Search NASA⌕ Search

SEARCH · Search NASA

Results for “BIOLOGICAL STRESS”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 127 records · Page 7
All sourcesNASA NTRSDOE OSTI
DOE OSTI2021

Stoichiometric Ecotoxicology for a Multisubstance World

Nutritional and contaminant stressors influence organismal physiology, trophic interactions, community structure, and ecosystem-level processes; however, the interactions between toxicity and elemental imbalance in food resources have been examined in only a few ecotoxicity studies. Integrating well-developed ecological theories that cross all levels of biological organization can enhance our understanding of ecotoxicology. In the present article, we underline the opportunity to couple concepts and approaches used in the theory of ecological stoichiometry (ES) to ask ecotoxicological questions and introduce stoichiometric ecotoxicology, a subfield in ecology that examines how contaminant stress, nutrient supply, and elemental constraints interact throughout all levels of biological organization. This conceptual framework unifying ecotoxicology with ES offers potential for both empirical and theoretical studies to deepen our mechanistic understanding of the adverse outcomes of chemicals across ecological scales and improve the predictive powers of ecotoxicology.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2021

A multistep enrichment process with custom growth medium improves resuscitation of chlorine-stressed coliforms from secondary sewage effluents

Resuscitation and detection of stressed coliforms in treated water samples is needed to assess and prevent health effects from adverse exposure. Herein, we developed a custom growth media that improved total coliform resuscitation from chlorine-stressed samples from secondary effluent to see if detection time could be reduced from 18 to 8 hours.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Developmentally-specific physiological and metabolic responses support drought resilience in switchgrass and constrains biofuel yield

Switchgrass (Panicum virgatum) is a promising bioenergy crop due in part to its resilience to drought stress. However, the significance of drought timing remains poorly understood, both from a plant biology perspective and its impact on downstream biofuel production. This study determines the developmental stage-specific physiological and metabolic responses of switchgrass to drought stress and its implications for biofuel production using a custom-built programmable irrigation system. Vegetative, flowering, and senescence-stage drought significantly reduced carbon dioxide assimilation, and stomatal conductance without affecting biomass yield. Metabolic profiling revealed significant accumulation of glucose, fructose, quinic acid, shikimate and GABA during vegetative-stage drought, while flowering and senescence stages exhibited limited metabolic changes. Similarly, specialized metabolites also displayed distinct developmental patterns, with vegetative-stage drought driving the most pronounced metabolic alterations. Thermochemically-treated and hydrolyzed switchgrass biomass from vegetative-stage drought showed elevated lignocellulose-derived compounds and saponins with the latter most positively correlating with fermentation lag times. Conversely, senescence-stage drought enhanced ethanol yields while lowering saponin levels in the hydrolysates. While vegetative-stage drought enhanced physiological resilience, it compromises downstream biofuel production by introducing fermentation inhibitors, particularly saponins.

biofuel↗
DOE OSTI2024

Genome-wide profiling of histone (H3) lysine 4 (K4) tri-methylation (me3) under drought, heat, and combined stresses in switchgrass

Background: Switchgrass (Panicum virgatum L.) is a warm-season perennial (C4) grass identified as an important biofuel crop in the United States. It is well adapted to the marginal environment where heat and moisture stresses predominantly affect crop growth. However, the underlying molecular mechanisms associated with heat and drought stress tolerance still need to be fully understood in switchgrass. The methylation of H3K4 is often associated with transcriptional activation of genes, including stress-responsive. Therefore, this study aimed to analyze genome-wide histone H3K4-tri-methylation in switchgrass under heat, drought, and combined stress. Results: In total, ~ 1.3 million H3K4me3 peaks were identified in this study using SICER. Among them, 7,342; 6,510; and 8,536 peaks responded under drought (DT), drought and heat (DTHT), and heat (HT) stresses, respectively. Most DT and DTHT peaks spanned 0 to + 2000 bases from the transcription start site [TSS]. By comparing differentially marked peaks with RNA-Seq data, we identified peaks associated with genes: 155 DT-responsive peaks with 118 DT-responsive genes, 121 DTHT-responsive peaks with 110 DTHT-responsive genes, and 175 HT-responsive peaks with 136 HT-responsive genes. We have identified various transcription factors involved in DT, DTHT, and HT stresses. Gene Ontology analysis using the AgriGO revealed that most genes belonged to biological processes. Most annotated peaks belonged to metabolite interconversion, RNA metabolism, transporter, protein modifying, defense/immunity, membrane traffic protein, transmembrane signal receptor, and transcriptional regulator protein families. Further, we identified significant peaks associated with TFs, hormones, signaling, fatty acid and carbohydrate metabolism, and secondary metabolites. qRT-PCR analysis revealed the relative expressions of six abiotic stress-responsive genes (transketolase, chromatin remodeling factor-CDH3, fatty-acid desaturase A, transmembrane protein 14C, beta-amylase 1, and integrase-type DNA binding protein genes) that were significantly (P < 0.05) marked during drought, heat, and combined stresses by comparing stress-induced against un-stressed and input controls. Conclusion: Our study provides a comprehensive and reproducible epigenomic analysis of drought, heat, and combined stress responses in switchgrass. Significant enrichment of H3K4me3 peaks downstream of the TSS of protein-coding genes was observed. In addition, the cost-effective experimental design, modified ChIP-Seq approach, and analyses presented here can serve as a prototype for other non-model plant species for conducting stress studies.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Synthetic microbial communities: Bridging research and application in second-generation bioenergy feedstock microbiomes

The sustainable production of purpose-grown bioenergy feedstocks is essential in transitioning away from fossil fuels. Synthetic communities (SynComs) are consortia of microorganisms that can be used as biological interventions to support objectives like plant growth and stress tolerance. This review examines the state of knowledge regarding microbiomes and SynComs of second-generation bioenergy feedstocks, focusing on the rhizosphere. We first provide an overview of second-generation feedstocks, including switchgrass (Panicum virgatum), miscanthus (Miscanthus × giganteus), sorghum (Sorghum spp.), sugarcane (Saccharum spp.), and poplar (Populus spp.), and summarize our current understanding of their plant-soil-microbiome ecology. We next discuss considerations in the objectives, design, and evaluation of SynComs to enhance feedstock production, and then critically review the literature around their use. Our literature analysis revealed that SynCom performance varied substantially between controlled pilot experiments and field trials, possibly due to system complexity that could not be fully considered in their design and pilot evaluation. We identified a gap in the use of SynComs to support the unique sustainability objectives of biofuel feedstock agriculture, presenting an opportunity to leverage these additional microbial traits in SynCom designs. Finally, we emphasize the importance of targeted research to identify the ecological principles that govern the assembly, activation, and persistence of microbes in the feedstock rhizosphere, thereby enhancing our capacity to manage microbiomes under diverse environmental conditions and ensure their functionality. Beyond biofuels, SynComs are a promising microbiome management strategy for crop production; however, an ecologically informed design and evaluation of SynComs are advised.

SynCom↗
DOE OSTI2021

The Ancient Salicoid Genome Duplication Event: A Platform for Reconstruction of De Novo Gene Evolution in Populus trichocarpa

Orphan genes are characteristic genomic features that have no detectable homology to genes in any other species and represent an important attribute of genome evolution as sources of novel genetic functions. Here, we identified 445 genes specific to Populus trichocarpa. Of these, we performed deeper reconstruction of 13 orphan genes to provide evidence of de novo gene evolution. Populus and its sister genera Salix are particularly well suited for the study of orphan gene evolution because of the Salicoid whole-genome duplication event which resulted in highly syntenic sister chromosomal segments across the Salicaceae. We leveraged this genomic feature to reconstruct de novo gene evolution from intergenera, interspecies, and intragenomic perspectives by comparing the syntenic regions within the P. trichocarpa reference, then P. deltoides, and finally Salix purpurea. Furthermore, we demonstrated that 86.5% of the putative orphan genes had evidence of transcription. Additionally, we also utilized the Populus genome-wide association mapping panel, a collection of 1,084 undomesticated P. trichocarpa genotypes to further determine putative regulatory networks of orphan genes using expression quantitative trait loci (eQTL) mapping. Functional enrichment of these eQTL subnetworks identified common biological themes associated with orphan genes such as response to stress and defense response. We also identify a putative cis-element for a de novo gene and leverage conserved synteny to describe evolution of a putative transcription factor binding site. Overall, 45% of orphan genes were captured in trans-eQTL networks.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Membrane lipid and expression responses of Saccharolobus islandicus REY15A to acid and cold stress

Archaea adjust the number of cyclopentane rings in their glycerol dibiphytanyl glycerol tetraether (GDGT) membrane lipids as a homeostatic response to environmental stressors such as temperature, pH, and energy availability shifts. However, archaeal expression patterns that correspond with changes in GDGT composition are less understood. Here we characterize the acid and cold stress responses of the thermoacidophilic crenarchaeon Saccharolobus islandicus REY15A using growth rates, core GDGT lipid profiles, transcriptomics and proteomics. We show that both stressors result in impaired growth, lower average GDGT cyclization, and differences in gene and protein expression. Transcription data revealed differential expression of the GDGT ring synthase grsB in response to both acid stress and cold stress. Although the GDGT ring synthase encoded by grsB forms highly cyclized GDGTs with ≥5 ring moieties, S. islandicus grsB upregulation under acidic pH conditions did not correspond with increased abundances of highly cyclized GDGTs. Our observations highlight the inability to predict GDGT changes from transcription data alone. Broader analysis of transcriptomic data revealed that S. islandicus differentially expresses many of the same transcripts in response to both acid and cold stress. These included upregulation of several biosynthetic pathways and downregulation of oxidative phosphorylation and motility. Transcript responses specific to either of the two stressors tested here included upregulation of genes related to proton pumping and molecular turnover in acid stress conditions and upregulation of transposases in cold stress conditions. Overall, our study provides a comprehensive understanding of the GDGT modifications and differential expression characteristic of the acid stress and cold stress responses in S. islandicus.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Multidimensional genome-wide screening in yeast provides mechanistic insights into europium toxicity

Abstract Europium is a lanthanide metal that is highly valued in optoelectronics. Even though europium is used in many commercial products, its toxicological profile has only been partially characterized, with most studies focusing on identifying lethal doses in different systems or bioaccumulation in vivo. This paper describes a genome-wide toxicogenomic study of europium in Saccharomyces cerevisiae, which shares many biological functions with humans. By using a multidimensional approach and functional and network analyses, we have identified a group of genes and proteins associated with the yeast responses to ameliorate metal toxicity, which include metal discharge paths through vesicle-mediated transport, paths to regulate biologically relevant cations, and processes to reduce metal-induced stress. Furthermore, the analyses indicated that europium promotes yeast toxicity by disrupting the function of chaperones and cochaperones, which have metal-binding sites. Several of the genes and proteins highlighted in our study have human orthologues, suggesting they may participate in europium-induced toxicity in humans. By identifying the endogenous targets of europium as well as the already existing paths that can decrease its toxicity, we can determine specific genes and proteins that may help to develop future therapeutic strategies.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Multi-omics profiling of the cold tolerant Monoraphidium minutum 26B-AM in response to abiotic stress

Microalgae that are of interest for biofuel production must be able to tolerate environmental changes that occur in outdoor cultivation systems. While algal cultures may experience daily temperature fluctuations and seasonal environmental changes, the underlying mechanisms that control and regulate physiological responses and adaptation to environmental pressures are largely unknown. Systems-level characterization enabled by functional genomics can help identify biochemical pathways that promote stability and productivity of algae in various environmental conditions. Monoraphidium minutum 26B-AM, a freshwater green microalga, was identified as a top performer in biomass production in winter season screens. We sequenced the genome of M. minutum 26B-AM and applied our multi-omics pipeline to profile this high potential strain under high salt and cold temperature perturbations. Through comparative analysis, including other green algae in the class Chlorophyceae, we identified gene families unique to the genus Monoraphidium, including a desaturase that has been linked to cold tolerance in plants. We observed that osmolytes, such as trehalose, proline and betaine, accumulate under salt stress, coinciding with upregulation of genes involved in biosynthesis of these metabolites. From the genome annotation, we reconstructed a metabolic model to provide a detailed map of the metabolic pathways and can be used to simulate growth and reaction fluxes. This multi-omics analysis provides a foundation to explore algal strain potential for biofuel applications, guides strain engineering, and expands our understanding of metabolic and regulatory mechanisms of algae in applied systems.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Microscopic dynamics underlying the stress relaxation of arrested soft materials

Arrested soft materials such as gels and glasses exhibit a slow stress relaxation with a broad distribution of relaxation times in response to linear mechanical perturbations. Although this macroscopic stress relaxation is an essential feature in the application of arrested systems as structural materials, consumer products, foods, and biological materials, the microscopic origins of this relaxation remain poorly understood. Here, we elucidate the microscopic dynamics underlying the stress relaxation of such arrested soft materials under both quiescent and mechanically perturbed conditions through X-ray photon correlation spectroscopy. By studying the dynamics of a model associative gel system that undergoes dynamical arrest in the absence of aging effects, we show that the mean stress relaxation time measured from linear rheometry is directly correlated to the quiescent superdiffusive dynamics of the microscopic clusters, which are governed by a buildup of internal stresses during arrest. We also show that perturbing the system via small mechanical deformations can result in large intermittent fluctuations in the form of avalanches, which give rise to a broad non-Gaussian spectrum of relaxation modes at short times that is observed in stress relaxation measurements. These findings suggest that the linear viscoelastic stress relaxation in arrested soft materials may be governed by nonlinear phenomena involving an interplay of internal stress relaxations and perturbation-induced intermittent avalanches.

36 MATERIALS SCIENCE↗
DOE OSTI2020

Drought Drives Spatial Variation in the Millet Root Microbiome

Efforts to boost crop yield and meet global food demands while striving to reach sustainability goals are hindered by the increasingly severe impacts of abiotic stress, such as drought. One strategy for alleviating drought stress in crops is to utilize rootassociated bacteria, yet knowledge concerning the relationship between plant hosts and their microbiomes during drought remain under-studied. One broad pattern that has recently been reported in a variety of monocot and dicot species from both native and agricultural environments, is the enrichment of Actinobacteria within the drought-stressed root microbiome. In order to better understand the causes of this phenomenon, we performed a series of experiments in millet plants to explore the roles of drought severity, drought localization, and root development in provoking Actinobacteria enrichment within the root endosphere. Through 16S rRNA ampliconbased sequencing, we demonstrate that the degree of drought is correlated with levels of Actinobacterial enrichment in four species of millet. Additionally, we demonstrate that the observed drought-induced enrichment of Actinobacteria occurs along the length of the root, but the response is localized to portions of the root experiencing drought. Finally, we demonstrate that Actinobacteria are depleted in the dead root tissue of Japanese millet, suggesting saprophytic activity is not the main cause of observed shifts in drought-treated root microbiome structure. Collectively, these results help narrow the list of potential causes of drought-induced Actinobacterial enrichment in plant roots by showing that enrichment is dependent upon localized drought responses but not root developmental stage or root death.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Intraspecific Variation for Leaf Physiological and Root Morphological Adaptation to Drought Stress in Alfalfa ( Medicago sativa L.)

Drought stress reduces crop biomass yield and the profitability of rainfed agricultural systems. Evaluation of populations or accessions adapted to diverse geographical and agro-climatic environments sheds light on beneficial plant responses to enhance and optimize yield in resource-limited environments. This study used the morphological and physiological characteristics of leaves and roots from two different alfalfa subspecies during progressive drought stress imposed on controlled and field conditions. Two different soils (Experiments 1 and 2) imposed water stress at different stress intensities and crop stages in the controlled environment. Algorithm-based image analysis of leaves and root systems revealed key morphological and physiological traits associated with biomass yield under stress. The Medicago sativa subspecies (ssp.) sativa population, PI478573, had smaller leaves and maintained higher chlorophyll content (CC), leaf water potential, and osmotic potential under water stress. In contrast, M. sativa ssp. varia, PI502521, had larger leaves, a robust root system, and more biomass yield. In the field study, an unmanned aerial vehicle survey revealed PI502521 to have a higher normalized difference vegetation index (vegetation cover and plant health characteristics) throughout the cropping season, whereas PI478573 values were low during the hot summer and yielded low biomass in both irrigated and rainfed treatments. RhizoVision Explorer image analysis of excavated roots revealed a smaller diameter and a narrow root angle as target traits to increase alfalfa biomass yield irrespective of water availability. Root architectural traits such as network area, solidity, volume, surface area, and maximum radius exhibited significant variation at the genotype level only under limited water availability. Different drought-adaptive strategies identified across subspecies populations will benefit the plant under varying levels of water limitation and facilitate the development of alfalfa cultivars suitable across a broad range of growing conditions. The alleles from both subspecies will enable the development of drought-tolerant alfalfa with enhanced productivity under limited water availability.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

A transcriptomic atlas of acute stress response to low pH in multiple Issatchenkia orientalis strains

Because of its natural stress tolerance to low pH, Issatchenkia orientalis (a.k.a. Pichia kudriavzevii) is a promising non-model yeast for bio-based production of organic acids. Yet, this organism is relatively unstudied, and specific mechanisms of its tolerance to low pH are poorly understood, limiting commercial use. In this study, we selected 12 I. orientalis strains with varying acid stress tolerance (six tolerant and six susceptible) and profiled their transcriptomes in different pH conditions to study potential mechanisms of pH tolerance in this species. We identified hundreds of genes whose expression response is shared by tolerant strains but not by susceptible strains, or vice versa, as well as genes whose responses are reversed between tolerant and susceptible strains. We mapped regulatory mechanisms of transcriptomic responses via motif analysis as well as differential network reconstruction, identifying several transcription factors, including Stb5, Mac1, and Rtg1/Rtg3, some of which are known for their roles in acid response in Saccharomyces cerevisiae. Functional genomics analysis of short-listed genes and transcription factors suggested significant roles for energy metabolism and translation-related processes, as well as the cell wall integrity pathway and RTG-dependent retrograde signaling pathway. Finally, we conducted additional experiments for two organic acids, 3-hydroxypropionate and citramalate, to eliminate acid-specific effects and found potential roles for glycolysis and trehalose biosynthesis specifically for response to low pH. In summary, our approach of comparative transcriptomics and phenotypic contrasting, along with a multi-pronged bioinformatics analysis, suggests specific mechanisms of tolerance to low pH in I. orientalis that merit further validation through experimental perturbation and engineering.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

A rapid assay for assessing bacterial effects on Arabidopsis thermotolerance

Abstract Background The role of beneficial microbes in mitigating plant abiotic stress has received considerable attention. However, the lack of a reproducible and relatively high-throughput screen for microbial contributions to plant thermotolerance has greatly limited progress in this area, this slows the discovery of novel beneficial isolates and the processes by which they operate. Results We designed a rapid phenotyping method to assess the effects of bacteria on plant host thermotolerance. After testing multiple growth conditions, a hydroponic system was selected and used to optimize an Arabidopsis heat shock regime and phenotypic evaluation. Arabidopsis seedlings germinated on a PTFE mesh disc were floated onto a 6-well plate containing liquid MS media, then subjected to heat shock at 45 °C for various duration. To characterize phenotype, plants were harvested after four days of recovery to measure chlorophyll content. The method was extended to include bacterial isolates and to quantify bacterial contributions to host plant thermotolerance. As an exemplar, the method was used to screen 25 strains of the plant growth promoting Variovorax spp. for enhanced plant thermotolerance. A follow-up study demonstrated the reproducibility of this assay and led to the discovery of a novel beneficial interaction. Conclusions This method enables rapid screening of individual bacterial strains for beneficial effects on host plant thermotolerance. The throughput and reproducibility of the system is ideal for testing many genetic variants of Arabidopsis and bacterial strains.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

The Antioxidant Enzyme Methionine Sulfoxide Reductase A (MsrA) Interacts with Jab1/CSN5 and Regulates Its Function

Methionine sulfoxide (MetO) is an oxidative posttranslational modification that primarily occurs under oxidative stress conditions, leading to alteration of protein structure and function. This modification is regulated by MetO reduction through the evolutionarily conserved methionine sulfoxide reductase (Msr) system. The Msr type A enzyme (MsrA) plays an important role as a cellular antioxidant and promotes cell survival. The ubiquitin- (Ub) like neddylation pathway, which is controlled by the c-Jun activation domain-binding protein-1 (Jab1), also affects cell survival. Jab1 negatively regulates expression of the cell cycle inhibitor cyclin-dependent kinase inhibitor 1B (P27) through binding and targeting P27 for ubiquitination and degradation. Here we report the finding that MsrA interacts with Jab1 and enhances Jab1's deneddylase activity (removal of Nedd8). In turn, an increase is observed in the level of deneddylated Cullin-1 (Cul-1, a component of E3 Ub ligase complexes). Furthermore, the action of MsrA increases the binding affinity of Jab1 to P27, while MsrA ablation causes a dramatic increase in P27 expression. Thus, an interaction between MsrA and Jab1 is proposed to have a positive effect on the function of Jab1 and to serve as a means to regulate cellular resistance to oxidative stress and to enhance cell survival.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

De novo transcriptome in roots of switchgrass ( Panicum virgatum L. ) reveals gene expression dynamic and act network under alkaline salt stress

Background: Soil salinization is a major limiting factor for crop cultivation. Switchgrass is a perennial rhizomatous bunchgrass that is considered an ideal plant for marginal lands, including sites with saline soil. Here we investigated the physiological responses and transcriptome changes in the roots of Alamo (alkaline-tolerant genotype) and AM314/MS-155 (alkaline-sensitive genotype) under alkaline salt stress. Results: Alkaline salt stress significantly affected the membrane, osmotic adjustment and antioxidant systems in switchgrass roots, and the ASTTI values between Alamo and AM-314/MS-155 were divergent at different time points. A total of 108,319 unigenes were obtained after reassembly, including 73,636 unigenes in AM-314/MS-155 and 65,492 unigenes in Alamo. A total of 10,219 DEGs were identified, and the number of upregulated genes in Alamo was much greater than that in AM-314/MS-155 in both the early and late stages of alkaline salt stress. The DEGs in AM-314/MS-155 were mainly concentrated in the early stage, while Alamo showed greater advantages in the late stage. These DEGs were mainly enriched in plant-pathogen interactions, ubiquitin-mediated proteolysis and glycolysis/gluconeogenesis pathways. We characterized 1480 TF genes into 64 TF families, and the most abundant TF family was the C2H2 family, followed by the bZIP and bHLH families. A total of 1718 PKs were predicted, including CaMK, CDPK, MAPK and RLK. WGCNA revealed that the DEGs in the blue, brown, dark magenta and light steel blue 1 modules were associated with the physiological changes in roots of switchgrass under alkaline salt stress. The consistency between the qRT-PCR and RNA-Seq results confirmed the reliability of the RNA-seq sequencing data. A molecular regulatory network of the switchgrass response to alkaline salt stress was preliminarily constructed on the basis of transcriptional regulation and functional genes. Conclusions: Alkaline salt tolerance of switchgrass may be achieved by the regulation of ion homeostasis, transport proteins, detoxification, heat shock proteins, dehydration and sugar metabolism. These findings provide a comprehensive analysis of gene expression dynamic and act network induced by alkaline salt stress in two switchgrass genotypes and contribute to the understanding of the alkaline salt tolerance mechanism of switchgrass and the improvement of switchgrass germplasm.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

Salt supplementation-induced metabolic reprogramming in Streptomyces coelicolor

Members of the genus Streptomyces are major producers of a wide variety of secondary metabolites that serve as bioactive compounds. Many secondary metabolites are produced in response to environmental signals such as biotic and abiotic stresses. In this study, we identified salt supplementation as one of the stimuli activating secondary metabolism in the model Streptomyces species, Streptomyces coelicolor. Comparative metabolomics revealed overproduction of several known secondary metabolites, most notably undecylprodigiosin and coelimycin P1, in addition to their biosynthetic intermediates and derivatives, as well as many unknown metabolites. Transcriptomic analysis revealed activation of diverse biological processes including cation uptake, compatible solute production, and the phosphate limitation stress response through conserved and species-specific mechanisms, presumably to overcome the increased salinity. This response leads to activation of a variety of regulatory and metabolic pathways required for production of secondary metabolites including activation of conserved metabolic pathways for energy and substrate supply and species-specific secondary metabolite biosynthetic gene clusters. Furthermore, several promoter sequences contributing to upregulation of secondary metabolism induced by salt supplementation were identified. Overall, our data show how S. coelicolor copes with the increased salinity and tailors the cellular metabolism toward secondary metabolism in a conserved and species-specific manner.

Otani, Hiroshi [USDOE Joint Genome Institute (JGI)↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗