Search NASA⌕ Search

SEARCH · Search NASA

Results for “Green”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 91 records · Page 5
All sourcesNASA NTRSDOE OSTI
DOE OSTI2020

A 3D simulation comparison of carrier transport in green and blue c-plane multi-quantum well nitride light emitting diodes

Until recently, the electrical efficiency of green nitride light-emitting diodes (LEDs) was considerably lower than that of blue LEDs. This is particularly surprising as one would expect a reduced forward voltage with increasing emission wavelength. In this paper, we theoretically investigated the impact of the number of quantum wells on the forward voltage of III-nitride LEDs with x = 0.15 (blue) and x = 0.24 (green) In x Ga1–xN QWs. The simulated dependence of current density (J) on applied diode bias (V) shows a significant increase of 1.9 V in the forward voltage between one and five quantum well (QW) c-plane green LED structures. Artificially turning off the polarization fields in the simulation does not entirely suppress this effect. Due to the large band offsets in the green LED multiple QW stack, simulations indicate a sequential band filling of the QW sequence. Furthermore, this mechanism should not be limited to c-plane LEDs and could also be present in nonpolar or semipolar devices.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2020

Time reversal symmetry breaking and odd viscosity in active fluids: Green–Kubo and NEMD results

Active fluids, which are driven at the microscale by non-conservative forces, are known to exhibit novel transport phenomena due to the breaking of time reversal symmetry. Recently, Epstein and Mandadapu [arXiv:1907.10041 (2019)] obtained Green-Kubo relations for the full set of viscous coefficients governing isotropic chiral active fluids, including the so-called odd viscosity, invoking Onsager's regression hypothesis for the decay of fluctuations in active non-equilibrium steady states. In this Communication, we test these Green-Kubo relations using molecular dynamics simulations of a canonical model system consisting of actively torqued dumbbells. We find the resulting odd and shear viscosity values from the Green-Kubo relations to be in good agreement with values measured independently through non-equilibrium molecular dynamics flow simulations. This provides a test of the Green-Kubo relations and lends support to the application of the Onsager regression hypothesis in relation to viscous behaviors of active matter systems.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2023

Climate change increases carbon allocation to leaves in early leaf green-up

Global greening, characterized by an increase in leaf area index (LAI), implies an increase in foliar carbon (C). Whether this increase in foliar C under climate change is due to higher photosynthesis or to higher allocation of C to leaves remains unknown. Here, we explored the trends in foliar C accumulation and allocation during leaf green-up from 2000 to 2017 using satellite-derived LAI and solar-induced chlorophyll fluorescence (SIF) across the Northern Hemisphere. The accumulation of foliar C accelerated in the early green-up period due to both increased photosynthesis and higher foliar C allocation driven by climate change. In the late stage of green-up, however, we detected decreasing trends in foliar C accumulation and foliar C allocation. Such stage-dependent trends in the accumulation and allocation of foliar C are not represented in current terrestrial biosphere models. Further, our results highlight that a better representation of C allocation should be incorporated into models.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2020

Biophysical impacts of Earth greening largely controlled by aerodynamic resistance

Satellite observations show widespread increasing trends of leaf area index (LAI), known as the Earth greening. However, the biophysical impacts of this greening on land surface temperature (LST) remain unclear. Here, we quantify the biophysical impacts of Earth greening on LST from 2000 to 2014 and disentangle the contributions of different factors using a physically based attribution model. We find that 93% of the global vegetated area shows negative sensitivity of LST to LAI increase at the annual scale, especially for semiarid woody vegetation. Further considering the LAI trends (P ≤ 0.1), 30% of the global vegetated area is cooled by these trends and 5% is warmed. Aerodynamic resistance is the dominant factor in controlling Earth greening’s biophysical impacts: The increase in LAI produces a decrease in aerodynamic resistance, thereby favoring increased turbulent heat transfer between the land and the atmosphere, especially latent heat flux.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2021

My Green LANL [Slides]

The My Green LANL initiative was created to unify LANL employees in all research and work environments to reflect the highest standard of social and environmental responsibility. In combination with the My Green Lab non-profit organization and internal LANL efforts, the My Green LANL mission is to educate and emphasize the importance of practicing sustainable or ‘green’ efforts in both laboratory and office spaces.

32 ENERGY CONSERVATION, CONSUMPTION, AND UTILIZATI↗
DOE OSTI2023

Demonstration of multi-active region p-down green LEDs with high quantum efficiency

Abstract Longer wavelength emitters such as green LEDs display a pronounced efficiency drop at higher current densities, resulting in relatively low wall-plug efficiency (WPE). Multi-active region approach can improve the WPE significantly and tackle the “green gap” challenge. This work reports multi-active region p-down LEDs with high external efficiency operating entirely in the green wavelength. Devices were developed using p-down topology, where the PN junction is oriented such that electric fields from depletion and built-in polarization dipoles are aligned. Ga-polar multi-active region green LEDs with excellent voltage and external quantum efficiency scaling, and significantly higher WPE is demonstrated in this work.

Physics↗
DOE OSTI2024

A Green's Function Wind Turbine Induction Model That Incorporates Complex Inflow Conditions

ABSTRACT In this work, we develop a new analytical turbine induction model that can incorporate complex inflow conditions including cases where the wind velocity and temperature profiles can vary as functions of height. This induction model is derived from the linearized Navier–Stokes and leads to a second‐order ODE that can be solved using a Green's function formulation. The corresponding Green's function for several configurations are found including the infinite domain, semi‐infinite domain with ground plane, and a power law velocity inflow profile. The results of this approach are then compared with simulations of the turbine induction field using the AMR‐Wind CFD solver with a uniformly loaded actuator disk model. These comparisons show that the Green's function approach captures the centerline blockage, three‐dimensional blockage flow field, and streamwise velocity slow down, with very good agreement for lower thrust conditions and at larger distances away from rotor disk. The effects of shear on the turbine blockage were also compared using a power law inflow profile, and we show that this approach matches the CFD predictions for the cases considered.

17 WIND ENERGY↗
DOE OSTI2023

Green-Solvent Processed Blade-Coating Organic Solar Cells with an Efficiency Approaching 19% Enabled by Alkyl-Tailored Acceptors

Power-conversion-efficiencies (PCEs) of organic solar cells (OSCs) in laboratory, normally processed by spin-coating technology with toxic halogenated solvents, have reached over 19%. However, there is usually a marked PCE drop when the blade-coating and/or green-solvents toward large-scale printing are used instead, which hampers the practical development of OSCs. Here, a new series of N-alkyl-tailored small molecule acceptors named YR-SeNF with a same molecular main backbone are developed by combining selenium-fused central-core and naphthalene-fused end-group. Thanks to the N-alkyl engineering, NIR-absorbing YR-SeNF series show different crystallinity, packing patterns, and miscibility with polymeric donor. The studies exhibit that the molecular packing, crystallinity, and vertical distribution of active layer morphologies are well optimized by introducing newly designed guest acceptor associated with tailored N-alkyl chains, providing the improved charge transfer dynamics and stability for the PM6:L8-BO:YR-SeNF-based OSCs. As a result, a record-high PCE approaching 19% is achieved in the blade-coating OSCs fabricated from a green-solvent o-xylene with high-boiling point. Notably, ternary OSCs offer robust operating stability under maximum-power-point tracking and well-keep > 80% of the initial PCEs for even over 400 h. Our alkyl-tailored guest acceptor strategy provides a unique approach to develop green-solvent and blade-coating processed high-efficiency and operating stable OSCs, which paves a way for industrial development.

14 SOLAR ENERGY↗
DOE OSTI2025

A Green’s function fast multipole method for computation of micromechanical fields in heterogeneous materials

Computation of micromechanical fields in heterogeneous materials is usually performed using either the finite element method or the Green’s function method based on FFTs. The finite element method allows for accurate discretization and for non-periodic boundary conditions but is computationally expensive. On the other hand, the FFT-based method is computationally efficient but requires discretization on a regular grid of hexahedral voxels. In this paper, a Green’s function method allowing for accurate discretization using tetrahedral elements and for non-periodic boundary conditions is proposed. The convolution is computed using the fast multipole method, which provides good accuracy even for low-order expansion due to the fast decay of interactions between elements. The proposed Green’s function fast multipole method is verified by comparison with analytical and FFT-based solutions. Furthermore, the computational time is analyzed and compared to the FFT-based method for non-periodic convolution. Finally, effective properties of an elastic polycrystalline microstructure containing thin intergranular cracks are computed and analyzed.

36 MATERIALS SCIENCE↗
DOE OSTI2025

Screening green solvents for multilayer plastic film recycling processes

Multilayer (ML) plastic films are essential packaging materials that help protect products from diverse external factors; however, only 5% of all ML films are recycled in the United States. Solvent-based technologies are a promising alternative for recycling ML films because they enable recovery of constituent polymer resins. For example, the Solvent Targeted Recovery and Precipitation (STRAPTM) process sequentially dissolves and separates polymer components using a series of targeted solvent washes. A crucial design aspect of this process is the impact of selected solvents on human health and on the environment. Here, this work introduces a computational framework that integrates molecular modeling, process modeling, techno-economic analysis (TEA), and life-cycle analysis (LCA) to quickly screen green solvents for solvent-based ML recycling processes. Initial screening for solvents based on selectivity is performed by estimating temperature-dependent solubilities using molecular-scale models. Subsequent screening uses basic estimates of energy use and octanol-water partition coefficients (logP) as key measures of health, safety, and environmental hazards. Detailed process modeling, TEA, and LCA are used on a reduced set of promising solvents identified in early screening steps to more accurately determine how solvent selection and associated operating conditions impact overall economics and environmental impacts. The framework is used for the identification of green solvents (from a database of 1,000 solvents) that separate an industrial ML film composed of polyethylene (PE), ethylene vinyl alcohol (EVOH), and polyethylene terephthalate (PET). Our analysis shows the effectiveness of the framework and reveals fundamental trade-offs between solvent greenness, solubility, and economics. Our work emphasizes the importance of taking a holistic systems view during solvent design and aims to inform the development of new processes for ML film recycling and the identification of new ML films that are easier to recycle.

economics↗
DOE OSTI2024

Identifying Green Solvent Mixtures for Bioproduct Separation Using Bayesian Experimental Design

Liquid–liquid extraction (LLE) is a widely used technique for the separation and purification of liquid-phase products with applications in various industries, including pharmaceuticals, petrochemicals, and renewable chemistry. A critical step in the design of an LLE process is the selection of appropriate solvents. This study presents a new methodology for identifying solvent mixtures for bioproduct separation using Bayesian experimental design (BED). Motivated by the need for environmentally friendly and effective separation methods, we address the challenge of selecting solvent systems that balance separation efficiency, selectivity, and environmental impact while also tackling the difficulty of separating multiple bioproducts using complex solvent systems. Our approach specifically seeks to predict product partition coefficients (log10 Kp values) as thermodynamic parameters underlying solvent selection. The iterative approach integrates Bayesian optimization with experimental measurements to guide solvent selection and leverages COSMO-RS simulations to enhance high-throughput experimentation. Using the design of solvent systems for the separation of lignin-derived aromatic products via centrifugal partition chromatography (CPC) as a case study, we show that within seven iterations/cycles of the methodology, we can identify new mixtures of green solvents that align with CPC design principles. Furthermore, these results demonstrate the efficacy of the BED framework in optimizing green solvent systems for complex separations, highlighting the potential of this method to advance the field of green chemistry and contribute to the development of sustainable industrial processes.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2023

Versatile recognition of graphene layers from optical images under controlled illumination through green channel correlation method

In this study, a simple yet versatile method is proposed for identifying the number of exfoliated graphene layers transferred on an oxide substrate from optical images, utilizing a limited number of input images for training, paired with a more traditional number of a few thousand well-published Github images for testing and predicting. Two thresholding approaches, namely the standard deviation-based approach and the linear regression-based approach, were employed in this study. The method specifically leverages the red, green, and blue color channels of image pixels and creates a correlation between the green channel of the background and the green channel of the various layers of graphene. This method proves to be a feasible alternative to deep learning-based graphene recognition and traditional microscopic analysis. The proposed methodology performs well under conditions where the effect of surrounding light on the graphene-on-oxide sample is minimum and allows rapid identification of the various graphene layers. Here, the study additionally addresses the functionality of the proposed methodology with nonhomogeneous lighting conditions, showcasing successful prediction of graphene layers from images that are lower in quality compared to typically published in literature. In all, the proposed methodology opens up the possibility for the non-destructive identification of graphene layers from optical images by utilizing a new and versatile method that is quick, inexpensive, and works well with fewer images that are not necessarily of high quality.

36 MATERIALS SCIENCE↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Geranylgeranylated-chlorophyll-protein complexes in lhl3 mutant of the green alga Chlamydomonas reinhardtii

Chlorophylls a and b (Chl a and b) are involved in light harvesting, photochemical reactions, and electron transfer reactions in plants and green algae. The core complexes of the photosystems (PSI and PSII) associate with Chl a, while the peripheral antenna complexes (LHCI and LHCII) bind Chls a and b. One of the final steps of Chl biosynthesis is the conversion of geranylgeranylated Chls (Chls GG ) to phytylated Chls by geranylgeranyl reductase (GGR). Here, we isolated and characterized a pale green mutant of the green alga Chlamydomonas reinhardtii that was very photosensitive and was unable to grow photoautotrophically. This mutant has a 16-bp deletion in the LHL3 gene, which resulted in the loss of LHL3 and GGR and accumulated only Chls GG . The lhl3 mutant cells grown in the dark accumulated PSII and PSI proteins at 25–50% of WT levels, lacked PSII activity, and retained a decreased PSI activity. The PSII and PSI proteins were depleted to trace amounts in the mutant cells grown in light. In contrast, the accumulation of LHCI and LHCII was unaffected except for LHCA3. Our results suggest that the replacement of Chls with Chls GG strongly affects the structural and functional integrity of PSII and PSI complexes but their associating LHC complexes to a lesser extent. Affinity purification of HA-tagged LHL3 confirmed the formation of a stable LHL3-GGR complex, which is vital for GGR stability. The LHL3-GGR complex contained a small amount of PSI complex assembly factors, suggesting a putative coupling between Chl synthesis and PSI complex assembly.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

Multiscale Neural Networks for Approximating Green’s Functions

Neural networks (NNs) have been widely used to solve partial differential equations (PDEs) in the applications of physics, biology, and engineering. One effective approach for solving PDEs with a fixed differential operator is learning Green’s functions. However, Green’s functions are notoriously difficult to learn due to their poor regularity, which typically requires larger NNs and longer training times. In this work, we address these challenges by leveraging multiscale NNs to learn Green’s functions. Through theoretical analysis using multiscale Barron space methods and experimental validation, we show that the multiscale approach significantly reduces the necessary NN size and accelerates training.

97 MATHEMATICS AND COMPUTING↗
DOE OSTI2024

Silicate coprecipitation reduces green rust crystal size and limits dissolution-precipitation during air oxidation

Green rusts (GR) are mixed-valence iron (Fe) hydroxides which form in reducing redox environments like riparian and wetland soils and shallow groundwater. In these environments, silicon (Si) can influence Fe oxides’ chemical and physical properties but its role in GR formation and subsequent oxidative transformation have not been studied starting at initial nucleation. Green rust sulfate [GR(SO 4 )] and green rust carbonate [GR(CO 3 )] were both coprecipitated from salts by base titration in increasing % mol Si (0, 1, 10, and 50). The minerals were characterized before and after rapid (24 h) aqueous air-oxidation by x-ray diffraction (XRD), scanning electron microscopy (SEM), Fe extended x-ray absorption fine structure spectroscopy (EXAFS), and N 2 -BET surface area. Results showed that only GR(SO4) or GR(CO3) was formed at every tested Si concentration. Increasing % mol Si caused decreased plate size and increased surface area in GR(CO3) but not GR(SO4). GR plate basal thickness was not changed at any condition indicating a lack of Si interlayering. Air oxidation of GR(SO4) at all % mol Si contents transformed by dissolution and reprecipitation into lepidocrocite and goethite, favoring ferrihydrite with higher % Si content. Air oxidation of GR(CO3) transformed into magnetite and goethite but increasing Si caused GR to oxidize while retaining its hexagonal plate structure via solid-state oxidation. Our results indicate that Si has the potential to cause GR to form in smaller particles and upon air oxidation, Si can either stabilize the plate structure or alter transformation to ferrihydrite.

36 MATERIALS SCIENCE↗
DOE OSTI2023

Perspectives on future research directions in green manufacturing for discrete products

With the increasing concern due to climate change caused by a higher atmospheric concentration of CO 2 and other greenhouse gases, reducing environmental impact is becoming more important for every part of society. Manufacturing is responsible for a significant amount of energy/material consumption and environmental burden and, therefore, has a great opportunity to reduce its impact through green manufacturing. Green manufacturing presents opportunities across the manufacturing enterprise to increase the efficient usage of energy and material resources. These opportunities include designing products to consume fewer materials and energy during manufacturing and use, incorporating more efficient manufacturing processes, streamlining and optimizing manufacturing schedules and plans, and circularizing products. The goal of this paper will be to provide a perspective from the authors on the opportunities that exist within green manufacturing for discrete products through a review of pertinent topics and future directions. The paper will focus on processes, manufacturing equipment, manufacturing systems, recovering value at a product’s end-of-life, and additional thoughts that include metrics and indicators, techno-economic assessment, and a discussion of efficiency and effectiveness. Key findings from this review include a need for social indicators and renewable energy considerations in scheduling and process planning, integrating Industry 4.0 into circular economy along with social and institutional dimensions, consistency in the ability to measure and conceptualize metrics and indicators, a detailed evaluation of the life cycle impacts and cost of Addit Manuf, and more human and environment-oriented considerations for smart manufacturing.

29 ENERGY PLANNING, POLICY, AND ECONOMY↗
DOE OSTI2023

Status and Trends in the U.S. Voluntary Green Power Market (2021 Data)

Voluntary green power, for the purposes of this report, refers to renewable energy procurement by retail electricity customers above state renewable energy mandates. In this report, we present data and key trends for voluntary green power markets, except for a small portion of voluntary purchasing where no data are available. In 2021, about 8 million retail electricity customers procured about 244 million megawatt-hours (MWh) of voluntary green power (Figure ES-1), representing about 27% of all U.S. renewable energy sales, about 39% of non-hydro renewable energy sales, and about 6% of all U.S. retail electricity sales. Most of the remainder of U.S. renewable energy sales reflects renewable energy procured by load-serving entities to comply with state renewable energy mandates, also known as compliance-based procurement.

29 ENERGY PLANNING, POLICY, AND ECONOMY↗