentration of available potassium, suggesting that diazotrophs potentially play an important role in biogeochemical cycles, such as those of nitrogen, phosphorus, sulfur, and potassium, in the mangrove ecosystem.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Standardized phylogenetic and molecular evolutionary analysis applied to species across the microbial tree of life

There is growing interest in reconstructing phylogenies from the copious amounts of genome sequencing projects that target related viral, bacterial or eukaryotic organisms. To facilitate the construction of standardized and robust phylogenies for disparate types of projects, we have developed a complete bioinformatic workflow, with a web-based component to perform phylogenetic and molecular evolutionary (PhaME) analysis from sequencing reads, draft assemblies or completed genomes of closely related organisms. Furthermore, the ability to incorporate raw data, including some metagenomic samples containing a target organism (e.g. from clinical samples with suspected infectious agents), shows promise for the rapid phylogenetic characterization of organisms within complex samples without the need for prior assembly.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Prevalence of gp160 polymorphisms known to be related to decreased susceptibility to temsavir in different subtypes of HIV-1 in the Los Alamos National Laboratory HIV Sequence Database

Fostemsavir, a prodrug of the gp120-directed attachment inhibitor temsavir, is indicated for use in heavily treatment-experienced individuals with MDR HIV-1. Reduced susceptibility to temsavir in the clinic maps to discrete changes at amino acid positions in gp160: S375, M426, M434 and M475.To query the Los Alamos National Laboratory (LANL) HIV Sequence Database for the prevalence of polymorphisms at gp160 positions of interest. Full-length gp160 sequences (N = 7560) were queried for amino acid polymorphisms relative to the subtype B consensus at positions of interest; frequencies were reported for all sequences and among subtypes/circulating recombinant forms (CRFs) with ≥10 isolates in the database. Among 239 subtypes in the database, the 5 most prevalent were B (n = 2651, 35.1%), C (n = 1626, 21.5%), CRF01_AE (n = 674, 8.9%), A1 (n = 273, 3.6%) and CRF02_AG (n = 199, 2.6%). Among all 7560 sequences, the most prevalent amino acids at positions of interest (S 375 , 73.5%; M 426 , 82.1%; M 434 , 88.2%; M 475 , 89.9%) were the same as the subtype B consensus. Specific polymorphisms with the potential to decrease temsavir susceptibility (S 375 H/I/M/N/T/Y, M 426 L/P, M 434 I/K and M475I) were found in <10% of isolates of subtypes D, G, A6, BC, F1, CRF07_BC, CRF08_BC, 02A, CRF06_cpx, F2, 02G and 02B. S 375 H and M 475 I were predominant among CRF01_AE (S375H, 99.3%; M 475 I, 76.3%; consistent with previously reported low temsavir susceptibility of this CRF) and 01B (S 375 H, 71.7%; M 475 I, 49.5%). Analysis of the LANL HIV Sequence Database found a low prevalence of gp160 amino acid polymorphisms with the potential to reduce temsavir susceptibility overall and among most of the common subtypes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Machine-Learning-Based Analysis of the Guy-Greenbrier, Arkansas Earthquakes: A Tale of Two Sequences

Here, we revisited the June 2010 to October 2011 Guy-Greenbrier earthquake sequence in central Arkansas using PhaseNet, a deep neural network trained to pick P and S arrival times. We applied PhaseNet to continuous waveform data and used phase association and hypocenter relocation to locate nearly 90,000 events. Our catalog suggests that the sequence consists of two adjacent earthquake sequences on the same fault and that the second sequence may be associated with the wastewater disposal well to the west of the Guy-Greenbrier Fault, rather than the wells to the north and the east that were previously implicated. We find that each sequence is composed of many small clusters that exhibit diffusion along the fault at shorter timescales. Our study demonstrates that machine-learning-based earthquake catalog development is now feasible and will yield new insights into earthquake behavior.

58 GEOSCIENCES↗
DOE OSTI2023

SSGUI v1.0

SSGUI is a web-based application that integrates the integrative genomics browser (IGV) with upstream alignment pipelines enabling rapid analysis of a batch of next-generation sequencing (NGS) samples. The input to SSGUI is an NGS file system directory that is organized by experiment and reference sequence. The output is an online dashboard containing various sequencing statistics for each sample and an integrated IGV plugin enabling rapid analysis of aligned NGS reads.

Kulawik, Mark↗
NASA NTRS1986

Functional and evolutionary relationships between bacteriorhodopsin and halorhodopsin in the archaebacterium, halobacterium halobium

The archaebacteria occupy a unique place in phylogenetic trees constructed from analyses of sequences from key informational macromolecules, and their study continues to yield interesting ideas on the early evolution and divergence of biological forms. It is now known that the halobacteria among these species contain various retinal-proteins, resembling eukaryotic rhodopsins, but with different functions. Two of these pigments, located in the cytoplasmic membranes of the bacteria, are bacteriorhodopsin (a light-driven proton pump) and halorhodopsin (a light-driven chloride pump). Comparison of these systems is expected to reveal structure/function relationships in these simple (primitive?) energy transducing membrane components and evolutionary relationships which had produced the structural features which allow the divergent functions. Findings indicate that very different primary structures are needed for these proteins to accomplish their different functions. Indeed, analysis of partial amino acid sequences from halo-opsin shows already that few if any long segments exist which are homologous to bacterio-opsin. Either these proteins diverged a very long time ago to allow for the observed differences, or the evolutionary clock in the halobacteria runs faster than usual.

Lanyi, J. K.↗
NASA NTRS2012

The Role of (Delta)C-13 in the Search for Reduced Organics on the Surface of Mars

The capabilities of the Sample Analysis at Mars (SAM) instrument suite on the Mars Science Laboratory (MSL) to detect trace amounts of organic carbon compounds are unprecedented, and MSL may be the first mission to reveal the presence of organic carbon on Mars. The search for reduced organic carbon on Mars is inextricably tied to: a) the preservation potential of the environment from which we take a solid sample, and b) the evolved gas analysis (EGA) techniques used by SAM to release volatiles from this solid sample. Several prospective targets have been identified for sample analysis at Gale Crater. Stratigraphic sequences of phyllosilicates and sulfates at Gale are thought to represent a period of global climate transition from a moderate pH lacustrine environment to an evaporitic environment, both of which could sequester organic carbon (Thomson et al. 2011). The sediment mound in Gale Crater contains a range of lithologies suggesting changes in redox conditions, and evidence of both lacustrine and fluvial depositional processes, which may have transported organic carbon from the layer in which it formed and resulted in its preservation elsewhere within the crater (Anderson and Bell, 2010). Inverted channel fills suggest erosion resistant material that could serve to preserve organics originally deposited in a low energy aqueous environment. The lithology sampled will affect not only the preservation of organics, but also our ability to detect organics during our evolved gas analysis, based on the sample matrix. For example, reduced organics may be trapped in the mineral structure, and thermal evolution of these organics will occur during thermal decomposition of the host mineral. If organics are occluded in minerals that have very high thermal decomposition temperatures, they may be, in effect, "too well preserved," and difficult to detect during EGA. Alternatively, the possible presence of perchlorate, or other strong oxidants in surface regolith, may result in destruction of structural information identifying organic molecules before reaching the QMS on SAM via oxidation to C02 during heating. If this is the case, the stable carbon isotopic composition (delta 13C) of the C02 evolved and measured by the Tunable Laser Spectrometer (TLS) on SAM may help identify the presence of organics. On Earth, biological activity can cause large fractionations of 13C/12C, which can preserved in sedimentary deposits and distinguish the organic products of biotic processes from inorganic atmospheric and geological reservoirs. It is plausible that similar fractionations could occur on Mars and be preserved in reduced organic matter in sediments. Bulk delta 13C measurements alone may not reveal a signature of trace organic carbon that may be present along with inorganic carbon. If both organic and inorganic carbon compounds are present, it may be possible to detect the organic carbon by comparing the 013C of pyrolysis and combustion experiments. The TLS on SAM is capable of obtaining high precision measurements of delta13C from C02 evolved during pyrolysis and combustion of solid regolith samples. Because carbonates are expected to be present at abundances of 0.1-1 % in Martian soil, and organics in the ppb range (Webster and Mahaffy, 2011), analog samples must represent this mix of reduced organic carbon and carbonate. The work presented here will examine the use of delta13C of C02 produced during combustion of bulk Mars analog samples as a proxy for detection of reduced organic carbon.

Stern, J. C.↗
NASA NTRS2010

Model for Simulating a Spiral Software-Development Process

A discrete-event simulation model, and a computer program that implements the model, have been developed as means of analyzing a spiral software-development process. This model can be tailored to specific development environments for use by software project managers in making quantitative cases for deciding among different software-development processes, courses of action, and cost estimates. A spiral process can be contrasted with a waterfall process, which is a traditional process that consists of a sequence of activities that include analysis of requirements, design, coding, testing, and support. A spiral process is an iterative process that can be regarded as a repeating modified waterfall process. Each iteration includes assessment of risk, analysis of requirements, design, coding, testing, delivery, and evaluation. A key difference between a spiral and a waterfall process is that a spiral process can accommodate changes in requirements at each iteration, whereas in a waterfall process, requirements are considered to be fixed from the beginning and, therefore, a waterfall process is not flexible enough for some projects, especially those in which requirements are not known at the beginning or may change during development. For a given project, a spiral process may cost more and take more time than does a waterfall process, but may better satisfy a customer's expectations and needs. Models for simulating various waterfall processes have been developed previously, but until now, there have been no models for simulating spiral processes. The present spiral-process-simulating model and the software that implements it were developed by extending a discrete-event simulation process model of the IEEE 12207 Software Development Process, which was built using commercially available software known as the Process Analysis Tradeoff Tool (PATT). Typical inputs to PATT models include industry-average values of product size (expressed as number of lines of code), productivity (number of lines of code per hour), and number of defects per source line of code. The user provides the number of resources, the overall percent of effort that should be allocated to each process step, and the number of desired staff members for each step. The output of PATT includes the size of the product, a measure of effort, a measure of rework effort, the duration of the entire process, and the numbers of injected, detected, and corrected defects as well as a number of other interesting features. In the development of the present model, steps were added to the IEEE 12207 waterfall process, and this model and its implementing software were made to run repeatedly through the sequence of steps, each repetition representing an iteration in a spiral process. Because the IEEE 12207 model is founded on a waterfall paradigm, it enables direct comparison of spiral and waterfall processes. The model can be used throughout a software-development project to analyze the project as more information becomes available. For instance, data from early iterations can be used as inputs to the model, and the model can be used to estimate the time and cost of carrying the project to completion.

Mizell, Carolyn↗
DOE OSTI2025

Microreactor Assembly Transportation Cask Model Description for Criticality Safety Validation Basis Assessment

Criticality safety analyses are completed on a transportation cask used for microreactor assembly shipment to provide an example of model and analysis to industry for reproducing this type of study on their microreactor fuel shipment. The fuel assembly considered is based on a gas-cooled microreactor (GC-MR), which utilizes HALEU fuel in the form of TRISO particles and utilizes various design options considered in industry designs. Various versions of this GC-MR assembly were studied, with and without YH2 moderator, providing similar conclusions. The shipment cask design is revised based on an existing design ES-3100, developed by Y-12 for the transport of highly enriched uranium (HEU), but is enlarged to hold the GC-MR fuel assembly. Criticality safety analysis for the cask/GC-MR fuel assembly package was performed using the CSAS6 sequence of SCALE6.3.2, utilizing the ENDF/B-VII.1 based continuous energy neutron library, and the analysis strictly follows the guideline from NRC reference reports. Different scenarios, e.g. normal operation, undamaged cask with water flooded, damaged cask with optimal water moderation, have been analyzed and it could be concluded the package would always have a large margin of subcriticality even packed in an infinite array. Sensitivity and similarity analyses are also performed using the TSUNAMI sequence of SCALE6.3.2, and the similarity analysis uses all the experiments from the ICSBEP Handbook with Intermediate and Mixed Enriched Uranium (IEU) and Low Enriched Uranium (LEU) systems together with additional ones that are sponsored by the DNCSH program. These similarity analyses indicate that dry cases have no similar benchmark experiments (ck values greater than 0.8), which may become problematic if more assemblies are shipped together (or a fully loaded core is shipped) and margin to criticality is reduced. However, the damaged cask models with flooded assemblies exhibited similarities to many experiments with ck values greater than 0.8.

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗
DOE OSTI2026

Microreactor Assembly Transportation Cask Model Description for Criticality Safety Validation Basis Assessment (Rev. 3)

Criticality safety analyses are completed on a transportation cask used for microreactor assembly shipment to provide an example of model and analysis to industry for reproducing this type of study on their microreactor fuel shipment. The fuel assembly considered is based on a gas-cooled microreactor (GC-MR), which utilizes HALEU fuel in the form of TRISO particles and utilizes various design options considered in industry designs. Various versions of this GC-MR assembly were studied, with and without YH 2 moderator, providing similar conclusions. The shipment cask design is revised based on an existing ES-3100 design, developed by Y-12 for the transport of highly enriched uranium (HEU), but is enlarged to hold the GC-MR fuel assembly. Criticality safety analysis for the cask/GC-MR fuel assembly package was performed using the CSAS6 sequence of SCALE6.3.2, utilizing the ENDF/B-VII.1 based continuous energy neutron library, and the analysis strictly follows the guideline from NRC reference reports. Different scenarios, e.g. normal operation, undamaged cask with water flooded, damaged cask with optimal water moderation, have been analyzed and it could be concluded the package would always have a large margin of subcriticality even packed in an infinite array. Sensitivity and similarity analyses are also performed using the TSUNAMI sequence of SCALE6.3.2, and the similarity analysis uses all the experiments from the ICSBEP Handbook with Highly Enriched Uranium (HEU), Intermediate and Mixed Enriched Uranium (IEU) and Low Enriched Uranium (LEU) systems, together with additional ones that are sponsored by the DNCSH program, and selected IRPhEP experiments using TRISO fuel and graphite moderator. These similarity analyses indicate that the dry nominal design has no similar benchmark experiments (ck values greater than 0.8), which may become problematic if more assemblies are shipped together (or a fully loaded core is shipped) and margin to criticality is reduced. However, the cask models with flooded assemblies exhibited similarities to many experiments with c k values greater than 0.8.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
NASA NTRS2012

TraceContract

TraceContract is an API (Application Programming Interface) for trace analysis. A trace is a sequence of events, and can, for example, be generated by a running program, instrumented appropriately to generate events. An event can be any data object. An example of a trace is a log file containing events that a programmer has found important to record during a program execution. Trace - Contract takes as input such a trace together with a specification formulated using the API and reports on any violations of the specification, potentially calling code (reactions) to be executed when violations are detected. The software is developed as an internal DSL (Domain Specific Language) in the Scala programming language. Scala is a relatively new programming language that is specifically convenient for defining such internal DSLs due to a number of language characteristics. This includes Scala s elegant combination of object-oriented and functional programming, a succinct notation, and an advanced type system. The DSL offers a combination of data-parameterized state machines and temporal logic, which is novel. As an extension of Scala, it is a very expressive and convenient log file analysis framework.

Kavelund, Klaus↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Transfer of beef bacterial communities onto food-contact surfaces

Introduction Food spoilage and pathogenic bacteria on food-contact surfaces, especially biofilm-forming strains, can transfer to meats during processing. The objectives of this study were to survey the bacterial communities of beef cuts that transfer onto two commonly used food-contact surfaces, stainless steel (SS) and high-density polyethylene (HDPE) and identify potentially biofilm-forming strains. Methods Top round, flank, chuck, and ground beef were purchased from 3 retail stores. SS and HDPE coupons (approximately 2cm × 5cm) were placed on beef portions (3h, 10°C), after which, the coupons were submerged halfway in PBS (24h, 10°C). Bacteria from the beef cuts and coupon surfaces ( n = 3) were collected, plated on tryptic soy agar plates and incubated (5 days, 25°C). Bacterial isolates were identified by 16S rRNA gene amplicon sequencing and assayed for biofilm formation using a crystal violet binding (CV) assay (72h, 10°C). Additionally, beef and coupon samples were collected for bacterial community analysis by 16S rRNA gene amplicon sequencing. Results and discussion Sixty-one of 972 beef isolates, 29 of 204 HDPE isolates, and 30 of 211 SS isolates were strong biofilm-formers (Absorbance>1.000 at 590 nm in the CV assay). Strong-binding isolates identified were of the genera Pseudomonas , Acinetobacter , Psychrobacter , Carnobacterium , and Brochothrix . Coupon bacterial communities among stores and cuts were distinct ( p < 0.001, PERMANOVA), but there was no distinction between the communities found on HDPE or SS coupons ( p > 0.050, PERMANOVA). The bacterial communities identified on the coupons may help determine the communities capable of transferring and colonizing onto surfaces, which can subsequently cross-contaminate foods.

Guron, Giselle K. P.↗
DOE OSTI2025

The role of soil chemical properties and microbial communities on Dendrocalamus brandisii bamboo shoot quality, Yunnan Province, China

Objective To explore the effects of soil nutrients and microbial communities on the quality of Dendrocalamus brandisii shoots in different regions, providing a scientific basis for their development and utilization. Methods Using seven different geographic sources of D. brandisii from Yunnan Province as research subjects, this study employs chemical analysis and high-throughput sequencing to reveal the relationship between soil nutrients, microbial functional groups, and the nutritional quality of bamboo shoots. Results The results indicate that there are significant differences in soil nutrient content among the regions ( p < 0.05), with bamboo shoots from Baoshan Changning (CN) exhibiting the best overall nutritional quality. The key factors influencing bacterial community changes include pH, available phosphorus (AP), and available potassium (AK). In contrast, the main factors affecting fungal community changes are pH, soil organic matter (SOM), available potassium (AK), and total nitrogen (TN). This version maintains clarity and logical flow, making it easier for readers to understand the different factors influencing bacterial and fungal community changes. The diversity indices of soil microbial communities among different sources of Dendrocalamus brandisii show significant differences ( p < 0.05). The dominant groups in the seven regions include Proteobacteria, Acidobacteriota, Actinobacteriota, Chloroflexi, Ascomycota, and Basidiomycota. The soil microbial community in Baoshan Changning (CN) shows significant structural differences compared to the other six regions, with the highest relative abundances of Chloroflexi and Acidobacteriota. In contrast, the highest relative abundance of Proteobacteria is found in Honghe Shiping (SP), while Actinobacteriota has the highest relative abundance in Yuxi Xinping (XP). RDA analysis indicates that soil nutrients (SOM, pH, AP, TN) affect the water content, soluble sugar, and crude fat of bamboo shoots. Additionally, the bacterial communities including Actinobacteriota, Chloroflexi, Patescibacteria, GAL15, and Cyanobacteria influence the water content, soluble sugar, ash content, protein, and lignin of bamboo shoots. Discussion In the fungal community, Basidiomycota, Kickxellomycota, Mucoromycota, unclassified-k-Fungi, and Glomeromycota affect the water content and tannin levels in bamboo shoots. In summary, soil nutrients and soil microorganisms are interconnected and work together to influence the quality of bamboo shoots.

Chen, Qian↗
DOE OSTI2024

High throughput, accurate gene annotation through AI and HPC-enabled structural analysis

With the advances in next generation sequencing technologies, the number of sequenced genomes is growing exponentially, resulting in a technology bottleneck for the translation of sequence information into usable hypotheses about the function of each gene. We have proposed leveraging our leadership high-performance computing (HPC) resources to help break this annotation bottleneck. Here we design an HPC-based framework to infer gene function from gene sequence by incorporating information about protein structure and interactions predicted by deep learning approaches. Accurate functional prediction and gene annotation using computational methods will facilitate breakthroughs in the genomic sciences essential to understanding and harnessing life processes in bacteria, fungi and plants. The development and applications of the state-of-the-art deep neural networks to protein structural modeling, interaction prediction, sequence comparison, and quality assessment of protein structural models will be made possible by leadership computational resources. These HPC-enabled bioinformatics and molecular modeling tools will provide powerful insights into molecular functions of genes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Delayed access to feed early post-hatch affects the development and maturation of gastrointestinal tract microbiota in broiler chickens

Background: The first two weeks of post-hatch (PH) growth in broilers (meat-type birds) are critical for gut development and microbiota colonization. In the current broiler production system, chicks may not receive feed and water for 24 to 72 h due to variations in hatching time and hatchery management. Post-hatch feed delay affects body weight, feed efficiency, mortality, and gut development. The goal of this study was to investigate changes in the microbiome in broiler chickens early PH and the effect of delayed access to feed on the microbiota. Results: Chicks either received feed and water immediately after hatch or access to feed was delayed for 48 h to mimic commercial hatchery settings (treatment, TRT). Both groups were sampled (n = 6) at -48, 0, 4 h, and 1 (24 h), 2 (48 h), 3 (72 h), 4 (96 h), 6 (144 h), 8 (192 h), 10 (240 h), 12 (288 h) and 14 (336 h) days PH. Ileal (IL) and cecal (CE) epithelial scrapings (mucosal bacteria, M) and digesta (luminal bacteria, L) were collected for microbiota analysis. Microbiota was determined by sequencing the V3-V4 region of bacterial 16S rRNA and analyzed using QIIME2. The microbiota of early ileal and cecal samples were characterized by high abundance of unclassified bacteria. Among four bacterial populations (IL-L, IL-M, CE-L, CE-M), IL-M was the least affected by delayed access to feed early PH. Both alpha and beta diversities were affected by delayed access to feed PH in IL-L, CE-M and CE-L. However, the development effect was more pronounced. In all four bacterial populations, significant changes due to developmental effect (time relative to hatch) was observed in taxonomic composition, with transient changes of bacterial taxa during the first two weeks PH. Delayed access to feed has limited influence on bacterial composition with only a few genera and species affected in all four bacterial populations. Predicted function based on 16S rRNA was also affected by delayed access to feed PH with most changes in metabolic pathway richness observed in IL-L, CE-L and CE-M. Conclusions: These results show transient changes in chicken microbiota biodiversity during the first two weeks PH and indicate that delayed access to feed affects microbiota development. Proper microbiota development could be an important factor in disease prevention and antibiotic use in broiler chickens. Moreover, significant differences in response to delayed access to feed PH between luminal and mucosal bacterial populations strongly suggests the need for separate analysis of these two populations.

16S↗