SEARCH · Search NASA

Results for “Green”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 145 records · Page 8

All sources NASA NTRS DOE OSTI

DOE OSTI2023

Green-Solvent Processed Blade-Coating Organic Solar Cells with an Efficiency Approaching 19% Enabled by Alkyl-Tailored Acceptors

Power-conversion-efficiencies (PCEs) of organic solar cells (OSCs) in laboratory, normally processed by spin-coating technology with toxic halogenated solvents, have reached over 19%. However, there is usually a marked PCE drop when the blade-coating and/or green-solvents toward large-scale printing are used instead, which hampers the practical development of OSCs. Here, a new series of N-alkyl-tailored small molecule acceptors named YR-SeNF with a same molecular main backbone are developed by combining selenium-fused central-core and naphthalene-fused end-group. Thanks to the N-alkyl engineering, NIR-absorbing YR-SeNF series show different crystallinity, packing patterns, and miscibility with polymeric donor. The studies exhibit that the molecular packing, crystallinity, and vertical distribution of active layer morphologies are well optimized by introducing newly designed guest acceptor associated with tailored N-alkyl chains, providing the improved charge transfer dynamics and stability for the PM6:L8-BO:YR-SeNF-based OSCs. As a result, a record-high PCE approaching 19% is achieved in the blade-coating OSCs fabricated from a green-solvent o-xylene with high-boiling point. Notably, ternary OSCs offer robust operating stability under maximum-power-point tracking and well-keep > 80% of the initial PCEs for even over 400 h. Our alkyl-tailored guest acceptor strategy provides a unique approach to develop green-solvent and blade-coating processed high-efficiency and operating stable OSCs, which paves a way for industrial development.

14 SOLAR ENERGY↗

DOE OSTI2025

A Green’s function fast multipole method for computation of micromechanical fields in heterogeneous materials

Computation of micromechanical fields in heterogeneous materials is usually performed using either the finite element method or the Green’s function method based on FFTs. The finite element method allows for accurate discretization and for non-periodic boundary conditions but is computationally expensive. On the other hand, the FFT-based method is computationally efficient but requires discretization on a regular grid of hexahedral voxels. In this paper, a Green’s function method allowing for accurate discretization using tetrahedral elements and for non-periodic boundary conditions is proposed. The convolution is computed using the fast multipole method, which provides good accuracy even for low-order expansion due to the fast decay of interactions between elements. The proposed Green’s function fast multipole method is verified by comparison with analytical and FFT-based solutions. Furthermore, the computational time is analyzed and compared to the FFT-based method for non-periodic convolution. Finally, effective properties of an elastic polycrystalline microstructure containing thin intergranular cracks are computed and analyzed.

36 MATERIALS SCIENCE↗

DOE OSTI2025

Screening green solvents for multilayer plastic film recycling processes

Multilayer (ML) plastic films are essential packaging materials that help protect products from diverse external factors; however, only 5% of all ML films are recycled in the United States. Solvent-based technologies are a promising alternative for recycling ML films because they enable recovery of constituent polymer resins. For example, the Solvent Targeted Recovery and Precipitation (STRAPTM) process sequentially dissolves and separates polymer components using a series of targeted solvent washes. A crucial design aspect of this process is the impact of selected solvents on human health and on the environment. Here, this work introduces a computational framework that integrates molecular modeling, process modeling, techno-economic analysis (TEA), and life-cycle analysis (LCA) to quickly screen green solvents for solvent-based ML recycling processes. Initial screening for solvents based on selectivity is performed by estimating temperature-dependent solubilities using molecular-scale models. Subsequent screening uses basic estimates of energy use and octanol-water partition coefficients (logP) as key measures of health, safety, and environmental hazards. Detailed process modeling, TEA, and LCA are used on a reduced set of promising solvents identified in early screening steps to more accurately determine how solvent selection and associated operating conditions impact overall economics and environmental impacts. The framework is used for the identification of green solvents (from a database of 1,000 solvents) that separate an industrial ML film composed of polyethylene (PE), ethylene vinyl alcohol (EVOH), and polyethylene terephthalate (PET). Our analysis shows the effectiveness of the framework and reveals fundamental trade-offs between solvent greenness, solubility, and economics. Our work emphasizes the importance of taking a holistic systems view during solvent design and aims to inform the development of new processes for ML film recycling and the identification of new ML films that are easier to recycle.

economics↗

DOE OSTI2024

Identifying Green Solvent Mixtures for Bioproduct Separation Using Bayesian Experimental Design

Liquid–liquid extraction (LLE) is a widely used technique for the separation and purification of liquid-phase products with applications in various industries, including pharmaceuticals, petrochemicals, and renewable chemistry. A critical step in the design of an LLE process is the selection of appropriate solvents. This study presents a new methodology for identifying solvent mixtures for bioproduct separation using Bayesian experimental design (BED). Motivated by the need for environmentally friendly and effective separation methods, we address the challenge of selecting solvent systems that balance separation efficiency, selectivity, and environmental impact while also tackling the difficulty of separating multiple bioproducts using complex solvent systems. Our approach specifically seeks to predict product partition coefficients (log10 Kp values) as thermodynamic parameters underlying solvent selection. The iterative approach integrates Bayesian optimization with experimental measurements to guide solvent selection and leverages COSMO-RS simulations to enhance high-throughput experimentation. Using the design of solvent systems for the separation of lignin-derived aromatic products via centrifugal partition chromatography (CPC) as a case study, we show that within seven iterations/cycles of the methodology, we can identify new mixtures of green solvents that align with CPC design principles. Furthermore, these results demonstrate the efficacy of the BED framework in optimizing green solvent systems for complex separations, highlighting the potential of this method to advance the field of green chemistry and contribute to the development of sustainable industrial processes.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗

DOE OSTI2023

Versatile recognition of graphene layers from optical images under controlled illumination through green channel correlation method

In this study, a simple yet versatile method is proposed for identifying the number of exfoliated graphene layers transferred on an oxide substrate from optical images, utilizing a limited number of input images for training, paired with a more traditional number of a few thousand well-published Github images for testing and predicting. Two thresholding approaches, namely the standard deviation-based approach and the linear regression-based approach, were employed in this study. The method specifically leverages the red, green, and blue color channels of image pixels and creates a correlation between the green channel of the background and the green channel of the various layers of graphene. This method proves to be a feasible alternative to deep learning-based graphene recognition and traditional microscopic analysis. The proposed methodology performs well under conditions where the effect of surrounding light on the graphene-on-oxide sample is minimum and allows rapid identification of the various graphene layers. Here, the study additionally addresses the functionality of the proposed methodology with nonhomogeneous lighting conditions, showcasing successful prediction of graphene layers from images that are lower in quality compared to typically published in literature. In all, the proposed methodology opens up the possibility for the non-destructive identification of graphene layers from optical images by utilizing a new and versatile method that is quick, inexpensive, and works well with fewer images that are not necessarily of high quality.

36 MATERIALS SCIENCE↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2024

Geranylgeranylated-chlorophyll-protein complexes in lhl3 mutant of the green alga Chlamydomonas reinhardtii

Chlorophylls a and b (Chl a and b) are involved in light harvesting, photochemical reactions, and electron transfer reactions in plants and green algae. The core complexes of the photosystems (PSI and PSII) associate with Chl a, while the peripheral antenna complexes (LHCI and LHCII) bind Chls a and b. One of the final steps of Chl biosynthesis is the conversion of geranylgeranylated Chls (Chls GG ) to phytylated Chls by geranylgeranyl reductase (GGR). Here, we isolated and characterized a pale green mutant of the green alga Chlamydomonas reinhardtii that was very photosensitive and was unable to grow photoautotrophically. This mutant has a 16-bp deletion in the LHL3 gene, which resulted in the loss of LHL3 and GGR and accumulated only Chls GG . The lhl3 mutant cells grown in the dark accumulated PSII and PSI proteins at 25–50% of WT levels, lacked PSII activity, and retained a decreased PSI activity. The PSII and PSI proteins were depleted to trace amounts in the mutant cells grown in light. In contrast, the accumulation of LHCI and LHCII was unaffected except for LHCA3. Our results suggest that the replacement of Chls with Chls GG strongly affects the structural and functional integrity of PSII and PSI complexes but their associating LHC complexes to a lesser extent. Affinity purification of HA-tagged LHL3 confirmed the formation of a stable LHL3-GGR complex, which is vital for GGR stability. The LHL3-GGR complex contained a small amount of PSI complex assembly factors, suggesting a putative coupling between Chl synthesis and PSI complex assembly.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2026

Multiscale Neural Networks for Approximating Green’s Functions

Neural networks (NNs) have been widely used to solve partial differential equations (PDEs) in the applications of physics, biology, and engineering. One effective approach for solving PDEs with a fixed differential operator is learning Green’s functions. However, Green’s functions are notoriously difficult to learn due to their poor regularity, which typically requires larger NNs and longer training times. In this work, we address these challenges by leveraging multiscale NNs to learn Green’s functions. Through theoretical analysis using multiscale Barron space methods and experimental validation, we show that the multiscale approach significantly reduces the necessary NN size and accelerates training.

97 MATHEMATICS AND COMPUTING↗

DOE OSTI2024

Silicate coprecipitation reduces green rust crystal size and limits dissolution-precipitation during air oxidation

Green rusts (GR) are mixed-valence iron (Fe) hydroxides which form in reducing redox environments like riparian and wetland soils and shallow groundwater. In these environments, silicon (Si) can influence Fe oxides’ chemical and physical properties but its role in GR formation and subsequent oxidative transformation have not been studied starting at initial nucleation. Green rust sulfate [GR(SO 4 )] and green rust carbonate [GR(CO 3 )] were both coprecipitated from salts by base titration in increasing % mol Si (0, 1, 10, and 50). The minerals were characterized before and after rapid (24 h) aqueous air-oxidation by x-ray diffraction (XRD), scanning electron microscopy (SEM), Fe extended x-ray absorption fine structure spectroscopy (EXAFS), and N 2 -BET surface area. Results showed that only GR(SO4) or GR(CO3) was formed at every tested Si concentration. Increasing % mol Si caused decreased plate size and increased surface area in GR(CO3) but not GR(SO4). GR plate basal thickness was not changed at any condition indicating a lack of Si interlayering. Air oxidation of GR(SO4) at all % mol Si contents transformed by dissolution and reprecipitation into lepidocrocite and goethite, favoring ferrihydrite with higher % Si content. Air oxidation of GR(CO3) transformed into magnetite and goethite but increasing Si caused GR to oxidize while retaining its hexagonal plate structure via solid-state oxidation. Our results indicate that Si has the potential to cause GR to form in smaller particles and upon air oxidation, Si can either stabilize the plate structure or alter transformation to ferrihydrite.

36 MATERIALS SCIENCE↗

DOE OSTI2023

Perspectives on future research directions in green manufacturing for discrete products

With the increasing concern due to climate change caused by a higher atmospheric concentration of CO 2 and other greenhouse gases, reducing environmental impact is becoming more important for every part of society. Manufacturing is responsible for a significant amount of energy/material consumption and environmental burden and, therefore, has a great opportunity to reduce its impact through green manufacturing. Green manufacturing presents opportunities across the manufacturing enterprise to increase the efficient usage of energy and material resources. These opportunities include designing products to consume fewer materials and energy during manufacturing and use, incorporating more efficient manufacturing processes, streamlining and optimizing manufacturing schedules and plans, and circularizing products. The goal of this paper will be to provide a perspective from the authors on the opportunities that exist within green manufacturing for discrete products through a review of pertinent topics and future directions. The paper will focus on processes, manufacturing equipment, manufacturing systems, recovering value at a product’s end-of-life, and additional thoughts that include metrics and indicators, techno-economic assessment, and a discussion of efficiency and effectiveness. Key findings from this review include a need for social indicators and renewable energy considerations in scheduling and process planning, integrating Industry 4.0 into circular economy along with social and institutional dimensions, consistency in the ability to measure and conceptualize metrics and indicators, a detailed evaluation of the life cycle impacts and cost of Addit Manuf, and more human and environment-oriented considerations for smart manufacturing.

29 ENERGY PLANNING, POLICY, AND ECONOMY↗

DOE OSTI2023

Status and Trends in the U.S. Voluntary Green Power Market (2021 Data)

Voluntary green power, for the purposes of this report, refers to renewable energy procurement by retail electricity customers above state renewable energy mandates. In this report, we present data and key trends for voluntary green power markets, except for a small portion of voluntary purchasing where no data are available. In 2021, about 8 million retail electricity customers procured about 244 million megawatt-hours (MWh) of voluntary green power (Figure ES-1), representing about 27% of all U.S. renewable energy sales, about 39% of non-hydro renewable energy sales, and about 6% of all U.S. retail electricity sales. Most of the remainder of U.S. renewable energy sales reflects renewable energy procured by load-serving entities to comply with state renewable energy mandates, also known as compliance-based procurement.

29 ENERGY PLANNING, POLICY, AND ECONOMY↗

DOE OSTI2023

Defects go green: using defects in nanomaterials for renewable energy and environmental sustainability

Induction of point defects in nanomaterials can bestow upon them entirely new physics or augment their pre-existing physical properties, thereby expanding their potential use in green energy technology. Predicting structure-property relationships for defects a priori is challenging, and developing methods for precise control of defect type, density, or structural distribution during synthesis is an even more formidable task. Hence, tuning the defect structure to tailor nanomaterials for enhanced device performance remains an underutilized tool in materials design. We review here the state of nanomaterial design through the lens of computational prediction of defect properties for green energy technology, and synthesis methods to control defect formation for optimal performance. We illustrate the efficacy of defect-focused approaches for refining nanomaterial physics by describing several specific applications where these techniques hold potential. Most notably, we focus on quantum dots for reabsorption-free solar windows and net-zero emission buildings, oxide cathodes for high energy density lithium-ion batteries and electric vehicles, and transition metal dichalcogenides for electrocatalytic green hydrogen production and carbon-free fuels.

14 SOLAR ENERGY↗

NASA NTRS2014

Green Propellant Infusion Mission Program Development and Technology Maturation

The NASA Space Technology Mission Directorate's (STMD) Green Propellant Infusion Mission (GPIM) Technology Demonstration Mission (TDM) is comprised of a cross-cutting team of domestic spacecraft propulsion and storable green propellant technology experts. This TDM is led by Ball Aerospace & Technologies Corp. (BATC), who will use their BCP- 100 spacecraft to carry a propulsion system payload consisting of one 22 N thruster for primary divert (DeltaV) maneuvers and four 1 N thrusters for attitude control, in a flight demonstration of the AF-M315E technology. The GPIM project has technology infusion team members from all three major market sectors: Industry, NASA, and the Department of Defense (DoD). The GPIM project team includes BATC, includes Aerojet Rocketdyne (AR), Air Force Research Laboratory, Aerospace Systems Directorate, Edwards AFB (AFRL), NASA Glenn Research Center (GRC), NASA Kennedy Space Center (KSC), and NASA Goddard Space Flight Center (GSFC). STMD programmatic and technology oversight is provided by NASA Marshall Space Flight Center. The GPIM project shall fly an operational AF-M315E green propulsion subsystem on a Ball-built BCP-100 spacecraft.

AF-M315E↗

NASA NTRS2014

Amazon Forests Maintain Consistent Canopy Structure and Greenness During the Dry Season

The seasonality of sunlight and rainfall regulates net primary production in tropical forests. Previous studies have suggested that light is more limiting than water for tropical forest productivity, consistent with greening of Amazon forests during the dry season in satellite data.We evaluated four potential mechanisms for the seasonal green-up phenomenon, including increases in leaf area or leaf reflectance, using a sophisticated radiative transfer model and independent satellite observations from lidar and optical sensors. Here we show that the apparent green up of Amazon forests in optical remote sensing data resulted from seasonal changes in near-infrared reflectance, an artefact of variations in sun-sensor geometry. Correcting this bidirectional reflectance effect eliminated seasonal changes in surface reflectance, consistent with independent lidar observations and model simulations with unchanging canopy properties. The stability of Amazon forest structure and reflectance over seasonal timescales challenges the paradigm of light-limited net primary production in Amazon forests and enhanced forest growth during drought conditions. Correcting optical remote sensing data for artefacts of sun-sensor geometry is essential to isolate the response of global vegetation to seasonal and interannual climate variability.

dry season↗

NASA NTRS2015

Evaluation of Volatile Species in Green Monopropellant Project

NASA is interested in green monopropellants to replace hydrazine in reaction control systems (RCSs). Some current NASA programs require reduced vapor pressure and low toxicity monopropellant (green) and superior performance (specific impulse and density) formulations. Earlier vapor phase studies of a candidate green monopropellant at the NASA White Sands Test Facility (WSTF) showed the presence of a volatile species that warranted further investigation. The purpose of this study was to further characterize the volatile species and to evaluate it. The evaluation was with respect to whether the volatile species was an impurity or how it is formed, and to use that information to examine whether its presence as an impurity can be eliminated during formulation. The evaluation also considered whether formation of the volatile impurity could be prevented while not compromising the propellant. To reduce variables associated with evaluation of the propellant formulation as a whole, a precursor to one of the individual components in the propellant formulation was subjected to a NASA Standard 6001B Flammability, Off-gassing, and Compatibility Requirements and Test Procedures "Determination of Off-gassed Products (Test 7)". Testing took place in the NASA WSTF Molecular Desorption and Analysis Laboratory. One gram of the precursor was placed in a flask within a specimen container. After thermal conditioning for 72 +/- 1 h at 50 +/- 3 deg C (122 +/- 5 deg F), the atmosphere inside the specimen container was analyzed for off-gassed compounds by cryotrap gas chromatography-mass spectrometry (GC-MS) and fixed sample loop GC-flame ionization detection (GC-FID). The specimen container used was glass to minimize potential catalytic surfaces. The identification of compounds was difficult due to the complexity of the vapor phase concentrations and overlapping chromatographic peaks and mass spectra. However, eleven compounds were specifically identified and five compounds or classes of compounds were reported as unidentified. Quantitation of most of the compounds, including unidentified compounds, was as methane. Quantitating compounds or classes of compounds that were detected but for which specific calibration is not established as methane is in accordance with the Test 7 standard protocol. The thermal decomposition temperature of the precursor was significantly higher than the test temperature. Based on thermal decomposition temperature and on an examination of the structure and chemistry of the identified volatile species, the presence of the volatile species appears to be chemically reasonable with respect to the propellant formulation and is at this time attributed to impurities. Further examination of the overall propellant formulation process (including the individual components' synthesis processes) and process quality control (including purity of reagents and possible decomposition reactions) is indicated.

Greene, Benjamin↗

NASA NTRSDate not supplied

Green Run Modal Test of the NASA Space Launch System Core Stage

The Core Stage of the new NASA Space Launch System (SLS) is a 212-foot tall rocket assembly—consisting primarily of two fuel tanks, an engine section, and four RS-25 rocket engines—capable of sending crew and large payloads to the moon and beyond with 1.6 million pounds of thrust. Currently, the Core Stage is in the B2 Test Stand at Stennis Space Center, undergoing a series of structural and functional tests, designated the Green Run test series. The ultimate goal of Green Run is to verify analytical models and confirm proper subsystem operation of the Core Stage. In January 2020, Green Run testing began with an experimental modal analysis test performed by the Marshal Space Flight Center modal test team. The desired free boundary condition of the Core Stage was achieved by suspending the massive spacecraft from the B2 Test Stand crane. Modal excitation was provided by a pair of 250-lb electro-dynamic shakers for multi-shaker random vibration testing, as well as a 12-pound impact hammer for impact testing. Modal response was measured with 550 accelerometers channels distributed on both the Core Stage and the B2 Test Stand crane. Following one very long night of testing, frequency response functions were calculated from the measured time histories in the target mode frequency range of 2.5 Hz to 15 Hz, and mode shapes, frequencies, and damping values were successfully extracted. The case-study presented in this paper will discuss the SLS Core Stage, the modal test setup and procedure, as well as a brief overview of the test results. Challenges associated with testing such a large, suspended structure in an outdoor environment will be discussed as well.

Green Run↗

NASA NTRSDate not supplied

Influence of the Mid-Holocene Green Sahara on South American Climate

Paleoclimatic data from pollen, speleothem and sedimentary records indicate a weakening of the South American Monsoon in the mid-Holocene (MH: 6,000 years BP), which occurred coevally with the intensification of the West African Monsoon. The reduction in precipitation over South America is also simulated by various models which account for changes in orbital forcings and greenhouse gas concentrations between the present day and the mid-Holocene. However, most model studies do not account for vegetation changes, which precludes realistic simulations, especially due to the presence and far-afield impacts of the Green Sahara. In this study, we evaluate precipitation over South America during the mid-Holocene from four models, namely – EC-Earth 3.1, iCESM 1.2, CCSM4-Toronto and GISS Model E2.1-G. Two scenarios are considered for each model – an MHPMIP scenario simulated with the mid-Holocene orbital parameters and greenhouse gas concentrations with vegetation prescribed to pre-industrial conditions, as well as an MHGS (Green Sahara) scenario which additionally considers factors such as enhanced vegetation, reduced dust, presence of lakes, and land and soil feedbacks. Incorporating the Green Sahara leads to an amplification of the drying signal over South America and brings it more in line with the proxy reconstructions. We also present a semi-quantitative assessment of the proxy-model agreement. Our work indicates that it is important to consider changes over northern Africa while studying South American climate of the mid-Holocene.

GISS-E2-1 model↗

DOE OSTI2021

Approximation of periodic Green's operator in real space using numerical integration and its use in fast Fourier transform-based micromechanical models

In this work, we propose an expression for the periodic first derivative of Green's function in real space. The proposed expression allows an alternative way of computing the periodic Green's operator based on periodically summing the free-space Green's operator in terms of an appropriate quadrature rule. We provide computational examples, which show the accuracy of the proposed approach, together with reduced spurious oscillations in the solution fields.

42 ENGINEERING↗