Search NASA⌕ Search

SEARCH · Search NASA

Results for “Core Design”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,207 records · Page 67
All sourcesNASA NTRSDOE OSTI
NASA NTRS1993

The first detection of a collapsed core globular cluster in M31

We report on the observations of a globular cluster (designated G105 = Bo 343) in the nearby spiral galaxy M31, using the Hubble Space Telescope (HST). Image deconvolutions using three different methods indicate that this cluster has a density profile with the morphology characteristic of stellar systems which have undergone core collapse, i.e., a power-law density cusp near the center. This is the first such detection in a galaxy as distant as M31. This discovery may lead to extensive future statistical studies of the globular cluster system of M31, and thus a better understanding of its evolution.

Bendinelli, O.↗
NASA NTRS1982

Advances in core loss calculations for magnetic materials

A new analytical technique which predicts the basic magnetic properties under various operating conditions encountered in state-of-the-art dc-ac/dc converters is discussed. Using a new flux-controlled core excitation circuit, magnetic core characteristics were developed for constant values of ramp flux (square wave voltage excitation) and frequency. From this empirical data, a mathematical loss characteristics equation is developed to analytically predict the specific core loss of several magnetic materials under various waveform excitation conditions. In addition, these characteristics show the circuit designer for the first time the direct functional relatonships between induction level and specific core loss as a function of the two key dc-dc converter operating parameters of input voltage and duty cycle.

Triner, J. E.↗
DOE OSTI2020

Random Variation of ACRR Core Report

The research presented in this paper is to be a contribution to a larger research project. The project was designed to test the safety standards of Sandia National Laboratories' ACRR. The MCNP model of the ACRR core is being used to simulate the environment. To test the safety standards, the dimensions and density of the fuel in the core were varied randomly. Each rod had its own dimension and density assigned to it randomly. Ten different cases of the ACRR core were randomly created. The different cases were studied using 640-group neutron fluxes. The fluxes were compared to see how the variations affected the system.

11 NUCLEAR FUEL CYCLE AND FUEL MATERIALS↗
NASA NTRS2012

Acoustic Performance of the GEAE UPS Research Fan in the NASA Glenn 9- by 15-Foot Low-Speed Wind Tunnel

A model advanced turbofan was acoustically tested in the NASA Glenn 9- by 15-Foot Low-Speed Wind Tunnel in 1994. The Universal Propulsion Simulator fan was designed and manufactured by General Electric Aircraft Engines, and included an active core, as well as bypass, flow paths. The fan was tested with several rotors featuring unswept, forward-swept and aft-swept designs of both metal and composite construction. Sideline acoustic data were taken with both hard and acoustically treated walls in the flow passages. The fan was tested within an airflow at a Mach number of 0.20, which is representative of aircraft takeoff/approach conditions. All rotors showed similar aerodynamic performance. However, the composite rotors typically showed higher noise levels than did corresponding metal rotors. Aft and forward rotor sweep showed at most modest reductions of transonic multiple pure tone levels. However, rotor sweep often introduced increased rotor-stator interaction tone levels. Broadband noise was typically higher for the composite rotors and also for the aft-swept metal rotor. Transonic MPT generation was reduced with increasing fan axis angle of attack (AOA); however, higher downstream noise levels did increase with AOA resulting in higher overall Effective Perceived Noise Level.

Woodward, Richard P.↗
NASA NTRS2005

Virtex-II Pro PowerPC SEE Characterization Test Methods and Results

The Xilinx Vix-11 Pro is a platform FPGA that embeds multiple microprocessors within the fabric of an SRAM-based reprogrammable FPGA. The variety and quantity of resources provided by this family of devices make them very attractive for spaceflight applications. However,these devices will be susceptible to single event effects (SEE), which must be mitigated. Observations from prior testing of the Xilinx Virtex-II Pro suggest that the PowerPC core has significant vulnerability to SEES. However, these initial tests were not designed to exclusively target the functionality of the PowerPC, therefore making it difficult to distinguish processor upsets from fabric upsets. The main focus of this paper involves detailed SEE testing of the embedded PowerPC core. Due to the complexity of the PowerPC, various custom test applications, both static and dynamic, will be designed to isolate each Unit of the processor. Collective analysis of the test results will provide insight into the exact upset mechanism of the PowerPC. With this information, mitigations schemes can be developed and tested that address the specific susceptibilities of these devices. The test bed will be the Xilinx SEE Consortium Virtex-II Pro test board, which allows for configuration scrubbing, design triplication, and ease of data collection. Testing will be performed at the Indiana University Cyclotron Facility using protons of varying energy levels and fluencies. This paper will present the detailed test approach along with the results.

Petrick, David↗
DOE OSTI2017

Liquid-Rich Shale Potential of Utah’s Uinta and Paradox Basins: Reservoir Characterization and Development Optimization

The enclosed report is the culmination of a multi-year and multi-faceted research project investigating Utah’s unconventional tight oil potential. From the beginning, the project team focused efforts on two different plays: (1) the basal Green River Formation’s (GRF) Uteland Butte unconventional play in the Uinta Basin and (2) the more established but understudied Cane Creek shale play in the Paradox Basin. The 2009-2014 high price of crude oil, coupled with lower natural gas prices, generated renewed interest in exploration and development of liquid hydrocarbon reserves. Following the success of the mid-2000s shale gas boom and employing many of the same well completion techniques, petroleum companies started exploring for liquid petroleum in shale formations. In fact, many shales targeted for natural gas include areas in which the shale is more prone to liquid production. In Utah, organic-rich shales in the Uinta and Paradox Basins have been the source of significant hydrocarbon generation, with companies traditionally targeting the interbedded sands or carbonates for their conventional resource recovery. Because of the advances in horizontal drilling and hydraulic fracturing techniques, operators in these basins started to explore the petroleum production potential of the shale units themselves. The GRF in the Uinta Basin has been studied for over 50 years, since the first hydrocarbon discoveries. However, those studies focused on the many conventional sandstone reservoirs currently producing oil and gas. In contrast, less information was available about the more unconventional crude oil production potential of thinner carbonate/shale units, most notably the basal Uteland Butte member. The Cane Creek shale of the Paradox Basin has been a target for exploration periodically since the 1960s and produces oil from several small fields. The play generated much interest in the early 1990s with the successful use of horizontal drilling. Recently, the USGS assessed the undiscovered oil resource in the Cane Creek shale of the Paradox Basin at 103 million barrels at a 95 percent confidence level and 198 million barrels at a 50 percent confidence level. Nonetheless, limited research was available or published to further define the play and the reservoir characteristics. The specific objectives of the enclosed research were to (1) characterize geologic, geochemical, and geomechanical rock properties of target zones in the two designated basins by compiling data and by analyzing available cores, cuttings, and well logs; (2) describe outcrop reservoir analogs of GRF plays (Cane Creek shale is not exposed) and compare them to subsurface data; (3) map major regional trends for targeted intervals and identify “sweet spots” that have the greatest oil potential; (4) reduce exploration costs and drilling risks, especially in environmentally sensitive areas; (5) improve drilling and fracturing effectiveness by determining optimal well completion design; and (6) reduce field development costs, maximize oil recovery, and increase reserves. These objectives are all addressed in a series of nine publications that resulted from this extensive research project. Each publication is included in this report as an independent appendix.

02 PETROLEUM↗
NASA NTRS2017

NASA's Space Launch System: Progress Report

NASA and its commercial industry team achieved significant progress in 2016 in manufacturing and testing of the Block 1 vehicle for the first launch of the Space Launch System (SLS). Test and flight article hardware for the liquid hydrogen fuel tank as well as the engine section for the core stage were completed at Michoud Assembly Facility (MAF) in New Orleans. Test stands neared completion at Marshall Space Flight Center for the propellant tanks, engine section, intertank and payload section. Stennis Space Center completed major structural renovations on the B2 test stand, where the core stage "green run" test program will be conducted. The SLS team completed a hotfire test series at Stennis to successfully demonstrate the ability of the RS-25 engine to operate under SLS environments and performance conditions. The team also test fired the second qualification five-segment solid rocket motor and cast the first six motor segments for the first SLS mission. The Interim Cryogenic Propulsion Stage (ICPS) test article was delivered to Marshall for structural tests, and work is nearly finished on the flight stage. Flight software testing completed at Marshall included power quality and command and data handling. In 2017, that work continues. SLS completed Preliminary Design Review (PDR) on the Exploration Upper Stage (EUS), a powerful, human-rated spacecraft that will propel explorers to cis-lunar space. In 2017, hardware will continue to be integrated at MAF for core stage structural test articles and the first two operational flights. RS-25 hotfire testing will continue to explore engine performance, as well as test flight-like software and four new Engine Controller Units (ECUs) for the first mission. Production of development components for a more affordable RS-25 design is underway. Core stage structural test articles have begun arriving at Marshall. While engineering challenges typical of a new development are possible, SLS is working toward launch readiness in late 2018. This paper will discuss these and other technical and programmatic successes and challenges over the past year and provide a preview of work ahead before first flight

Cook, Jerry↗
DOE OSTI2022

Analysis of Postulated Accident Scenarios for the Transformational Challenge Reactor

The Transformational Challenge Reactor (TCR) is a helium-cooled, yttrium-hydride-moderated reactor that was designed for the U.S. Department of Energy Office of Nuclear Energy. A key objective of the TCR was to employ advanced manufacturing techniques in a nuclear system and demonstrate their potential for revolutionizing the nuclear reactor design process. One purpose of the present work is to demonstrate the safety of the TCR under postulated accidents. Based on RELAP5-3D and COMSOL analyses, the TCR remained below all current safety limits and far below the expected failure limits for the core materials. Another purpose of this work is to provide useful insights and recommendations regarding the application of RELAP5-3D to gas-cooled or other advanced reactors. A novel approach was implemented for simultaneously modeling conduction and radiation in RELAP5-3D, which was found to provide reasonable predictions of radial core, vessel, and ex-vessel heat transfer during postulated events. A multicode approach was also applied, in which high-fidelity COMSOL calculations were used to tune the radial heat transfer parameters in RELAP5-3D. The tuned RELAP5-3D model demonstrated comparable peak temperature predictions as COMSOL, despite a coarse treatment of the core in RELAP5-3D consisting of only two lumped heat structures. This high-fidelity tuning approach enabled enhanced accuracy as well as minimal complexity within the RELAP5-3D model, even for complex fuel geometric designs as in the TCR. Finally, investigations were made into the potential for flow reversal during a pressurized loss-of-forced-flow event in the TCR. The TCR is designed with downward helium flow through the core during normal operation. The RELAP5-3D model predicted that this downward flow would persist, without flow reversal, up to several days after the circulator trip. This was attributed to natural circulation hysteresis effects as have been noted in similar thermofluidic systems. Although flow stagnation and eventual reversal did not lead to unsafe TCR conditions, interesting spatial effects were observed which may have safety relevance for other reactor system designs and coolant types that are designed for downward core flow during normal operation, warranting closer investigation of the flow reversal phenomenon.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
NASA NTRS2007

NASA Tech Briefs, December 2007

Topics include: Ka-Band TWT High-Efficiency Power Combiner for High-Rate Data Transmission; Reusable, Extensible High-Level Data-Distribution Concept; Processing Satellite Imagery To Detect Waste Tire Piles; Monitoring by Use of Clusters of Sensor-Data Vectors; Circuit and Method for Communication Over DC Power Line; Switched Band-Pass Filters for Adaptive Transceivers; Noncoherent DTTLs for Symbol Synchronization; High-Voltage Power Supply With Fast Rise and Fall Times; Waveguide Calibrator for Multi-Element Probe Calibration; Four-Way Ka-Band Power Combiner; Loss-of-Control-Inhibitor Systems for Aircraft; Improved Underwater Excitation-Emission Matrix Fluorometer; Metrology Camera System Using Two-Color Interferometry; Design and Fabrication of High-Efficiency CMOS/CCD Imagers; Foam Core Shielding for Spacecraft CHEM-Based Self-Deploying Planetary Storage Tanks Sequestration of Single-Walled Carbon Nanotubes in a Polymer PPC750 Performance Monitor Application-Program-Installer Builder Using Visual Odometry to Estimate Position and Attitude Design and Data Management System Simple, Script-Based Science Processing Archive Automated Rocket Propulsion Test Management Online Remote Sensing Interface Fusing Image Data for Calculating Position of an Object Implementation of a Point Algorithm for Real-Time Convex Optimization Handling Input and Output for COAMPS Modeling and Grid Generation of Iced Airfoils Automated Identification of Nucleotide Sequences Balloon Design Software Rocket Science 101 Interactive Educational Program Creep Forming of Carbon-Reinforced Ceramic-Matrix Composites Dog-Bone Horns for Piezoelectric Ultrasonic/Sonic Actuators Benchtop Detection of Proteins Recombinant Collagenlike Proteins Remote Sensing of Parasitic Nematodes in Plants Direct Coupling From WGM Resonator Disks to Photodetectors Using Digital Radiography To Image Liquid Nitrogen in Voids Multiple-Parameter, Low-False-Alarm Fire-Detection Systems Mosaic-Detector-Based Fluorescence Spectral Imager Plasmoid Thruster for High Specific-Impulse Propulsion Analysis Method for Quantifying Vehicle Design Goals Improved Tracking of Targets by Cameras on a Mars Rover Sample Caching Subsystem Multistage Passive Cooler for Spaceborne Instruments GVIPS Models and Software Stowable Energy-Absorbing Rocker-Bogie Suspensions

Source record↗
NASA NTRS2024

Test and Analysis of the 8-foot Diameter Cylindrical Sandwich Composite Test Article CTA8.2B: As part of the NASA Engineering and Safety Center Shell Buckling Knockdown Factor Project

The buckling response of thin-walled cylindrical structures have long been shown to be sensitive to various imperfections. That is, imperfections related to load introduction, boundary conditions, material property variation, and geometric deviations can all contribute to experimentally obtained buckling loads being lower than the buckling loads predicted for perfect representations of the same thin-walled cylindrical structure. To account for the influence of geometry-based imperfections of a thin-walled cylindrical structure on buckling response, a design factor (also known as a buckling knockdown factor) is used during the design phase. Guidelines for buckling knockdown factors are readily available in NASA SP-8007, Buckling of Thin Walled Circular Cylinders, which was updated in 2020. Prior to this recent update, NASA SP-8007 had not been updated since 1969, and since that time, computational analysis, experimental testing, and manufacturing methods have significantly improved. The NASA Engineering and Safety Center (NESC) Shell Buckling Knockdown Factor Project (SBKF, NESC Assessment 07-010-E) had the goal of developing buckling design recommendations for select classes of metallic and composite launch-vehicle structures [3]. Specifically, the test and analysis results from the fourth SBKF composite test article SBKF-P3-CYL-CTA8.2B, which is referred to as CTA8.2B, are described in this paper. This test was the fourth in a series of four tests on sandwich composite cylinders that will be used to experimentally validate analysis methods, which in turn can be used to develop new analysis-based shell buckling design guidelines for typical sandwich composite launch vehicle cylindrical structures. Publications describing previous test validation with analysis are available in Refs. CTA8.2B was designed to occupy one corner of the design space with approximately equal bending stiffnesses in the axial and transverse directions and have a larger ratio of radius to effective shell thickness. Each test article had a unique design and was designed to occupy a specific region of the design space. CTA8.2B was an 8-foot diameter honeycomb-core sandwich cylinder that was fabricated and tested at the NASA Marshall Space Flight Center (MSFC). The primary objectives of this test were to interrogate the structural capability of a composite test article, and to verify the test article design and analysis approach for cylinders subjected to axial compression and combined axial and bending loads. First, descriptions of the test article design and test are given in Section 2.0, and modeling and analysis methods used in support of the test article design and testing activities are described briefly in Section 3.0. Then, select test results are presented and compared to predicted results in Section 4.0, and concluding remarks are presented in Section 5.0. Finally, drawings of CTA8.2B and references used to support the test and analysis are provided in the Appendix.

Nonlinear analysis↗
DOE OSTI2024

Progress in Fast Modular Reactor Conceptual Design

The Fast Modular Reactor (FMR) is a 100-MW(thermal) gas-cooled fast reactor being developed by General Atomics Electromagnetic System with the goal of developing a FMR for flexible and dispatchable power to the U.S. electricity market in the mid-2030s. The conceptual design aims to develop and verify simplified design features. These include an inert helium gas coolant, pellet-loaded fuel rods, installations with air cooling as ultimate heat sink, and small and passive heat removal systems. The goal is to ensure the development of a safe, maintainable, cost-effective, and distributed nuclear energy-generating station. The baseline technologies selected to achieve this goal are a helium coolant that is an inert gas with no chemical reaction with structural components, not activated, single phase, enabling high-temperature operation and a high thermal efficiency Brayton cycle; conventional uranium dioxide (UO 2 ) fuel, which is the most widely used and well-known fuel material, capable of high burnup (100 MWd/kg) and a long fuel life; and silicon carbide composite (SiGA®) cladding and internal structures that are chemically inert in the helium environment, exceptionally radiation tolerant, and being derisked by accident tolerant fuel technology development. Further, the reactor was specifically designed with passive safety features, including high-temperature in-core materials and a reactor vessel cooling system consisting of cooling panels of naturally circulating water. The passive safety of the core was confirmed for the depressurized loss-of–forced cooling accident, which showed the peak cladding temperature at ~1600°C during the transient, which is below the current design limit of 1800°C. The conceptual design of the FMR has been conducted for the reactor system, vessel system, generator and turbomachine, instrumentation and control, residual heat removal system, plant service system, and containment, as well as pre-application licensing documents.

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗
NASA NTRS2011

Exploring the Model Design Space for Battery Health Management

Battery Health Management (BHM) is a core enabling technology for the success and widespread adoption of the emerging electric vehicles of today. Although battery chemistries have been studied in detail in literature, an accurate run-time battery life prediction algorithm has eluded us. Current reliability-based techniques are insufficient to manage the use of such batteries when they are an active power source with frequently varying loads in uncertain environments. The amount of usable charge of a battery for a given discharge profile is not only dependent on the starting state-of-charge (SOC), but also other factors like battery health and the discharge or load profile imposed. This paper presents a Particle Filter (PF) based BHM framework with plug-and-play modules for battery models and uncertainty management. The batteries are modeled at three different levels of granularity with associated uncertainty distributions, encoding the basic electrochemical processes of a Lithium-polymer battery. The effects of different choices in the model design space are explored in the context of prediction performance in an electric unmanned aerial vehicle (UAV) application with emulated flight profiles.

Saha, Bhaskar↗
DOE OSTI2022

Polymerized Small Molecular Acceptor with Branched Side Chains for All Polymer Solar Cells with Efficiency over 16.7%

The power conversion efficiencies (PCEs) of small molecule acceptor (SMA)-based organic solar cells have already exceeded 18%. However, the development of polymer acceptors still lags far behind their SMA counterparts mainly due to the lack of efficient polymer acceptors. In this work, a series of polymer acceptors named PY-X (with X being the branched alkyl chain) are designed and synthesized by employing the same central core with the SMA L8-BO but with different branched alkyl chains on the pyrrole motif. It is found that the molecular packing of SMA-HD featuring 2-hexyldecyl side chain used in the synthesis of PY-HD is similar to L8-BO, in which the branched alkyl chains lead to condensed and high-order molecular assembly in SMA-HD molecules. When combined with PM6, PY-HD-based all polymer solar cell (all-PSC) exhibits a high PCE of 16.41%, representing the highest efficiency for the binary all-PSCs. Moreover, the side-chain modification on the pyrrole site position further improves the performance of the all-PSCs, and the PY-DT-based device delivers a new record high efficiency of 16.76% (certified as 16.3%). The work provides new insights for understanding the structure–property relationship of polymer acceptors and paves a feasible avenue to develop efficient conjugated polymer acceptors.

14 SOLAR ENERGY↗
DOE OSTI2023

Mechanism of glycoform specificity and in vivo protection by an anti-afucosylated IgG nanobody

Abstract Immunoglobulin G (IgG) antibodies contain a complex N -glycan embedded in the hydrophobic pocket between its heavy chain protomers. This glycan contributes to the structural organization of the Fc domain and determines its specificity for Fcγ receptors, thereby dictating distinct cellular responses. The variable construction of this glycan structure leads to highly-related, but non-equivalent glycoproteins known as glycoforms. We previously reported synthetic nanobodies that distinguish IgG glycoforms. Here, we present the structure of one such nanobody, X0, in complex with the Fc fragment of afucosylated IgG1. Upon binding, the elongated CDR3 loop of X0 undergoes a conformational shift to access the buried N -glycan and acts as a ‘glycan sensor’, forming hydrogen bonds with the afucosylated IgG N -glycan that would otherwise be sterically hindered by the presence of a core fucose residue. Based on this structure, we designed X0 fusion constructs that disrupt pathogenic afucosylated IgG1-FcγRIIIa interactions and rescue mice in a model of dengue virus infection.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2017

Transport and spatial energy deposition of relativistic electrons in copper-doped fast ignition plasmas

Fast electron transport and spatial energy deposition are investigated in integrated cone-guided Fast Ignition experiments by measuring fast electron induced copper K-shell emission using a copper tracer added to deuterated plastic shells with a geometrically reentrant gold cone. Experiments were carried out at the Laboratory for Laser Energetics on the OMEGA/OMEGA-EP Laser where the plastic shells were imploded using 54 of the 60 OMEGA60 beams (3ω, 20 kJ), while the high intensity OMEGA-EP (BL2) beam (1 ω, 10 ps, 500 J, I peak > 10 19 W/cm 2 ) was focused onto the inner cone tip. Here, a retrograde analysis using the hybrid-PIC electron transport code, ZUMA, is performed to examine the sensitivity of the copper Kα spatial profile on the laser-produced fast electrons, facilitating the optimization of new target point designs and laser configurations to improve the compressed core areal density by a factor of 4 and the fast electron energy coupling by a factor of 3.5.

42 ENGINEERING↗
DOE OSTI2024

Thermal Fluid Modeling Approaches in SAM for High Temperature Gas-Cooled Reactor Applications

This paper provides an overview of the unique modeling and simulation challenges and needs in the system and safety analysis of two common types of High Temperature Gas-cooled Reactor (HTGR) designs. The challenges are associated with the complex core geometry configurations and the change of the dominant heat removal mechanisms between normal operating conditions and decay heat removal transients. This requires that simulation tools utilize models with reasonable length scales and capture both the localized heat transfer and the core-scale heat transfer at the same time. To meet such analysis needs, different methodologies were developed. In conclusion, this includes adopting existing methods and further developing/improving them, as well as proposing innovative methods that leverage advanced computational frameworks such as the Multiphysics Object Oriented Simulation Environment (MOOSE).

HTGR↗
DOE OSTI2022

Global gyrokinetic simulations of ASDEX Upgrade up to the transport timescale with GENE–Tango

An accurate description of turbulence up to the transport timescale is essential for predicting core plasma profiles and enabling reliable calculations for designing advanced scenarios and future devices. Here, we exploit the gap separation between turbulence and transport timescales and couple the global gyrokinetic code GENE to the transport-solver Tango, including kinetic electrons, collisions, realistic geometries, toroidal rotation and electromagnetic effects for the first time. This approach overcomes gyrokinetic codes' limitations and enables high-fidelity profile calculations in experimentally relevant plasma conditions, significantly reducing the computational cost. We present numerical results of GENE–Tango for two ASDEX Upgrade discharges, one of which exhibits a pronounced peaking of the ion temperature profile not reproduced by TGLF–ASTRA. We show that GENE–Tango can correctly capture the ion temperature peaking observed in the experiment. By retaining different physical effects in the GENE simulations, e.g., collisions, toroidal rotation and electromagnetic effects, we show that the ion temperature profile's peaking can be linked to electromagnetic effects of submarginal (stable) KBM modes. Furthermore, based on these results, the expected GENE–Tango speedup for the ITER standard scenario is larger than two orders of magnitude compared to a single gyrokinetic simulation up to the transport timescale, possibly making first-principles ITER simulations feasible on current computing resources.

70 PLASMA PHYSICS AND FUSION TECHNOLOGY↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗