Search NASA⌕ Search

SEARCH · Search NASA

Results for “Transient Expression”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 127 records · Page 7
All sourcesNASA NTRSDOE OSTI
DOE OSTI2023

DQ Admittance Extraction for Inverter-Based Resources: Preprint

The power grid industry is pushing for electro-magnetic transient (EMT)-based studies for generation interconnection and planning process due to high penetrations of inverter-based resource (IBRs). Vendor-specific and site-specific black-box IBR models are preferred in those simulation studies. For small-signal analysis, measurement-based admittance models are necessary. In this paper, we demonstrate the extraction of frequency-domain dq frame IBR models. These linear models are specific to operating conditions. We demonstrate two extraction methods: frequency scan and a step response-based method. The latter relies on converting time-domain responses to Laplace-domain expressions via eigensystem realization analysis (ERA). Both can lead to dq admittance representation and the latter is time saving.

admittance model↗
DOE OSTI2025

Additional considerations in analytical solution for time-dependent heat conduction in a three-dimensional multilayer sphere

This work presents an analytical method to solve the heat conduction equation in three dimensions for problems consisting of multilayer concentric spheres. The method can be used to treat time-varying heat conduction problems where the heat source that drives the transient is time-invariant. Equally applicable to all Poisson-type problems with concentric spherical geometry, the method consists of representing the solution as a summation of weighted eigenfunctions. The weights for each eigenfunction are computed algebraically. Previous work has already established the core constituents of the methodology. The current work augments the existing methods by including consideration of nonzero interface resistance between layers and explicit discussion on the boundary condition homogenization required to treat inhomogeneous problems. Also, two demonstration problems are presented. One demonstration problem is based on the method of manufactured solutions and therefore allows for comparison with exact expressions for the solution temperature distribution. The second, more complex, demonstration problem relies on the finite element method for comparisons. The expected convergence behavior is observed for both demonstration problems.

97 - MATHEMATICS AND COMPUTING↗
DOE OSTI2022

Modeling Down Syndrome Myeloid Leukemia by Sequential Introduction of GATA1 and STAG2 Mutations in Induced Pluripotent Stem Cells with Trisomy 21

Children with Down syndrome (DS) have a high risk for acute myeloid leukemia (DS-ML). Genomic characterization of DS-ML blasts showed the presence of unique mutations in GATA1, an essential hematopoietic transcription factor, leading to the production of a truncated from of GATA1 (GATA1s). GATA1s, together with trisomy 21, is sufficient to develop a pre-leukemic condition called transient abnormal myelopoiesis (TAM). Approximately 30% of these cases progress into DS-ML by acquisition of additional somatic mutations in a stepwise manner. We previously developed a model for TAM by introducing disease-specific GATA1 mutation in trisomy 21-induced pluripotent stem cells (iPSCs), leading to the production of N-terminally truncated short form of GATA1 (GATA1s). In this model, we used CRISPR/Cas9 to introduce a co-operating mutation in STAG2, a member of the cohesin complex recurrently mutated in DS-ML but not in TAM. Hematopoietic differentiation of GATA1 STAG2 double-mutant iPSC lines confirmed GATA1s expression and the loss of functional STAG2 protein, leading to enhanced production of immature megakaryocytic population compared to GATA1 mutant alone. Megakaryocyte-specific lineage expansion of the double-mutant HSPCs exhibited close resemblance to the DS-ML immunophenotype. Transcriptome analysis showed that GATA1 mutation resulted in downregulation of megakaryocytic and erythrocytic differentiation pathways and interferon α/β signaling, along with an upregulation of pathways promoting myeloid differentiation such as toll-like receptor cascade. The co-occurrence of STAG2 knockout partially reverted the expression of genes involved in myeloid differentiation, likely leading to enhanced self-renewal and promoting leukemogenesis. In conclusion, we developed a DS-ML model via hematopoietic differentiation of gene-targeted iPSCs bearing trisomy 21.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Reductive Dynamic and Static Excited State Quenching of a Homoleptic Ruthenium Complex Bearing Aldehyde Groups

A new homoleptic Ru polypyridyl complex bearing two aldehyde groups on each bipyridine ligand, [Ru(dab) 3 ](PF 6 ) 2 , where dab is 4,4′-dicarbaldehyde-2,2′-bipyridine, was synthesized, characterized, and utilized for iodide photo-oxidation studies. In acetonitrile (CH 3 CN) solution, the complex displayed an intense metal-to-ligand charge transfer (MLCT) absorbance maximum at 475 nm (ε = 22,000 M –1 cm –1 ) and an infrared (IR) band at 1712 cm –1 assigned to the pendent aldehyde groups. Visible light excitation in air-saturated solution resulted in room temperature photoluminescence (PL) with a maximum at 675 nm, a quantum yield, ϕ PL = 0.048, and an excited state lifetime, τ ο = 440 ns, from which radiative and nonradiative relaxation rate constants were extracted, k r = 9.1 × 10 4 s –1 and knr = 1.8 × 10 6 s –1 . Pulsed visible light excitation yielded transient UV–vis and IR absorption spectra consistent with an MLCT excited state; relaxation occurred with the maintenance of two isosbestic points in the visible region, and a lifetime that agreed with that measured by time-resolved PL. Cyclic voltammetry studies in a CH 3 CN solution with 0.1 M TBAPF 6 electrolyte revealed a quasi-reversible oxidation, E°(Ru III/II ) = +1.25 V vs. Fc +/0 , and three sequential one-electron reductions at −1.10, −1.25, and −1.54 V vs. Fc +/0 . Here, an excited state reduction potential of E°(Ru *2+/+ ) = +0.89 V vs. Fc +/0 was estimated with the Rehm–Weller expression. Titration of tetrabutylammonium iodide, TBAI, into a CD 3 CN solution of [Ru(dab) 3 ](PF 6 ) 2 resulted in significant shifts in the aldehyde H atom and 3,3′-biypridyl resonances that were analyzed with a 1:1 equilibrium model, from which K eq = 460 M –1 was extracted, increasing to 5800 M –1 when the solvent was changed to acetone-d 6 . Iodide titrations resulted in a significant quenching of the [Ru(dab) 3 ] *2+ lifetime and quantum yield in both CH 3 CN and acetone solvents. In CH 3 CN, the quenching was mainly dynamic and well described by the Stern–Volmer model, from which a quenching rate constant, k q , of 4.5 × 10 10 M –1 s –1 and an equilibrium constant, K eq , of 8.3 × 10 3 M –1 were obtained. In acetone, the static quenching pathway by iodide was greatly enhanced, with a K eq of 1.2 × 10 4 M –1 and a higher k q of 9.2 × 10 10 M –1 s –1 .

Aldehydes↗
DOE OSTI2024

Non-equilibrium rate theory for polariton relaxation dynamics

We derive an analytic expression of the non-equilibrium Fermi’s golden rule (NE-FGR) expression for a Holstein–Tavis–Cumming Hamiltonian, a universal model for many molecules collectively coupled to the optical cavity. These NE-FGR expressions capture the full-time-dependent behavior of the rate constant for transitions from polariton states to dark states. The rate is shown to be reduced to the well-known frequency domain-based equilibrium Fermi’s golden rule (E-FGR) expression in the equilibrium and collective limit and is shown to retain the same scaling with the number of sites in non-equilibrium and non-collective cases. We use these NE-FGR to perform population dynamics with a time-non-local and time-local quantum master equation and obtain accurate population dynamics from the initially occupied upper or lower polariton states. Furthermore, NE-FGR significantly improves the accuracy of the population dynamics when starting from the lower polariton compared to the E-FGR theory, highlighting the importance of the non-Markovian behavior and the short-time transient behavior in the transition rate constant.

Chemical dynamics↗
DOE OSTI2025

Bipolar transport in diamond under photo-excitation: Evidence of free charge scattering by excitons

The fundamental characteristics of the Coulomb e-h interactions in ultra-pure diamond are investigated through time-resolved photoconductivity measurements in homogeneously photoexcited samples with ohmic-like low resistive B + sandwich contacts. Here, we demonstrate that, in the electric field, the bipolar charge mobility exhibits drastic reduction for photo-injected densities of 10 14 ‐10 16 cm ‐3 that cannot be explained only by mutual scattering between free e-h particles. This phenomenon is clarified by adding scattering caused by excitons whose density grows in the photo-exited system. The comparison of drift mobilities at 300 K in diamond obtained in this study and in pure Si and Ge obtained from literature, where exciton scattering is insignificant, is presented. We derive the empirical expression for the density dependences of bipolar mobility for the electric fields up to 1 kV/cm that could be useful for the development of diamond electronic devices.

Bipolar drift↗
DOE OSTI2023

Atp7b-dependent choroid plexus dysfunction causes transient copper deficit and metabolic changes in the developing mouse brain

Copper (Cu) has a multifaceted role in brain development, function, and metabolism. Two homologous Cu transporters, Atp7a (Menkes disease protein) and Atp7b (Wilson disease protein), maintain Cu homeostasis in the tissue. Atp7a mediates Cu entry into the brain and activates Cu-dependent enzymes, whereas the role of Atp7b is less clear. We show that during postnatal development Atp7b is necessary for normal morphology and function of choroid plexus (ChPl). Inactivation of Atp7b causes reorganization of ChPl’ cytoskeleton and cell-cell contacts, loss of Slc31a1 from the apical membrane, and a decrease in the length and number of microvilli and cilia. In ChPl lacking Atp7b, Atp7a is upregulated but remains intracellular, which limits Cu transport into the brain and results in significant Cu deficit, which is reversed only in older animals. Cu deficiency is associated with down-regulation of Atp7a in locus coeruleus and catecholamine imbalance, despite normal expression of dopamine-β-hydroxylase. In addition, there are notable changes in the brain lipidome, which can be attributed to inhibition of diacylglyceride-to-phosphatidylethanolamine conversion. These results identify the new role for Atp7b in developing brain and identify metabolic changes that could be exacerbated by Cu chelation therapy.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Combining genome-wide association studies and expression quantitative trait nucleotide mapping with molecular and genetic validations to identify transcriptional networks regulating drought tolerance in Populus

Objectives: (i). To deploy a large-scale experimental drought trial for up to 1000 unique genotypes of Populus equipping the sites with controlled irrigation and drought treatments that are fully automated and monitored. FULLY COMPLETED (ii) To test the hypothesis that a suite of traits identified for drought tolerance in P. nigra can be measured in drought and control treatments in the wide germplasm collection of P. trichocarpa. FULLY COMPLETED (iii) To use established and novel GWAS model approaches to identify gene loci linked to drought tolerance traits on interest in P. trichocarpa. FULLY COMPLETED (iv) To undertake comparative analysis of GWAS results for drought tolerance traits in P. nigra and P. trichocarpa. PARTIALLY COMPLETED – remains active (v) Using RNAseq in P. trichocarpa, in droughted and control treatments to identify cis- and trans-regulated eQTN. FULLY COMPLETED (vi) Validate up to 50 cis-QTNs, from network hubs using transient protoplast assays. FULLY COMPLETED (vii) To establish Agrobacterium-based gene editing protocols in Populus. FULLY COMPLETED (viii) To utilize early leads from previous research to investigate at least 6 candidate genes for drought tolerance in Populus. FULLY COMPLETED (ix) To validate up to 20 candidate genes for drought tolerance in P. trichocarpa refined from the long-list tested in the transient assays for cis-acting hub gene targets. PARTIALLY COMPLETED- remains active.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2022

Kinetic Model for Moisture-Controlled CO 2 Sorption

The understanding of the sorption/desorption kinetics is essential for practical applications of moisture-controlled CO 2 sorption. We introduce an analytic model of the kinetics of moisture-controlled CO 2 sorption and its interpretation in two limiting cases. In one case, chemical reaction kinetics on pore surfaces dominates, in the other case, diffusive transport through the sorbent defines the kinetics. Here, we show that reaction kinetics, which is dominant in the first case, can be expressed as a linear combination of 1st and 2nd order kinetics in agreement with the static isotherm equation derived and validated in a previous paper. The interior transport kinetics can be described by non-linear diffusion equations. By combining all carbon species into a single equation, we can eliminate — in certain limits — the source terms associated with chemical reactions. In this case, the governing equation is ∂θ/∂t = –∇ · (–D eff ∇ θ ). For a sorbent in a form of a flat sheet or a membrane, one can maintain the same functional form of a diffusion equation by introducing a generalized effective diffusivity D M that combines contributions from both surface chemical reaction kinetics and interior diffusive transport kinetics. Experimental data of transient CO 2 flux in a preconditioned commercial anion exchange membrane fit well to the 1st order model as long as very dry states are avoided, validating the theory. The observed DM for a preconditioned commercial anion exchange membrane ranges from 6.6× 10 -14 to 7.1× 10 -14 m 2 s -1 at 35°C. These small values compared to typical ionic diffusivities imply a very slow kinetics, which will be the largest issue that needs to be addressed for practical application. The collected transient CO 2 flux data are used to predict the magnitude of a continuous CO 2 pumping flux in an active membrane that transports CO 2 against a CO 2 concentration gradient. The pumped CO 2 flux is supported by water flux due to a water concentration gradient.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2021

Analysis and design of DC-link capacitor in cascaded H-bridge multilevel active front-end converter

Medium-voltage grid-tied systems often use a cascaded H-bridge multi-level active front-end. In this converter, dc link bus capacitors play an important role in stabilizing the converter and enabling both active and reactive power injections. The present work provides analytical expressions for the capacitor current, which are essential for optimizing system design (especially capacitor size vs. lifetime). Then, the expression is incorporated into the grid connected bidirectional power system model. Consequently, this work contributes to the guiding principles to choose accurate dc link capacitor ratings against grid-side power delivery requirements. DC-link capacitors come with an expiration date which is dependent on the operating power and voltage values. Lack of information about the lifetime of the dc-link capacitor creates uncertainty in the duration of online operation of the converter, thus increasing the probability of a contingency outage. The lifetime of the capacitor can range from only a few seconds of online operation of the station due to under-sizing, to a compromised quality of power flowing through other solid state devices which may not have been designed for the transients that are caused by over-sizing of the dc-link capacitor. A better estimate of the lifetime of these capacitors can help maximize usage and maintain scheduled outages more efficiently, without disruption in service.

24 POWER TRANSMISSION AND DISTRIBUTION↗
DOE OSTI2025

Kölliker's Organ Functions as a Developmental Hub in Mouse Cochlea Regulating Spiral Limbus and Tectorial Membrane Development

Kölliker's organ is a transient developmental structure in the mouse cochlea that undergoes significant remodeling postnatally. Utilizing an epithelial-specific conditional deletion mouse model of Prdm16 (marker and regulator of Kölliker's organ), we show that Prdm16 is required for interdental cell development, and thereby the development of the limbal domain of the tectorial membrane and its medial anchorage to the spiral limbus. Additionally, we show that Kölliker's organ is involved in normal tectorial membrane collagen fibril development and maturation. Interestingly, mesenchymal cells of the spiral limbus underneath Prdm16 -deficient Kölliker's organ failed to produce interstitial matrix proteins, resulting in a hypoplastic and truncated spiral limbus, indicating a non-cell autonomous role of Prdm16 in regulating spiral mesenchymal matrix development. Single-cell RNA sequencing identified differentially expressed genes in Prdm16 -deficient Kölliker's organ suggesting a role for connective tissue growth factor (CTGF) downstream Prdm16 in epithelial-mesenchymal signaling involved in spiral limbus matrix deposition. Prdm16 -deficient mice showed a hearing deficit, as indicated by elevated auditory brainstem response thresholds at most frequencies, consistent with the cochlear structural defects. Both sexes were studied. This work establishes Prdm16 as a deafness gene in mice through its role in regulating Kölliker's organ development. Such understanding recognizes Kölliker's organ as a developmental hub regulating multiple surrounding cochlear structures.

Zhang, Hongji↗
DOE OSTI2020

A self-adjusting platinum surface for acetone hydrogenation

We show that platinum displays a self-adjusting surface that is active for the hydrogenation of acetone over a wide range of reaction conditions. Reaction kinetics measurements under steady-state and transient conditions at temperatures near 350 K, electronic structure calculations employing density-functional theory, and microkinetic modeling were employed to study this behavior over supported platinum catalysts. The importance of surface coverage effects was highlighted by evaluating the transient response of isopropanol formation following either removal of the reactant ketone from the feed, or its substitution with a similarly structured species. The extent to which adsorbed intermediates that lead to the formation of isopropanol were removed from the catalytic surface was observed to be higher following ketone substitution in comparison to its removal, indicating that surface species leading to isopropanol become more strongly adsorbed on the surface as the coverage decreases during the desorption experiment. This phenomenon occurs as a result of adsorbate–adsorbate repulsive interactions on the catalyst surface which adjust with respect to the reaction conditions. Reaction kinetics parameters obtained experimentally were in agreement with those predicted by microkinetic modeling when the binding energies, activation energies, and entropies of adsorbed species and transition states were expressed as a function of surface coverage of the most abundant surface intermediate (MASI, C 3 H 6 OH*). It is important that these effects of surface coverage be incorporated dynamically in the microkinetic model (e.g., using the Bragg–Williams approximation) to describe the experimental data over a wide range of acetone partial pressures.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2025

Nanoparticle-mediated antagonism of sustained endosomal signaling of the calcitonin receptor-like receptor provides enhanced and persistent relief of oral cancer pain

By improving the delivery and tumor retention of chemotherapeutics, nanomedicines hold potential for cancer treatment. The usefulness of nanoparticle (NP)-encapsulated analgesics for the cancer pain treatment is comparatively unexplored. We investigated whether NPs encapsulating olcegepant (OCP), an antagonist of the calcitonin receptor-like receptor (CLR) for the calcitonin gene-related peptide (CGRP), effectively relieved oral cancer pain in mice. Because persistent endosomal CLR signaling in Schwann cells mediates craniofacial pain, we reasoned that the predisposition of NPs to accumulate in endosomes could be leveraged to effectively relieve oral cancer pain. By expressing biosensors for activated CLR, Gα proteins and β-arrestins in HEK293T and Schwann cells, we found that CGRP activates CLR signaling first at the plasma membrane and then in early, late and recycling endosomes and the cis- and trans-Golgi apparatus. We synthesized biocompatible NPs encapsulating OCP and fluorophores by integrating hydrophobic ion pairing nanoformulation with Flash NanoPrecipitation. NPs slowly released OCP and accumulated in early endosomes, leading to sustained inhibition of endosomal CLR signaling in HEK293T and Schwann cells. Oral cancers were established in mice, which led to heightened pain-like responses. After intra-tumoral injection, NPs were retained in tumors for at least one week. OCP-loaded NPs almost completely reversed allodynia and hyperalgesia for a prolonged period, whereas unencapsulated OCP had small and transient effects. The NP accumulation in endosomal sites of pain signaling, the sustained release of antagonist, and the retention of NPs in tumors explain their beneficial actions. Thus, NP-encapsulation holds promise for the relief of painful cancers that are inadequately treated by opioids.

Calcitonin gene-related peptide↗
DOE OSTI2021

Theory of subcycle time-resolved photoemission: Application to terahertz photodressing in graphene

Here, motivated by recent experimental progress we revisit the theory of pump–probe time- and angle-resolved photoemission spectroscopy (trARPES), which is one of the most powerful techniques to trace transient pump-driven modifications of the electronic properties. The pump-induced dynamics can be described in different gauges for the light–matter interaction. Standard minimal coupling leads to the velocity gauge, defined by linear coupling to the vector potential. In the context of tight-binding (TB) models, the Peierls substitution is the commonly employed scheme for single-band models. Multi-orbital extensions – including the coupling of the dipole moments to the electric field – have been introduced and tested recently. In this work, we derive the theory of time-resolved photoemission within both gauges from the perspective of nonequilibrium Green’s functions. This approach naturally incorporates the photoelectron continuum, which allows for a direct calculation of the observable photocurrent. Following this route we introduce gauge-invariant expressions for the time-resolved photoemission signal. The theory is applied to graphene pumped with short terahertz pulses, which we treat within a first-principles TB model. We investigate the gauge invariance and discuss typical effects observed in subcycle time-resolved photoemission. Our formalism is an ideal starting point for realistic trARPES simulations including scattering effects.

72 PHYSICS OF ELEMENTARY PARTICLES AND FIELDS↗
DOE OSTI2024

Dynamics and activity of an ammonia-oxidizing archaea bloom in South San Francisco Bay

Abstract Transient or recurring blooms of ammonia-oxidizing archaea (AOA) have been reported in several estuarine and coastal environments, including recent observations of AOA blooms in South San Francisco Bay. Here, we measured nitrification rates, quantified AOA abundance, and analyzed both metagenomic and metatranscriptomic data to examine the dynamics and activity of nitrifying microorganisms over the course of an AOA bloom in South San Francisco Bay during the autumn of 2018 and seasonally throughout 2019. Nitrification rates were correlated with AOA abundance in quantitative polymerase chain reaction (PCR) data, and both increased several orders of magnitude between the autumn AOA bloom and spring and summer seasons. From bloom samples, we recovered an extremely abundant, high-quality Candidatus Nitrosomarinus catalina-like AOA metagenome-assembled genome that had high transcript abundance during the bloom and expressed >80% of genes in its genome. We also recovered a putative nitrite-oxidizing bacteria metagenome-assembled genome from within the Nitrospinaceae that was of much lower abundance and had lower transcript abundance than AOA. During the AOA bloom, we observed increased transcript abundance for nitrogen uptake and oxidative stress genes in non-nitrifier metagenome-assembled genomes. This study confirms AOA are not only abundant but also highly active during blooms oxidizing large amounts of ammonia to nitrite—a key intermediate in the microbial nitrogen cycle—and producing reactive compounds that may impact other members of the microbial community.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Dual Photoluminescence in Low-Temperature Phase of CsSnI 3 Nanocrystals

The expression of metal lone-pair electrons is hypothesized to underpin many of the interesting properties of inorganic halide perovskite semiconductors. Recently, a stable low-temperature monoclinic polar phase was predicted for CsSnBr 3 and CsSnI 3 , opening the possibility of direct investigation of a ferroelectric distorted structure compared to the undistorted structure. To date, there have been no experimental reports of such a structure in CsSnI 3 , and the low-temperature optical properties of CsSnI 3 nanocrystals have remained unexplored. Here we report optical and structural evidence of a phase transition around 240 K in 8.9 nm CsSnI 3 nanocrystals. Several changes in optical behavior occur below this transition point, including high-energy photoluminescence (PL) that emits concurrently with the exciton PL. The emergence of this high-energy PL is correlated with X-ray diffraction (XRD) and differential scanning calorimetry (DSC) supporting a phase transition from the orthorhombic structure between 240-200 K. Transient absorption measurements show an increase in the excited state lifetimes, i.e., slowed carrier cooling, at 200 K when photoexciting with photon energies above the high-energy state, consistent with slowed carrier cooling and emergence of high-energy PL. We hypothesize that the slowed carrier cooling is distinctive to this phase transition that modifies both the electronic and phonon structures that dictate excited-state carrier dynamics, and we discuss these changes.

14 SOLAR ENERGY↗
DOE OSTI2022

Network Uncertainty Quantification for Analysis of Multi-Component Systems

To impact physical mechanical system design decisions and realize the full promise of high-fidelity computational tools, simulation results must be integrated at the earliest stages of the design process. This is particularly challenging when dealing with uncertainty and optimizing for system-level performance metrics, as full-system models (often notoriously expensive and time-consuming to develop) are generally required to propagate uncertainties to system-level quantities of interest. Methods for propagating parameter and boundary condition uncertainty in networks of interconnected components hold promise for enabling design under uncertainty in real-world applications. These methods avoid the need for time consuming mesh generation of full-system geometries when changes are made to components or subassemblies. Additionally, they explicitly tie full-system model predictions to component/subassembly validation data which is valuable for qualification. These methods work by leveraging the fact that many engineered systems are inherently modular, being comprised of a hierarchy of components and subassemblies that are individually modified or replaced to define new system designs. By doing so, these methods enable rapid model development and the incorporation of uncertainty quantification earlier in the design process. The resulting formulation of the uncertainty propagation problem is iterative. We express the system model as a network of interconnected component models, which exchange solution information at component boundaries. We present a pair of approaches for propagating uncertainty in this type of decomposed system and provide implementations in the form of an open-source software library. We demonstrate these tools on a variety of applications and demonstrate the impact of problem-specific details on the performance and accuracy of the resulting UQ analysis. This work represents the most comprehensive investigation of these network uncertainty propagation methods to date.

42 ENGINEERING↗