Search NASA⌕ Search

SEARCH · Search NASA

Results for “transient gene expression”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 91 records · Page 5
All sourcesNASA NTRSDOE OSTI
NASA NTRS1997

Development of Plant Gene Vectors for Tissue-Specific Expression Using GFP as a Reporter Gene

Reporter genes are widely employed in plant molecular biology research to analyze gene expression and to identify promoters. Gus (UidA) is currently the most popular reporter gene but its detection requires a destructive assay. The use of jellyfish green fluorescent protein (GFP) gene from Aequorea Victoria holds promise for noninvasive detection of in vivo gene expression. To study how various plant promoters are expressed in sweet potato (Ipomoea batatas), we are transcriptionally fusing the intron-modified (mGFP) or synthetic (modified for codon-usage) GFP coding regions to these promoters: double cauliflower mosaic virus 35S (CaMV 35S) with AMV translational enhancer, ubiquitin7-intron-ubiquitin coding region (ubi7-intron-UQ) and sporaminA. A few of these vectors have been constructed and introduced into E. coli DH5a and Agrobacterium tumefaciens EHA105. Transient expression studies are underway using protoplast-electroporation and particle bombardment of leaf tissues.

Jackson, Jacquelyn↗
NASA NTRS2002

Coordinate late expression of trefoil peptide genes (pS2/TFF1 and ITF/TFF3) in human breast, colon, and gastric tumor cells exposed to X-rays

The trefoil factors (TFFs) are pleiotropic factors involved in organization and homeostasis of the gastrointestinal tract, estrogen responsiveness, inflammatory disorders, and carcinogenesis. In an earlier study using cDNA array technologies to identify new genes expressed in irradiated cell survivors, we isolated a cDNA clone corresponding to the reported human TFF1 gene (E. K. Balcer-Kubiczek et al., Int. J. Radiat. Biol., 75: 529-541, 1999). To determine whether expression of other TFFs is altered by ionizing radiation, we quantified changes in expression of TFF3 as well as TFF1 in RNA samples obtained from irradiated and control human tumor breast, colon, and gastric tumor cells and examined expression kinetics up to 2 weeks after irradiation. X-ray-induced TFF1 and TFF3 expression profiles were compared with those induced by hydrogen peroxide (H2O2) or 17beta-estradiol (ES). The results revealed that TFF1 and TFF3 mRNA are coinduced by X-irradiation in a subset of the lines, but substantial heterogeneity in their responses was observed in cells derived from a single cell type. TFF1 and TFF3 transcriptional response to X-irradiation differed from that to H2O2 or ES in the timing of their induction as well as tissue-type dependence, i.e., their induction pattern after X-irradiation was late and sustained, whereas their induction by H2O2 or ES was early and transient. TFF1 mRNA, protein production in the cytoplasm, and secretion in the culture supernatant were coordinately regulated after X-irradiation. There was no requirement for TP53 in this induction. These results demonstrate the existence of a novel class of radiation-responsive genes that might be involved in bystander effects.

Non-NASA Center↗
NASA NTRS2000

Time- and dose-related interactions between glucocorticoid and cyclic adenosine 3',5'-monophosphate on CCAAT/enhancer-binding protein-dependent insulin-like growth factor I expression by osteoblasts

Glucocorticoid has complex effects on osteoblasts. Several of these changes appear to be related to steroid concentration, duration of exposure, or specific effects on growth factor expression or activity within bone. One important bone growth factor, insulin-like growth factor I (IGF-I), is induced in osteoblasts by hormones such as PGE2 that increase intracellular cAMP levels. In this way, PGE2 activates transcription factor CCAAT/enhancer-binding protein-delta (C/EBPdelta) and enhances its binding to a specific control element found in exon 1 in the IGF-I gene. Our current studies show that preexposure to glucocorticoid enhanced C/EBPdelta and C/EBPbeta expression by osteoblasts and thereby potentiated IGF-I gene promoter activation in response to PGE2. Importantly, this directly contrasts with inhibitory effects on IGF-I expression that result from sustained or pharmacologically high levels of glucocorticoid exposure. Consistent with the stimulatory effect of IGF-I on bone protein synthesis, pretreatment with glucocorticoid sensitized osteoblasts to PGE2, and in this context significantly enhanced new collagen and noncollagen protein synthesis. Therefore, pharmacological levels of glucocorticoid may reduce IGF-I expression by osteoblasts and cause osteopenic disease, whereas physiological transient increases in glucocorticoid may permit or amplify the effectiveness of hormones that regulate skeletal tissue integrity. These events appear to converge on the important role of C/EBPdelta and C/EBPbeta on IGF-I expression by osteoblasts.

NASA Program Biomedical Research and Countermeasur↗
DOE OSTI2024

Genome reduction improves octanoic acid production in scale down bioreactors

Microorganisms in large-scale bioreactors are exposed to heterogeneous environmental conditions due to physical mixing constraints. Nutritional gradients can lead to transient expression of energetically wasteful stress responses and as a result, can reduce the titres, rates and yields of a bioprocess at larger scales. To what extent these process parameters are impacted is often unknown and therefore bioprocess scale-up comes with major risk. Designing platform strains to account for these intermittent stresses before introducing synthesis pathways is one strategy for de-risking bioprocess development. For example, Escherichia coli strain RM214 is a derivative of wild-type MG1655 that has had several genes and whole operons removed from its genome based on their metabolic cost. In this study, we engineered E. coli strain RM214 (referred to as WG02) to produce octanoic acid from glycerol in batch-flask and fed-batch bioreactor cultivations and compared it to an octanoic acid-producing E. coli MG1655 (WG01). In batch flask cultivations, the two strains performed similarly. However, in carbon limited fed-batch bioreactor cultivations, WG02 provided a greater than 22% boost to biomass compared to WG01 while maintaining similar titres of octanoic acid. Reducing the biomass accumulation of WG02 with nitrogen limited fed-batch cultivation resulted in a 16% improvement in octanoic acid titre over WG01. Finally, in a scale-down system consisting of a stirred tank reactor (representing a well-mixed zone) and plug flow reactor (representing an intermittent carbon starvation zone), WG02 again improved octanoic acid titre by almost 18% while maintaining similar biomass concentrations as WG01.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Effects of Perfluorinated Alkyl Substances (PFAS) on Amphibian Body and Liver Conditions: Is Lipid Metabolism Being Perturbed throughout Metamorphosis?

Per- and polyfluoroalkyl substances (PFAS) may interact with peroxisome proliferator activated receptors (PPARs) and alter lipid homeostasis. Using Xenopus laevis, we investigated the effect of PFAS on (a) lipid homeostasis and whether this correlated to changes in body and hepatic condition; (b) the expression of hepatic genes regulated by PPAR; and (c) the hepatic lipidome. We chronically exposed tadpoles to 0.5 µg/L of either PFOS, PFHxS, PFOA, PFHxA, a binary mixture of PFOS and PFHxS (0.5 µg/L of each), or a control, from NF stage 52 through metamorphic climax. Growth, development, and survival were not affected, but we detected a sex-specific decrease in body condition at NF 66 (6.8%) and in hepatic condition (16.6%) across metamorphic climax for male tadpoles exposed to PFOS. We observed weak evidence for the transient downregulation of apolipoprotein-V (apoa5) at NF 62 in tadpoles exposed to PFHxA. Acyl-CoA oxidase 1 (acox1) was downregulated only in males exposed to PFHxS (Ln(Fold Change) = −0.54). We detected PFAS-specific downregulation of structural glycerophospholipids, while semi-quantitative profiling detected the upregulation in numerous glycerophospholipids, sphingomyelins, and diglycerides. Overall, our findings indicate that PFAS can induce sex-specific effects that change across larval development and metamorphosis. We demonstrate that PFAS alter lipid metabolism at environmentally relevant concentrations through divergent mechanisms that may not be related to PPARs, with an absence of effects on body condition, demonstrating the need for more molecular studies to elucidate mechanisms of PFAS-induced lipid dysregulation in amphibians and in other taxa.

Bushong, Anna (ORCID:0000000249630578)↗
NASA NTRSDate not supplied

Maize Rough Endosperm6 (rgh6) Encodes A Predicted Dead-Box RNA Helicase and Affects Mirna Processing in Endosperm Development

Maize rough endosperm (rgh) mutants have defective kernels with a rough, etched, or pitted endosperm surface. Molecular genetic analysis of this mutant class has identified multiple RNA processing proteins critical to endosperm development. Here, we report on the developmental and molecular function of the rgh6 locus. The rgh6 mutant was isolated from the UniformMu transposon tagging population. Mutant kernels have reduced endosperm size and defective embryos that develop in a more apical position than typical for defective embryos. TB translocation crosses revealed that rgh6 mutant endosperm inhibits normal embryo development. Positional cloning of the rgh6 locus found that it encodes a predicted DEAD-box RNA helicase. Consistent with a predicted function for RNA processing, transient expression of a RGH6-GFP fusion protein is localized to nucleolus and nuclear speckles in Nicotiana benthamiana leaves. Rgh6 transcripts are highly expressed in endosperm epidermal cell types such as the aleurone, basal endosperm cell layer, embryo surrounding region, and endosperm adjacent to scutellum. Markers of these cell types show increased levels in rgh6 mutant kernels. Mutant endosperm tissues have increased precursor microRNA (pre-miRNA) and decreased mature miRNA relative to normal sibling endosperm, indicating that rgh6 is required for miRNA processing. The transcript levels for most miRNA target genes accumulate to a higher level in rgh6 mutant tissue. These results suggest that miRNA processing and regulation of miRNA target genes are required for normal endosperm development.

Plant Sciences↗
DOE OSTI2024

Paternal preconception alcohol consumption increased Angiotensin II‐mediated vasoconstriction in male offspring cerebral arteries via oxidative stress‐AT1R pathway

Abstract Alcohol consumption is popular worldwidely and closely associated with cardiovascular diseases. Influences of paternal preconception alcohol consumption on offspring cerebral arteries are largely unknown. Male rats were randomly given alcohol or water before being mated with alcohol‐naive females to produce alcohol‐ and control‐sired offspring. Middle cerebral artery (MCA) was tested with a Danish Myo Technology wire myograph, patch‐clamp, IONOPTIX, immunofluorescence and quantitative PCR. Alcohol consumption enhanced angiotensin II (AngII)‐mediated constriction in male offspring MCA mainly via AT1R. PD123,319 only augmented AngII‐induced constriction in control offspring. AngII and Bay K8644 induced stronger intracellular calcium transient in vascular smooth muscle cells (VSMCs) from MCA of alcohol offspring. L‐type voltage‐dependent calcium channel (L‐Ca 2+ ) current at baseline and after AngII‐stimulation was higher in VSMCs. Influence of large‐conductance calcium‐activated potassium channel (BK C a ) was lower. Caffeine induced stronger constriction and intracellular calcium release in alcohol offspring. Superoxide anion was higher in alcohol MCA than control. Tempol and thenoyltrifluoroacetone alleviated AngII‐mediated contractions, while inhibition was significantly higher in alcohol group. The mitochondria were swollen in alcohol MCA. Despite lower Kcnma1 and Prkce expression, many genes expressions were higher in alcohol group. Hypoxia induced reactive oxygen species production and increased AT1R expression in control MCA and rat aorta smooth muscle cell line. In conclusion, this study firstly demonstrated paternal preconception alcohol potentiated AngII‐mediated vasoconstriction in offspring MCA via ROS‐AT1R. Alcohol consumption increased intracellular calcium via L‐Ca 2+ channel and endoplasmic reticulum and decreased BK Ca function. The present study provided new information for male reproductive health and developmental origin of cerebrovascular diseases.

Zhang, Ze↗
DOE OSTI2021

Transient knockdown of Anopheles stephensi LRIM1 using RNAi increases Plasmodium falciparum sporozoite salivary gland infections

Abstract Background Plasmodium falciparum (Pf) sporozoites (PfSPZ) can be administered as a highly protective vaccine conferring the highest protection seen to date. Sanaria® PfSPZ vaccines are produced using aseptically reared Anopheles stephensi mosquitoes. The bionomics of sporogonic development of P. falciparum in A. stephensi to fully mature salivary gland PfSPZ is thought to be modulated by several components of the mosquito innate immune system. In order to increase salivary gland PfSPZ infections in A. stephensi and thereby increase vaccine production efficiency, a gene knock down approach was used to investigate the activity of the immune deficiency (IMD) signaling pathway downstream effector leucine-rich repeat immune molecule 1 ( LRIM1 ), an antagonist to Plasmodium development. Methods Expression of LRIM1 in A. stephensi was reduced following injection of double stranded (ds) RNA into mosquitoes. By combining the Gal4/UAS bipartite system with in vivo expression of short hairpin (sh) RNA coding for LRIM1 reduced expression of LRIM1 was targeted in the midgut, fat body, and salivary glands. RT-qPCR was used to demonstrate fold-changes in gene expression in three transgenic crosses and the effects on P. falciparum infections determined in mosquitoes showing the greatest reduction in LRIM1 expression. Results LRIM1 expression could be reduced, but not completely silenced, by expression of LRIM1 dsRNA. Infections of P. falciparum oocysts and PfSPZ were consistently and significantly higher in transgenic mosquitoes than wild type controls, with increases in PfSPZ ranging from 2.5- to tenfold. Conclusions Plasmodium falciparum infections in A. stephensi can be increased following reduced expression of LRIM1. These data provide the springboard for more precise knockout of LRIM1 for the eventual incorporation of immune-compromised A. stephensi into manufacturing of Sanaria’s PfSPZ products.

Billingsley, Peter F. (ORCID:0000000311424813)↗
DOE OSTI2024

Target of 1 Rapamycin kinase is a positive regulator of plant fatty acid 2 and lipid synthesis

In eukaryotes, Target of Rapamycin (TOR), a conserved protein sensor kinase, integrates a diverse set of environmental cues, including growth factor signals, energy availability, and nutritional status, to direct cell growth. In plants, TOR is activated by light and sugars and regulates a wide range of cellular processes, including protein synthesis and metabolism. Fatty acid synthesis is key to membrane biogenesis that in turn, is required for cell growth. To elucidate the primary regulatory role(s) of TOR in lipid metabolism, we followed fatty acid and lipid changes in plants with altered TOR protein levels or activity for short durations, using Nicotiana benthamiana leaves, Arabidopsis seedlings and Brassica napus cell suspension cultures. Transient expression of TOR significantly elevated the levels of total fatty acids in Nicotiana benthamiana leaves, while treatment of Arabidopsis seedlings with Torin 2, a TOR specific inhibitor, for one day, caused significant reductions in fatty acids and membrane lipids. Similarly, incubating oil-producing Brassica napus suspension culture cells with Torin 2 for eight hours led to significant decreases in the levels of TFA and TAG. Taken together the results from three independent systems presented here establishes that TOR positively regulates lipid synthesis in plants, consistent with its role in animals. Furthermore, RNA-seq analysis of Torin 2-treated Arabidopsis seedlings showed that TOR promotes the upregulation of a number of genes involved in de novo fatty acid synthesis while downregulating genes involved in lipid turnover, which we propose as a mechanistic explanation for its promotion of lipid synthesis and accumulation.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Novel interaction interfaces mediate the interaction between the NEIL1 DNA glycosylase and mitochondrial transcription factor A

The maintenance of human mitochondrial DNA (mtDNA) is critical for proper cellular function as damage to mtDNA, if left unrepaired, can lead to a diverse array of pathologies. Of the pathways identified to participate in DNA repair within the mitochondria, base excision repair (BER) is the most extensively studied. Protein-protein interactions drive the step-by-step coordination required for the successful completion of this pathway and are important for crosstalk with other mitochondrial factors involved in genome maintenance. Human NEIL1 is one of seven DNA glycosylases that initiates BER in both the nuclear and mitochondrial compartments. In the current work, we scrutinized the interaction between NEIL1 and mitochondrial transcription factor A (TFAM), a protein that is essential for various aspects of mtDNA metabolism. We note, for the first time, that both the N- and C- terminal domains of NEIL1 interact with TFAM revealing a unique NEIL1 protein-binding interface. The interaction between the two proteins, as observed biochemically, appears to be transient and is most apparent at concentrations of low salt. The presence of DNA (or RNA) also positively influences the interaction between the two proteins, and molar mass estimates indicate that duplex DNA is required for complex formation at higher salt concentrations. Hydrogen deuterium exchange mass spectrometry data reveal that both proteins exchange less deuterium upon DNA binding, indicative of an interaction, and the addition of NEIL1 to the TFAM-DNA complex alters the interaction landscape. The transcriptional activity of TFAM appears to be independent of NEIL1 expression under normal cellular conditions, however, in the presence of DNA damage, we observe a significant reduction in the mRNA expression of TFAM-transcribed mitochondrial genes in the absence of NEIL1. Overall, our data indicate that the interaction between NEIL1 and TFAM can be modulated by local environment such as salt concentrations, protein availability, the presence of nucleic acids, as well as the presence of DNA damage.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS2005

Skeletal phenotype of growing transgenic mice that express a function-perturbing form of beta1 integrin in osteoblasts

Skeletal modeling entails the deposition of large amounts of extracellular matrix (ECM) to form structures tailored to withstand increasing mechanical loads during rapid growth. Specific ECM molecules bind to integrin receptors on the cell surface, thereby triggering a cascade of signaling events that affect critical cell functions. To evaluate the role of integrins during skeletal growth, transgenic mice were engineered to express a function-perturbing fragment of beta1 integrin consisting of the transmembrane domain and cytoplasmic tail under the control of the osteocalcin promoter (TG mice). Thus, transgene expression was targeted to mature cells of the osteoblast lineage, and herein we show that cultured cells resembling osteocytes from 90-day-old TG mice display impaired adhesion to collagen I, a ligand for beta1 integrin. To determine the influence of beta1 integrin on bones that are responsible for providing structural support during periods of rapid growth, we examined the phenotype of the appendicular skeleton in TG mice compared to wild type (WT) mice. According to radiographs, bones from mice of both genotypes between 14 and 90 days of age appeared similar in gross structure and density, although proximal tibiae from 35-90 days old TG mice were less curved than those of WT mice (72-92% TG/WT). Although there were only mild and transient differences in absolute bone mass and strength, once normalized to body mass, the tibial dry mass (79.1% TG/WT females), ash mass (78.5% TG/WT females), and femoral strength in torsion (71.6% TG/WT females) were reduced in TG mice compared to WT mice at 90 days of age. Similar effects of genotype on bone mass and curvature were observed in 1-year-old retired breeders, indicating that these phenotypic differences between TG and WT mice were stable well into adulthood. Effects of genotype on histomorphometric indices of cancellous bone turnover were minimal and evident only transiently during growth, but when present they demonstrated differences in osteoblast rather than osteoclast parameters. Together, these results suggest that integrin signals generated during growth enhance the acquisition of a skeletal mass, structure, and strength to withstand the mechanical loads generated by weight-bearing.

Antigens, CD29/genetics/metabolism↗
DOE OSTI2025

Kölliker's Organ Functions as a Developmental Hub in Mouse Cochlea Regulating Spiral Limbus and Tectorial Membrane Development

Kölliker's organ is a transient developmental structure in the mouse cochlea that undergoes significant remodeling postnatally. Utilizing an epithelial-specific conditional deletion mouse model of Prdm16 (marker and regulator of Kölliker's organ), we show that Prdm16 is required for interdental cell development, and thereby the development of the limbal domain of the tectorial membrane and its medial anchorage to the spiral limbus. Additionally, we show that Kölliker's organ is involved in normal tectorial membrane collagen fibril development and maturation. Interestingly, mesenchymal cells of the spiral limbus underneath Prdm16 -deficient Kölliker's organ failed to produce interstitial matrix proteins, resulting in a hypoplastic and truncated spiral limbus, indicating a non-cell autonomous role of Prdm16 in regulating spiral mesenchymal matrix development. Single-cell RNA sequencing identified differentially expressed genes in Prdm16 -deficient Kölliker's organ suggesting a role for connective tissue growth factor (CTGF) downstream Prdm16 in epithelial-mesenchymal signaling involved in spiral limbus matrix deposition. Prdm16 -deficient mice showed a hearing deficit, as indicated by elevated auditory brainstem response thresholds at most frequencies, consistent with the cochlear structural defects. Both sexes were studied. This work establishes Prdm16 as a deafness gene in mice through its role in regulating Kölliker's organ development. Such understanding recognizes Kölliker's organ as a developmental hub regulating multiple surrounding cochlear structures.

Zhang, Hongji↗
DOE OSTI2025

Nanoparticle-mediated antagonism of sustained endosomal signaling of the calcitonin receptor-like receptor provides enhanced and persistent relief of oral cancer pain

By improving the delivery and tumor retention of chemotherapeutics, nanomedicines hold potential for cancer treatment. The usefulness of nanoparticle (NP)-encapsulated analgesics for the cancer pain treatment is comparatively unexplored. We investigated whether NPs encapsulating olcegepant (OCP), an antagonist of the calcitonin receptor-like receptor (CLR) for the calcitonin gene-related peptide (CGRP), effectively relieved oral cancer pain in mice. Because persistent endosomal CLR signaling in Schwann cells mediates craniofacial pain, we reasoned that the predisposition of NPs to accumulate in endosomes could be leveraged to effectively relieve oral cancer pain. By expressing biosensors for activated CLR, Gα proteins and β-arrestins in HEK293T and Schwann cells, we found that CGRP activates CLR signaling first at the plasma membrane and then in early, late and recycling endosomes and the cis- and trans-Golgi apparatus. We synthesized biocompatible NPs encapsulating OCP and fluorophores by integrating hydrophobic ion pairing nanoformulation with Flash NanoPrecipitation. NPs slowly released OCP and accumulated in early endosomes, leading to sustained inhibition of endosomal CLR signaling in HEK293T and Schwann cells. Oral cancers were established in mice, which led to heightened pain-like responses. After intra-tumoral injection, NPs were retained in tumors for at least one week. OCP-loaded NPs almost completely reversed allodynia and hyperalgesia for a prolonged period, whereas unencapsulated OCP had small and transient effects. The NP accumulation in endosomal sites of pain signaling, the sustained release of antagonist, and the retention of NPs in tumors explain their beneficial actions. Thus, NP-encapsulation holds promise for the relief of painful cancers that are inadequately treated by opioids.

Calcitonin gene-related peptide↗
DOE OSTI2025

Combining genome-wide association studies and expression quantitative trait nucleotide mapping with molecular and genetic validations to identify transcriptional networks regulating drought tolerance in Populus

Objectives: (i). To deploy a large-scale experimental drought trial for up to 1000 unique genotypes of Populus equipping the sites with controlled irrigation and drought treatments that are fully automated and monitored. FULLY COMPLETED (ii) To test the hypothesis that a suite of traits identified for drought tolerance in P. nigra can be measured in drought and control treatments in the wide germplasm collection of P. trichocarpa. FULLY COMPLETED (iii) To use established and novel GWAS model approaches to identify gene loci linked to drought tolerance traits on interest in P. trichocarpa. FULLY COMPLETED (iv) To undertake comparative analysis of GWAS results for drought tolerance traits in P. nigra and P. trichocarpa. PARTIALLY COMPLETED – remains active (v) Using RNAseq in P. trichocarpa, in droughted and control treatments to identify cis- and trans-regulated eQTN. FULLY COMPLETED (vi) Validate up to 50 cis-QTNs, from network hubs using transient protoplast assays. FULLY COMPLETED (vii) To establish Agrobacterium-based gene editing protocols in Populus. FULLY COMPLETED (viii) To utilize early leads from previous research to investigate at least 6 candidate genes for drought tolerance in Populus. FULLY COMPLETED (ix) To validate up to 20 candidate genes for drought tolerance in P. trichocarpa refined from the long-list tested in the transient assays for cis-acting hub gene targets. PARTIALLY COMPLETED- remains active.

60 APPLIED LIFE SCIENCES↗
NASA NTRS1996

Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts

Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal activation of IGF-I gene transcription by cAMP in osteoblasts.

NASA Discipline Musculoskeletal↗
DOE OSTI2024

Dynamics and activity of an ammonia-oxidizing archaea bloom in South San Francisco Bay

Abstract Transient or recurring blooms of ammonia-oxidizing archaea (AOA) have been reported in several estuarine and coastal environments, including recent observations of AOA blooms in South San Francisco Bay. Here, we measured nitrification rates, quantified AOA abundance, and analyzed both metagenomic and metatranscriptomic data to examine the dynamics and activity of nitrifying microorganisms over the course of an AOA bloom in South San Francisco Bay during the autumn of 2018 and seasonally throughout 2019. Nitrification rates were correlated with AOA abundance in quantitative polymerase chain reaction (PCR) data, and both increased several orders of magnitude between the autumn AOA bloom and spring and summer seasons. From bloom samples, we recovered an extremely abundant, high-quality Candidatus Nitrosomarinus catalina-like AOA metagenome-assembled genome that had high transcript abundance during the bloom and expressed >80% of genes in its genome. We also recovered a putative nitrite-oxidizing bacteria metagenome-assembled genome from within the Nitrospinaceae that was of much lower abundance and had lower transcript abundance than AOA. During the AOA bloom, we observed increased transcript abundance for nitrogen uptake and oxidative stress genes in non-nitrifier metagenome-assembled genomes. This study confirms AOA are not only abundant but also highly active during blooms oxidizing large amounts of ammonia to nitrite—a key intermediate in the microbial nitrogen cycle—and producing reactive compounds that may impact other members of the microbial community.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

eYGFPuv-Assisted Transgenic Selection in Populus deltoides WV94 and Multiplex Genome Editing in Protoplasts of P. trichocarpa × P. deltoides Clone ‘52-225’

Although CRISPR/Cas-based genome editing has been widely used for plant genetic engineering, its application in the genetic improvement of trees has been limited, partly because of challenges in Agrobacterium-mediated transformation. As an important model for poplar genomics and biotechnology research, eastern cottonwood (Populus deltoides) clone WV94 can be transformed by A. tumefaciens, but several challenges remain unresolved, including the relatively low transformation efficiency and the relatively high rate of false positives from antibiotic-based selection of transgenic events. Moreover, the efficacy of CRISPR-Cas system has not been explored in P. deltoides yet. Here, we first optimized the protocol for Agrobacterium-mediated stable transformation in P. deltoides WV94 and applied a UV-visible reporter called eYGFPuv in transformation. Our results showed that the transgenic events in the early stage of transformation could be easily recognized and counted in a non-invasive manner to narrow down the number of regenerated shoots for further molecular characterization (at the DNA or mRNA level) using PCR. We found that approximately 8.7% of explants regenerated transgenic shoots with green fluorescence within two months. Next, we examined the efficacy of multiplex CRISPR-based genome editing in the protoplasts derived from P. deltoides WV94 and hybrid poplar clone ‘52-225’ (P. trichocarpa × P. deltoides clone ‘52-225’). The two constructs expressing the Trex2-Cas9 system resulted in mutation efficiency ranging from 31% to 57% in hybrid poplar clone 52-225, but no editing events were observed in P. deltoides WV94 transient assay. The eYGFPuv-assisted plant transformation and genome editing approach demonstrated in this study has great potential for accelerating the genome editing-based breeding process in poplar and other non-model plants species and point to the need for additional CRISPR work in P. deltoides.

59 BASIC BIOLOGICAL SCIENCES↗