Search NASA⌕ Search

SEARCH · Search NASA

Results for “MAGNETIC SWITCHING”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,045 records · Page 58
All sourcesNASA NTRSDOE OSTI
DOE OSTI2014

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2017

Coupled Lattice Polarization and Ferromagnetism in Multiferroic NiTiO 3 Thin Films

Polarization-induced weak ferromagnetism (WFM) was demonstrated a few years back in LiNbO3-type compounds, MTiO3 (M = Fe, Mn, Ni). Although the coexistence of ferroelectric polarization and ferromagnetism has been demonstrated in this rare multiferroic family before, first in bulk FeTiO3, then in thin-film NiTiO3, the coupling of the two order parameters has not been confirmed Here, we report the stabilization of polar, ferromagnetic NiTiO3 by oxide epitaxy on a LiNbO3 substrate utilizing tensile strain and demonstrate the theoretically predicted coupling between its polarization and ferromagnetism by X-ray magnetic circular dichroism under applied fields. The experimentally observed direction of ferroic ordering in the film is supported by simulations using the phase-field approach. Our work validates symmetry-based criteria and first-principles calculations of the coexistence of ferroelectricity and WFM in MTiO3 transition metal titanates crystallizing in the LiNbO3 structure. It also demonstrates the applicability of epitaxial strain as a viable alternative to high-pressure crystal growth to stabilize metastable materials and a valuable tuning parameter to simultaneously control two ferroic order parameters to create a multiferroic. Multiferroic NiTiO3 has potential applications in spintronics where ferroic switching is used, such as new four-stage memories and electromagnetic switches.

36 MATERIALS SCIENCE↗
DOE OSTI2021

Efficiency, Power Loss, and Power Factor Measurement of Quadrupole Magnet Power Supplies at the Spallation Neutron Source

The linear accelerator (LINAC) quadrupole magnets are powered by 42 silicon-controlled rectifier (SCR) based power supplies at the Spallation Neutron Source (SNS) facility of Oak Ridge National Laboratory. These 35V, 525A power supplies are bulky, inefficient and require both air and water cooling. The reliability of the SNS facility is impacted due to water leaks internal to power supplies and current readback issues associated with their unique control system interface, resulting in multiple downtime events. Hence, an alternate solution is necessary for the continued reliable operation of the SNS. To mitigate the above-mentioned problems, this paper proposes the use of off-the-shelf Switch Mode Power Supplies (SMPS) rated for 20V, 500A with serial control interface. These SMPS are air-cooled, more efficient and more compact owing to their switching speeds of approximately 160 kHz. The performance enhancements of the SMPS in comparison with the existing SCR power supply are discussed in detail in this paper. The features of the SMPS, along with experimental results for both power supplies, like efficiency, power losses and stability, are presented. Ongoing work is also discussed.

Harave, Sudarshan↗
DOE OSTI2016

Resistive switching and voltage induced modulation of tunneling magnetoresistance in nanosized perpendicular organic spin valves

Nanoscale multifunctional perpendicular organic spin valves have been fabricated. The devices based on an La{sub 0.7}Sr{sub 0.3}MnO{sub 3}/Alq3/Co trilayer show resistive switching of up to 4-5 orders of magnitude and magnetoresistance as high as -70% the latter even changing sign when voltage pulses are applied. This combination of phenomena is typically observed in multiferroic tunnel junctions where it is attributed to magnetoelectric coupling between a ferromagnet and a ferroelectric material. Modeling indicates that here the switching originates from a modification of the La{sub 0.7}Sr{sub 0.3}MnO{sub 3} surface. This modification influences the tunneling of charge carriers and thus both the electrical resistance and the tunneling magnetoresistance which occurs at pinholes in the organic layer.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2014

Electro-optic switching in iron oxide nanoparticle embedded paramagnetic chiral liquid crystal via magneto-electric coupling

The variation in optical texture, electro-optic, and dielectric properties of iron oxide nanoparticles (NPs) embedded ferroelectric liquid crystal (FLC) with respect to change in temperature and electrical bias conditions are demonstrated in the current investigations. Improvement in spontaneous polarization and response time in nanocomposites has been attributed to magneto-electric (ME) coupling resulting from the strong interaction among the ferromagnetic nanoparticle's exchange field (due to unpaired e{sup −}) and the field of liquid crystal molecular director. Electron paramagnetic resonance spectrum of FLC material gives a broad resonance signal with superimposed components indicating the presence of a source of spin. This paramagnetic behavior of host FLC material had been a major factor in strengthening the guest host interaction by giving an additional possibility of (a) spin-spin interaction and (b) interactions between magnetic-dipole and electric-dipole moments (ME effects) in the composite materials. Furthermore, the phenomenon of dielectric and static memory effect in these composites are also observed which yet again confirms the coupling of magnetic NP's field with FLC's director orientation. We therefore believe that such advanced soft materials holding the optical and electrical properties of conventional LCs with the magnetic and electronic properties of ferromagnetic nanoparticles are going to play a key role in the development of futuristic multifunctional optical devices.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2016

Low-temperature characterization of Nb-Cu-Nb weak links with Ar ion-cleaned interfaces

We characterize niobium-based lateral Superconductor (S)–Normal metal (N)–Superconductor (SNS) weak links through low-temperature switching current measurements and tunnel spectroscopy. We fabricate the SNS devices in two separate lithography and deposition steps, combined with strong argon ion cleaning before the normal metal deposition in the last step. Our SNS weak link consists of high-quality sputtered Nb electrodes that have contacted with evaporated Cu. The two-step fabrication flow enables more flexibility in the choice of materials and pattern design. A comparison of the temperature-dependent equilibrium critical supercurrent with theoretical predictions indicates that the quality of the Nb-Cu interface is similar to that of evaporated Al-Cu weak links. We further demonstrate a hybrid magnetic flux sensor based on an Nb-Cu-Nb SNS junction, where the phase-dependent normal metal density of states is probed with an Al tunnel junction.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗
DOE OSTI2013

Magic Angle Spinning NMR Reveals Sequence-Dependent Structural Plasticity, Dynamics, and the Spacer Peptide 1 Conformation in HIV-1 Capsid Protein Assemblies

Maturation of HIV-1 virus into an infectious virion requires cleavage of the Gag polyprotein into its constituent domains and formation of a conical capsid core that encloses viral RNA and a small complement of proteins for replication. The final step of this process is the cleavage of the SP1 peptide from the CA-SP1 maturation intermediate, which triggers the condensation of the CA protein into a conical capsid. The mechanism of this step, including the conformation of the SP1 peptide in CA-SP1, is under intense debate. In this report, we examine the tubular assemblies of CA and the CA-SP1 maturation intermediate using Magic Angle Spinning NMR spectroscopy. At the magnetic fields of 19.9 T and above, tubular CA and CA-SP1 assemblies yield outstanding-quality 2D and 3D MAS NMR spectra, which are amenable to resonance assignments and detailed structural characterization. Dipolar- and scalar-based correlation experiments unequivocally indicate that SP1 peptide is in a random coil conformation and mobile in the assembled CA-SP1. Analysis of two sequence variants reveals that remarkably, the conformation of SP1 tail, of the functionally important CypA loop, and of the loop preceding helix 8 are sequence dependent and modulated by the residue variations at distal sites. These findings challenge the role of SP1 as a conformational switch in the maturation process and establish sequence-dependent conformational plasticity in CA.

Environmental Molecular Sciences Laboratory↗
DOE OSTI2021

A light-induced phononic symmetry switch and giant dissipationless topological photocurrent in ZrTe 5

Dissipationless currents from topologically protected states are promising for disorder-tolerant electronics and quantum computation. In this work, we photogenerate giant anisotropic terahertz nonlinear currents with vanishing scattering, driven by laser-induced coherent phonons of broken inversion symmetry in a centrosymmetric Dirac material ZrTe 5 . Our work suggests that this phononic terahertz symmetry switching leads to formation of Weyl points, whose chirality manifests in a transverse, helicity-dependent current, orthogonal to the dynamical inversion symmetry breaking axis, via circular photogalvanic effect. The temperature-dependent topological photocurrent exhibits several distinct features: Berry curvature dominance, particle–hole reversal near conical points and chirality protection that is responsible for an exceptional ballistic transport length of ~10 μm. These results, together with first-principles modelling, indicate two pairs of Weyl points dynamically created by B 1u phonons of broken inversion symmetry. Such phononic terahertz control breaks ground for coherent manipulation of Weyl nodes and robust quantum transport without application of static electric or magnetic fields.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2016

Newly designed double surface bimorph mirror for BL-15A of the photon factory

BL-15A is a new x-ray undulator beamline at the Photon Factory. It will be dedicated to two independent research activities, simultaneous XAFS/XRF/XRD experiments, and SAXS/WAXS/GI-SAXS studies. In order to supply a choice of micro-focus, low-divergence and collimated beams, a double surface bimorph mirror was recently developed. To achieve further mirror surface optimization, the pencil beam scanning method was applied for “in-situ” beam inspection and the Inverse Matrix method was used for determination of optimal voltages on the piezoelectric actuators. The corrected beam profiles at every focal spot gave good agreement with the theoretical values and the resultant beam performance is promising for both techniques. Quick and stable switching between highly focused and intense collimated beams was established using this new mirror with the simple motorized stages.

46 INSTRUMENTATION RELATED TO NUCLEAR SCIENCE AND ↗
DOE OSTI2025

Turbulent Heating in Collisionless Low-beta Plasmas: Imbalance, Landau Damping, and Electron–Ion Energy Partition

An understanding of how turbulent energy is partitioned between ions and electrons in weakly collisional plasmas is crucial for modeling many astrophysical systems. Using theory and simulations of a four-dimensional reduced model of low-beta gyrokinetics (the “Kinetic Reduced Electron Heating Model”), we investigate the dependence of collisionless heating processes on plasma beta and imbalance (normalized cross-helicity). These parameters are important because they control the helicity barrier, the formation of which divides the parameter space into two distinct regimes with remarkably different properties. In the first, at lower beta and/or imbalance, the absence of a helicity barrier allows the cascade of injected power to proceed to small (perpendicular) scales, but its slow cascade rate makes it susceptible to significant electron Landau damping, in some cases leading to a marked steepening of the magnetic spectra on scales above the ion Larmor radius. In the second, at higher beta and/or imbalance, the helicity barrier halts the cascade, confining electron Landau damping to scales above the steep “transition-range” spectral break, resulting in dominant ion heating. We formulate quantitative models of these processes that compare well to simulations in each regime, and combine them with results of previous studies to construct a simple formula for the electron–ion heating ratio as a function of beta and imbalance. This model predicts a “winner takes all” picture of low-beta plasma heating, where a small change in the fluctuations' properties at large scales (the imbalance) can cause a sudden switch between electron and ion heating.

Interplanetary turbulence↗
DOE OSTI2016

Simultaneous X-ray and radio observations of the radio-mode-switching pulsar PSR B1822$-$09

Here, we report on simultaneous X-ray and radio observations of the radio-mode-switching pulsar PSR B1822–09 with ESA's XMM–Newton and the Westerbork Synthesis Radio Telescope, Giant Metrewave Radio Telescope and Lovell radio telescopes. PSR B1822–09 switches between a radio-bright and radio-quiet mode, and we discovered a relationship between the durations of its modes and a known underlying radio-modulation time-scale within the modes. We discovered X-ray (energies 0.2–1.4 keV) pulsations with a broad sinusoidal pulse, slightly lagging the radio main pulse in phase by 0.094 ± 0.017, with an energy-dependent pulsed fraction varying from ~0.15 at 0.3 keV to ~0.6 at 1 keV. No evidence is found for simultaneous X-ray and radio mode switching. The total X-ray spectrum consists of a cool component (T ~0.96 × 10 6 K, hotspot radius R ~2.0 km) and a hot component (T ~2.2 × 10 6 K, R ~100 m). The hot component can be ascribed to the pulsed emission and the cool component to the unpulsed emission. The high-energy characteristics of PSR B1822–09 resemble those of middle-aged pulsars such as PSR B0656+14, PSR B1055–52 and Geminga, including an indication for pulsed high-energy gamma-ray emission in Fermi Large Area Telescope data. Explanations for the high pulsed fraction seem to require different temperatures at the two poles of this orthogonal rotator, or magnetic anisotropic beaming effects in its strong magnetic field. In our X-ray skymap, we found a harder source at only 5.1 ± 0.5 arcsec from PSR B1822–09, which might be a pulsar wind nebula.

79 ASTRONOMY AND ASTROPHYSICS↗
DOE OSTI2023

A review of crosstalk polymorphic circuits and their scalability

Using a control variable, the functionality of Polymorphic circuits can be modified, making them adaptable and useful for reconfiguring circuit behavior — all the way from gate level to system level. State-of-the art polymorphic circuits are based on custom non-linear circuit design or emerging devices such as ambipolar FET, configurable magnetic devices etc. While some of these approaches are inefficient in performance, others involve exotic devices. The Crosstalk computing based polymorphic circuits offer a fresh perspective. In Crosstalk, the interconnect interference between nanoscale metal lines is intentionally engineered to exhibit the programmable Boolean logic behavior. This approach relies on the coupling between metal lines and not on the transistors for computing, resulting in better scalability, security by obscurity, and fault tolerance by reconfiguration. Our novel approach is backed by the mathematical formulation that conveys the rationale to generalize and achieve a wide variety of polymorphic circuits. Our experiments, including design, simulation, and Power Performance Area (PPA) characterization results indicate that crosstalk circuits provide significant improvement in transistor count (about 3x), switching energy (2x), and speed (1.5x) for polymorphic logic circuits. In the best-case scenario, the transistor count reduction is 5x. This paper presents Crosstalk computing’s fundamentals, polymorphism and the scalability aspects to compete/co-exist with CMOS for digital logic implementations below 10 nm. Our scalability study uses Open Source 7 nm PDK, considers all process variation aspects and accommodates worst-case scenarios. The study results for various benchmark circuits show that the Crosstalk technology is a viable alternative to CMOS for digital logic implementations below 10 nm, having 48% density, 57% power, and 10% performance gains over equivalent CMOS counterparts. Finally, we compare Crosstalk Polymorphic Circuit design technique with similar approaches described in related works and discuss its features and constraints.

97 MATHEMATICS AND COMPUTING↗
DOE OSTI2021

Cr-Doped Ge-Core/Si-Shell Nanowire: An Antiferromagnetic Semiconductor

An antiferromagnet offers many important functionalities such as opportunities for electrical control of magnetic domains, immunity from magnetic perturbations, and fast spin dynamics. Introducing some of these intriguing features of an antiferromagnet into a low dimensional semiconductor core–shell nanowire offers an exciting pathway for its usage in antiferromagnetic semiconductor spintronics. Here, using a quantum mechanical approach, we predict that the Cr-doped Ge-core/Si-shell nanowire behaves as an antiferromagnetic semiconductor. In this work, the origin of antiferromagnetic spin alignments between Cr is attributed to the superexchange interaction mediated by the p z orbitals of the Ge atoms that are bonded to Cr. A weak spin–orbit interaction was found in this material, suggesting a longer spin coherence length. The spin-dependent quantum transport calculations in the Cr-doped nanowire junction reveals a switching feature with a high ON/OFF current ratio (~41 times higher for the ON state at a relatively small bias of 0.83 V).

77 NANOSCIENCE AND NANOTECHNOLOGY↗
DOE OSTI2026

Noncanonical folding of peptoid oligomers: Formation of a closed conformation in nonpolar solvent

Peptoids provide a versatile platform for foldamer design, yet their conformational behavior in low-dielectric media remains poorly understood. The structural characteristics of N-1-phenylethylglycine (Nspe) homo-oligomers were inves-tigated in chloroform, a solvent that mimics the interior of lipid bilayers, using nuclear magnetic resonance (NMR) spec-troscopy and molecular dynamics (MD) simulations. Nspe7 populated two distinct compact conformations, while Nspe10 adopted a single homogeneous conformation related to the previously reported Nspe9 threaded-loop structure. Integrated experimental and computational analysis reveals that these structures are stabilized by cooperative end-to-end intramo-lecular hydrogen bonding, cis-trans backbone isomerism, and hydrophobic side-chain shielding. The resulting structures minimize exposed polar surface area, demonstrating a closed conformation in the low-dielectric environment. These find-ings establish specific chain-length requirements for achieving well-defined closed conformations. This work provides insights into peptoid folding in nonpolar media, enabling rational design strategies for solvent-directed conformational switching systems.

Oh, Jinyoung↗
DOE OSTI2019

Compac carbon ion LINAC

The invention provides a method for accelerating protons and carbon ions up to 450 MeV/u in a very compact linac, the method comprising subjecting the particles to a radio frequency quadrupole field to accelerate the particles to at least 3 MeV/u, a drift tube linac (DTL) to an energy of 20 MeV/u, followed by a coupled DTL to 45 MeV/u and finally a high-gradient section made of CCL-type standing wave cavities or negative harmonic traveling wave cavities operating at S-band frequencies and capable of delivering voltage gradients of 40 to 60 MV/m. Focusing the accelerated particles while accelerated to higher energy is provided by appropriately placed constant field permanent magnets and electromagnetic quadrupoles. The compactness and power efficiency of the linac is enabled by using high-gradient structure in the S-band frequencies for lower energy particles than ever before. The low-intensity required for hadron therapy allows the use of small-aperture S-band structures and the operation at very high gradient compared to high-intensity machines for research. Operating with very short sub-microsecond pulses at repetition rates up to 400 Hz allows the fast and flexible beam energy and intensity tuning not provided by existing hadron therapy machines. The designed linac is capable of accelerating ions as heavy as neon to the full 450 MeV/u energy, therefore allowing fast beam switching if different ion sources are installed in the front-end of the linac.

43 PARTICLE ACCELERATORS↗
DOE OSTI2015

Fragmentation of fast Josephson vortices and breakdown of ordered states by moving topological defects

Topological defects such as vortices, dislocations or domain walls define many important effects in superconductivity, superfluidity, magnetism, liquid crystals, and plasticity of solids. Here we address the breakdown of the topologically-protected stability of such defects driven by strong external forces. We focus on Josephson vortices that appear at planar weak links of suppressed superconductivity which have attracted much attention for electronic applications, new sources of THz radiation, and low-dissipative computing. Our numerical simulations show that a rapidly moving vortex driven by a constant current becomes unstable with respect to generation of vortex-antivortex pairs caused by Cherenkov radiation. As a result, vortices and antivortices become spatially separated and accumulate continuously on the opposite sides of an expanding dissipative domain. This effect is most pronounced in thin film edge Josephson junctions at low temperatures where a single vortex can switch the whole junction into a resistive state at currents well below the Josephson critical current. In conclusion, our work gives a new insight into instability of a moving topological defect which destroys global long-range order in a way that is remarkably similar to the crack propagation in solids.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2013

PULSAR STATE SWITCHING FROM MARKOV TRANSITIONS AND STOCHASTIC RESONANCE

Markov processes are shown to be consistent with metastable states seen in pulsar phenomena, including intensity nulling, pulse-shape mode changes, subpulse drift rates, spin-down rates, and X-ray emission, based on the typically broad and monotonic distributions of state lifetimes. Markovianity implies a nonlinear magnetospheric system in which state changes occur stochastically, corresponding to transitions between local minima in an effective potential. State durations (though not transition times) are thus largely decoupled from the characteristic timescales of various magnetospheric processes. Dyadic states are common but some objects show at least four states with some transitions forbidden. Another case is the long-term intermittent pulsar B1931+24 that has binary radio-emission and torque states with wide, but non-monotonic duration distributions. It also shows a quasi-period of 38 ± 5 days in a 13 yr time sequence, suggesting stochastic resonance in a Markov system with a forcing function that could be strictly periodic or quasi-periodic. Nonlinear phenomena are associated with time-dependent activity in the acceleration region near each magnetic polar cap. The polar-cap diode is altered by feedback from the outer magnetosphere and by return currents from the equatorial region outside the light cylinder that may also cause the neutron star to episodically charge and discharge. Orbital perturbations of a disk or current sheet provide a natural periodicity for the forcing function in the stochastic-resonance interpretation of B1931+24. Disk dynamics may introduce additional timescales in observed phenomena. Future work can test the Markov interpretation, identify which pulsar types have a propensity for state changes, and clarify the role of selection effects.

79 ASTRONOMY AND ASTROPHYSICS↗
DOE OSTI2020

Enhanced positive and negative exchange bias in FeF 2 /Ni with dusted interfaces

An enhanced exchange bias was found in FeF 2 /Ni interfaces by inserting dusting of Pd and Cu atoms. We have used an ultrathin wedge to investigate systematically the effect of a discontinuous nonmagnetic spacer between the antiferromagnetic and ferromagnetic layers. Negative and positive exchange biases are symmetric and maximized for less than two angstroms of the nonmagnetic layer. Moreover, the dusting reduces the field cooling threshold to switch between the negative and the positive exchange bias. This finding demonstrates that nonmagnetic dusted layers can improve the interfacial exchange energy density in antiferromagnetic/ferromagnetic heterostructures and modify the bulk antiferromagnetic domain structure. Other dusting materials such as Ag, Ti, V, and SiO 2 showed no enhancement in FeF 2 /Ni bilayers, which indicates the atomic sensitivity of this effect.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗