Search NASA⌕ Search

SEARCH · Search NASA

Results for “transient water”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 163 records · Page 9
All sourcesNASA NTRSDOE OSTI
NASA NTRS2017

Chemical Complexity Induced by Efficient Ice Evaporation in the Barnard 5 Molecular Cloud

Cold gas-phase water has recently been detected in a cold dark cloud, Barnard 5 located in the Perseus complex, by targeting methanol peaks as signposts for ice mantle evaporation. Observed morphology and abundances of methanol and water are consistent with a transient non-thermal evaporation process only affecting the outermost ice mantle layers, possibly triggering a more complex chemistry. Here we present the detection of the complex organic molecules (COMs) acetaldehyde (CH3CHO) and methyl formate (CH3OCHO), as well as formic acid (HCOOH) and ketene (CH2CO), and the tentative detection of di-methyl ether (CH3OCH3) towards the ''methanol hotspot'' of Barnard 5 located between two dense cores using the single dish OSO 20 m, IRAM 30 m, and NRO 45 m telescopes. The high energy cis-conformer of formic acid is detected, suggesting that formic acid is mostly formed at the surface of interstellar grains and then evaporated. The detection of multiple transitions for each species allows us to constrain their abundances through LTE and non-LTE methods. All the considered COMs show similar abundances between approx. 1 and approx. 10% relative to methanol depending on the assumed excitation temperature. The non-detection of glycolaldehyde, an isomer of methyl formate, with a [glycolaldehyde]/[methyl formate] abundance ratio lower than 6%, favours gas phase formation pathways triggered by methanol evaporation. According to their excitation temperatures derived in massive hot cores, formic acid, ketene, and acetaldehyde have been designated as ''lukewarm'' COMs whereas methyl formate and di-methyl ether were defined as ''warm'' species. Comparison with previous observations of other types of sources confirms that lukewarm and warm COMs show similar abundances in low-density cold gas whereas the warm COMs tend to be more abundant than the lukewarm species in warm protostellar cores. This abundance evolution suggests either that warm COMs are indeed mostly formed in protostellar environments and/or that lukewarm COMs are efficiently depleted by increased hydrogenation efficiency around protostars.

ISM: molecules↗
NASA NTRS2020

Large-Scale Influences on Atmospheric River–Induced Extreme Precipitation Events Along the Coast of Washington State

Transient, narrow plumes of strong water vapor transport, referred to as Atmospheric Rivers (ARs) are responsible for much of the precipitation along the west coast of the United States. Along the coast of Oregon and Washington, the most intense cool season precipitation events are almost always induced by an AR and can result in detrimental impacts on society due to mudslides and flooding. It is therefore important to understand the large scale influence on extreme AR events so that they can be accurately predicted on timescales ranging from numerical weather prediction to seasonal forecasts. Here, characteristics of ARs that result in observed extreme precipitation events are compared to typical ARs on the coast of Washington State using data from the Modern Era Retrospective analysis for Research and Applications, Version 2. In addition to more intense water vapor transport, notable differences in the synoptic scale forcing are present during extreme precipitation events that are not present during typical AR events. In particular, an anomalously deep low pressure system is stationed to the west in the Gulf of Alaska, alongside a jet streak overhead. Attention will also be given to subseasonal and seasonal teleconnection patterns that are known to influence the weather in the Pacific Northwest of the United States. While little influence can be seen from the phase of the El Nino Southern Oscillation, Pacific Decadal Oscillation, and Pacific North American Pattern, the Madden Julian Oscillation (MJO) can play a role in determining the strength of precipitation associated with in AR on the Washington Coast. Lastly, interactions between the MJO and other teleconnection patterns will be explored to determine key features that should be investigated when making subseasonal predictions for AR activity and the associated precipitation in the Pacific Northwest.

Collow, Allison↗
NASA NTRS2017

Chemical Complexity Induced by Efficient Ice Evaporation in the Barnard 5 Molecular Cloud

Cold gas-phase water has recently been detected in a cold dark cloud, Barnard 5 located in the Perseus complex, by targeting methanol peaks as signposts for ice mantle evaporation. Observed morphology and abundances of methanol and water are consistent with a transient non-thermal evaporation process only affecting the outermost ice mantle layers, possibly triggering a more complex chemistry. Here we present the detection of the complex organic molecules (COMs) acetaldehyde (CH3CHO) and methyl formate (CH3OCHO), as well as formic acid (HCOOH) and ketene (CH2CO), and the tentative detection of di-methyl ether (CH3OCH3) towards the ‘methanol hotspot’ of Barnard 5 located between two dense cores using the single dish OSO 20m, IRAM 30m, and NRO 45m telescopes. The high energy cis- conformer of formic acid is detected, suggesting that formic acid is mostly formed at the surface of interstellar grains and then evaporated. The detection of multiple transitions for each species allows us to constrain their abundances through LTE and non-LTE methods. All the considered COMs show similar abundances between ∼ 1 and ∼ 10 % relative to methanol depending on the assumed excitation temperature. The non-detection of glycolaldehyde, an isomer of methyl formate, with a [glycolaldehyde]/[methyl formate] abundance ratio lower than 6 %, favours gas phase formation pathways triggered by methanol evaporation. According to their excitation temperatures derived in massive hot cores, formic acid, ketene, and acetaldehyde have been designated as ‘lukewarm’ COMs whereas methyl formate and di-methyl ether were defined as ‘warm’ species. Comparison with previous observations of other types of sources confirms that lukewarm and warm COMs show similar abundances in low-density cold gas whereas the warm COMs tend to be more abundant than the lukewarm species in warm protostellar cores. This abundance evolution suggests either that warm COMs are indeed mostly formed in protostellar environments and/or that lukewarm COMs are efficiently depleted by increased hydrogenation efficiency around protostars.

astrochemistry – ISM: abundances – ISM: clouds – I↗
NASA NTRS2020

Large-Scale Influences on Atmospheric River Induced Extreme Precipitation Events Along the Coast of Washington State

Transient, narrow plumes of strong water vapor transport, referred to as AtmosphericRivers (ARs), are responsible for much of the precipitation along the west coast of the UnitedStates. The most intense precipitation events are almost always induced by an AR on the coast ofOregon and Washington and can result in detrimental impacts on society due to mudslides andflooding. In order to accurately predict AR events on numerical weather prediction, subseasonal,and seasonal timescales, it is important to understand the large-scale impacts on extreme ARevents. Here, characteristics of ARs that result in an extreme precipitation event are compared totypical ARs on the coast of Washington State. In addition to more intense water vapor transport,notable differences in the synoptic forcing are present during extreme precipitation events thatare not present during typical AR events. Subseasonal and seasonal teleconnection patterns areknown to influence the weather in the Pacific Northwest and are investigated here. The MaddenJulian Oscillation (MJO) plays a role in determining the strength of precipitation associated withan AR on the Washington Coast. Phase 5 of the MJO (convection centered over the maritimecontinent) is the most common phase during an extreme precipitation event, while phase 2(convection over the Indian Ocean) discourages an extreme event from occurring. Interactionsbetween El Niño Southern Oscillation (ENSO) and the propagation speed of the MJO result inextreme events during phase 1 of the MJO and El Niño but phase 8 during neutral ESNOconditions.

Allison B Marquardt Collow↗
NASA NTRS2022

Interactive Biogenic Emissions and Drought Stress Effects on Atmospheric Composition in NASA GISS ModelE

Drought is a hydroclimatic extreme that causes perturbations to the terrestrial biosphere and acts as a stressor on vegetation, affecting emissions patterns. During severe drought, isoprene emissions are reduced. In this paper, we focus on capturing this reduction signal by implementing a new percentile isoprene drought stress (y d ) algorithm in NASA GISS ModelE based on the MEGAN3 (Model of Emissions of Gases and Aerosols from Nature Version 3) approach as a function of a photosynthetic parameter (V c,max ) and water stress (β). Four global transient simulations from 2003–2013 are used to demonstrate the effect without y d (Default_ModelE) and with online y d (DroughtStress_ModelE). DroughtStress_ModelE is evaluated against the observed isoprene measurements at the Missouri Ozarks AmeriFlux (MOFLUX) site during the 2012 severe drought where improvements in the correlation coefficient indicate it is a suitable drought stress parameterization to capture the reduction signal during severe drought. The application of y d globally leads to a decadal average reduction of ∼ 2.7 %, which is equivalent to ∼14.6 Tg yr -1 of isoprene. The changes have larger impacts in regions such as the southeastern US. DroughtStress_ModelE is validated using the satellite ΩHCHO column from the Ozone Monitoring Instrument (OMI) and surface O 3 observations across regions of the US to examine the effect of drought on atmospheric composition. It was found that the inclusion of isoprene drought stress reduced the overestimation of ΩHCHO in Default_ModelE during the 2007 and 2011 southeastern US droughts and led to improvements in simulated O 3 during drought periods. We conclude that isoprene drought stress should be tuned on a model-by-model basis because the variables used in the parameterization responses are relative to the land surface model hydrology scheme (LSM) and the effects of y d application could be larger than seen here due to ModelE not having large biases of isoprene during severe drought.

drought stress effects↗
DOE OSTI2020

Subchannel codes: CTF and VIPRE-01

In this chapter, two state-of-the-art and well-used subchannel codes are presented: CTF and VIPRE-01. As part of the Consortium for Advanced Simulation of Light Water Reactors, CTF is being used for single- and two-phase flow analysis under light-water reactor normal and anticipated transient operating conditions. Accurate determination of flow distribution, pressure drop, and void content is crucial for predicting margins to thermal crisis and ensuring more efficient nuclear power plant performance. In preparation for the intended applications, CTF is extensively validated against data from experimental facilities. Meanwhile, the licensed commercial code VIPRE-01 is used to generate a baseline set of simulations for the targeted tests and the solution parameters are compared to CTF results. The closure models in CTF that are in the greatest need of improvement are highlighted and discussed.

Zhao, Xingang↗
DOE OSTI2021

Machine Learning in Nuclear Thermal Hydraulics

This presentation is prepared for "OECD/NEA/CSNI Specialists Meeting on Transient Thermal-hydraulics in Water Cooled Nuclear Reactors", which will be held in 9-10 June, 2021. A full-size paper has passed the review of PRS and LRS.

22 GENERAL STUDIES OF NUCLEAR REACTORS↗
DOE OSTI2026

A comparison of wrought and powder metallurgical FeCrAl claddings under simulated LWR accident transients

Iron-chromium-aluminum (FeCrAl) alloys are potential accident tolerant fuel (ATF) cladding candidates for light-water reactors but are difficult to fabricate as thin-walled tubes via conventional cast-and-wrought routes. Powder metallurgy (PM) offers a manufacturing alternative with improved compositional control, but its transient accident performance has not been directly benchmarked against wrought variants. This study evaluates the burst behavior of commercially developed PM-processed FeCrAl alloys, PM-C26M (Fe-12Cr-6Al-2Mo) and the high precipitate density FA-SMT (Fe-22Cr-5Al-3Mo), under simulated light-water reactor accident transient conditions. Burst testing was conducted using the Severe Accident Test Station with heating rates of 5 °C/s and 50 °C/s and internal pressures ranging from 25 MPa to 100 MPa. PM-C26M reproduced wrought C26M burst behavior within 7–37 °C across the stress range, indicating that PM processing does not compromise transient strength. FA-SMT exhibited markedly higher burst temperatures and reduced heating-rate sensitivity, consistent with its engineered precipitate strengthening. FA-SMT rupture exhibited axial "unzipping" rather than the lateral tearing characteristic of PM- and wrought C26M. Post-test EBSD and fractography indicate that this behavior is strongly correlated with strain-gated intergranular void nucleation associated with the dense precipitate architecture of FA-SMT, a response absent in the comparatively clean PM-C26M matrix and consistent with rupture morphologies reported for oxide-dispersion strengthened (ODS) FeCrAl of similar base-matrix chemistry to PM-C26M. These findings highlight the potential of powder metallurgy as a viable fabrication route for ATF claddings from an accident performance standpoint.

Bell, Sam [ORNL] (ORCID:0000000251905657)↗
DOE OSTI2024

In-situ strain behavior and BISON simulations of Zircaloy cladding subjected to temperature cycling separate-effects tests in a steam environment

Understanding fuel system performance during anticipated transients without scram (ATWSs) in boiling water reactors (BWRs) is necessary for refining current and future safety limits. High-fidelity material models and simulations are fundamental to rigorous assessment of zirconium-based cladding performance. However, experimental thermomechanical data during simulated ATWSs to validate these modes are limited. To provide relevant in-situ data, Zircaloy-4 cladding was subjected to cyclic heating in a steam environment to simulate an out-of-pile BWR ATWS. Digital image correlation was used to capture the cladding strain behavior in-situ for comparison against simulations using the BISON finite element code. Conventional high-temperature models were compared using multiple schemes to gain a better understanding of the applicability of three BISON models to BWR ATWS: (1) the default combination of creep models in BISON, (2) the high-temperature Erbacher model alone, and (3) the low-temperature Limback-Andersson model alone. The cases run with the Limback-Andersson model alone produced the lowest root mean square error (RMSE). The lowest RMSE for the Limback-Andersson model alone was 0.659%, and the highest RMSE reported was 4.22%. A data gap within the model in the temperature regime of interest was also identified, and to account for this gap, the current model in BISON is linearly interpolated between two separate datasets. In conclusion, this evaluation highlights the need to either develop a new model or to improve the existing model to capture transient creep effects resulting from a cyclic temperature transient.

Anticipated transient without SCRAM↗
DOE OSTI2023

Electron Target Cooling Analyses of the KIPT ADS Using MCNP and Ansys Fluent

This study presents multiphysics analyses of the electron target cooling system of the accelerator-driven system (ADS) of the Kharkiv Institute of Physics and Technology (KIPT) using MCNP and Fluent computer programs. MCNP has been used to transport electrons, gammas, and neutrons, and to calculate the energy deposition in the target materials. The MCNP mesh-tally data have been imported into Fluent by a C subroutine that has been compiled and linked to Fluent as a user-defined function.The KIPT ADS is located in Ukraine and was in operation until February 2022. The Fluent model is based on the computer-aided design files from the manufacturing process of the target assembly. Here, the Fluent results for the reference case match very well the literature results obtained by STAR-CCM+ during the design phase. Other cases that differ from the reference one have been analyzed; in these cases, it is assumed a malfunction of the electron accelerator or of the water cooling system. The target cooling system operates normally for all the analyzed cases except when the inlet water mass flow rate is decreased. The transient analysis showed that the target cooling system can operate for 180 s with full power when the inlet water mass flow rate is decreased down by 75%.

73 NUCLEAR PHYSICS AND RADIATION PHYSICS↗
DOE OSTI2020

Adhesion-force micro-scale study of desiccating granular material

Experiments on five-, four-, three- and two-wet-hydrophilic-grain clusters were performed to investigate evolution of adhesion of granular media during drying on the micro-scale. The experiments show that the adhesion-force of a cluster initially grows at most to three times the original value before decreasing to zero by the end of evaporation. The adhesion-force is composed of capillary pressure force acting over the liquid/solid contact surface area, and surface tension forces acting over the three-phase contact perimeter length. This is in contrast with most macro-scale phenomenological models, in which the only desaturation process variables affecting strength are suction and saturation. Both the contact surface area and contact perimeter length are reduced to zero upon complete liquid evaporation. The morphology of an evaporating water body evolves through slow flow controlled by evaporation rate, interrupted by various modes of fast air entry, which are non-equilibrium jumps of liquid/gas interfaces (Haines jumps). The instabilities involve large adhesion force discontinuities and substantial water mass reconfiguration with water flow in an extremely short time, which makes the process transient. The reconfigurations can reduce the original multi-grain water clusters to four-, three- and two-grain clusters by way of three different instability modes: of thin-sheet instability, or meniscus snap-through instability, depending on the sign of the Gauss curvature of the liquid surface, or finally, for two-grain bridges only, a liquid wire pinch-off. For larger meso-scale assemblies, however, the global adhesion-force evolution is little affected by the jumps. The air entries are potential sites for drying cracks. The (approximately) calculated capillary pressure for two- and three-grain clusters, in no cases is seen to reach high values, predicted from water retention curves.

Engineering↗
DOE OSTI2022

Unstructured mesh-based multi-physics reactor transient simulation with iMC code

In this study, we present a time-dependent Monte Carlo simulation result about a complex fuel-loaded light water reactor system with thermal-hydraulic feedback using the KAIST iMC code. The intra-pin temperature distribution is calculated based on Monte Carlo-tallied detailed power distribution and the finite element heat transfer method. The temperature effect of fuel, absorber, and coolant are adequately reflected into the dynamic response by the on-the-fly Doppler broadened cross-section correction. For the time-dependent Monte Carlo transport simulation, the predictor-corrector quasi-static Monte Carlo method is used for this study. We tested the coupled analysis framework with a 17-by-17 fuel assembly loaded with the centrally-shielded burnable absorber (CSBA) fuel element. The temperature feedback effect on the material cross-section and the moderator density incurred negative reactivity in response to the external positive reactivity insertion, showing the inherent stability of the reactor system. The pin-wise power and temperature change during the system transient are presented and discussed. (authors)

21 SPECIFIC NUCLEAR REACTORS AND ASSOCIATED PLANTS↗
DOE OSTI2025

Pulse-by-pulse transient thermal deformation in crystal optics under high-repetition-rate FEL

Time-domain modeling of the thermal deformation of crystal optics can help define acceptable operational ranges across the pulse-energy repetition-rate phase space. In this paper, we have studied the transient thermal deformation of a water-cooled diamond crystal for a cavity-based X-ray free-electron laser (CBXFEL), either an X-ray free-electron laser oscillator (XFELO) or a regenerative amplifier X-ray free-electron laser (RAFEL), by numerical simulations including finite-element analysis and advanced data processing. Pulse-by-pulse transient thermal deformation of a 50 µm-thick diamond crystal has been performed with X-ray pulse repetition rates between 50 kHz and 1 MHz. Results for temperature and thermal deformation have been compared with the results of transient analysis using a continuous wave (CW) power loading. Temperature and thermal deformation results from pulse-by-pulse transient analysis vary with time about the results for the CW case for the same average power. The variation amplitude increases with pulse energy and decreases with repetition rate. When the repetition rate increases to infinity, both temperature and thermal deformation converge to the results for the CW case. Two critical time scales for the operation of crystal optics in a CBXFEL are (1) first-turn time, i.e. the time for the XFEL pulse to complete the first turn around the cavity so that the crystal sees the recirculated XFEL pulse, and (2) period-end time, i.e. the time that the next electron bunch arrives for the amplification, so that the crystal outcouples the amplified FEL power. For the same average power, simulation results show that the crystal thermal deformation seen by the XFEL beam decreases with repetition rate at the first-turn time of a 300 m-long cavity and increases with repetition rate at the period-end time. For the wavefront preservation requirement of the crystal optics, a pulse-energy versus repetition-rate phase space has been established. The upper bounds of the pulse energy at both first-turn and period-end times decreases with repetition rate, especially at the period-end time. The upper bound of the thermal deformation of the crystal at the period-end time for any repetition frequency can be estimated from the CW case. For a water-cooled diamond crystal of dimension 5 mm × 5 mm × 0.05 mm, the time to reach a quasi steady-state is about 50 ms for temperature and 50 µs for thermal deformation.

73 NUCLEAR PHYSICS AND RADIATION PHYSICS↗
DOE OSTI2024

Switching of electrochemical selectivity due to plasmonic field-induced dissociation

Electrochemical reactivity is known to be dictated by the structure and composition of the electrocatalyst–electrolyte interface. Here, we show that optically generated electric fields at this interface can influence electrochemical reactivity insofar as to completely switch reaction selectivity. We study an electrocatalyst composed of gold–copper alloy nanoparticles known to be active toward the reduction of CO 2 to CO. However, under the action of highly localized electric fields generated by plasmonic excitation of the gold–copper alloy nanoparticles, water splitting becomes favored at the expense of CO 2 reduction. Real-time time-dependent density functional tight binding calculations indicate that optically generated electric fields promote transient-hole-transfer-driven dissociation of the O─H bond of water preferentially over transient-electron-driven dissociation of the C─O bond of CO 2 . These results highlight the potential of optically generated electric fields for modulating pathways, switching reactivity on/off, and even directing outcomes.

Alcorn, Francis M.↗
DOE OSTI2023

DT-HYDRO

The software solves the time dependent, one dimensional (1D) coupled mass and momentum balance equations governing the elastic flow of water through the penstock, turbine and draft tube in a hydroelectric facility using a high order finite volume based method. The numerical method is based on the Kurganov-Tadmor central method paired with the Monotonic Upstream-centered Scheme for Conservation Laws (MUSCL). This solution method accurately resolves the fast transient behavior of the flow, including water hammer. Additionally, the software estimates the full 3D flow field within the turbine chamber in real time, a feat that is made possible by leveraging pre-computed CFD results by utilizing a reduced order modeling method based on an efficient randomized singular value decomposition (SVD) driven proper orthogonal decomposition (POD) with POD-mode weight regression. The reduced order model of the 3D flow is directly coupled to the 1D elastic flow model so the entire flow field through the penstock and turbine system is resolved quickly and with high fidelity.

Gurecky, William [Oak Ridge National Laboratory (O↗
NASA NTRS1993

Transient studies of capillary-induced flow

This paper presents the numerical and experimental results of a study performed on the transient rise of fluid in a capillary tube. The capillary tube problem provides an excellent mechanism from which to launch an investigation into the transient flow of a fluid in a porous wick structure where capillary forces must balance both adverse gravitational effects and frictional losses. For the study, a capillary tube, initially charged with a small volume of water, was lowered into a pool of water. The behavior of the column of fluid during the transient that followed as more water entered the tube from the pool was both numerically and experimentally studied.

Reagan, M. K.↗
DOE OSTI2020

Modeling Efforts to Gain Insight into Historical Leak Events from the Single-Shell Tank A-105 in the Hanford 241-A Tank Farm - 20113

The 241-A Tank Farm is a single-shell tank (SST) farm constructed to store process waste from Hanford nuclear operations. Millions of gallons of nuclear waste were stored in the 241-A Tank Farm SSTs and some of the SSTs leaked in the past. In addition, spills and pipeline leaks during transfers and storage and intentional discharges to cribs and trenches resulted in releasing waste to the ground. Tank liner leaks are referred to as 'leaks' and all other discharges to the soil are referred to as 'releases.' Liquid waste that could be removed by pumping has been removed from all of the SSTs to reduce the potential for future leaks. The most significant historical leak event in 241-A Tank Farm occurred in 1965 when tank A-105 experienced a pressurized steam event. This event resulted in damage to the inner steel liner flooring of A-105, which was separated from the sidewalls over part of its circumference and buckled up to 2.5 m, vertically. During this event up to 7,570 L of contaminated liquid may have leaked to the adjacent soil. This leak occurred under extreme temperature and pressure conditions. Modeling efforts to better understand the nature and extent of historical leaks from subsurface SSTs that were used to store highly radioactive, self-boiling liquid wastes at 241-A Tank Farm have recently been undertaken. These efforts have compiled the available historical information to support a preliminary non-isothermal, multiphase flow and chemical transport modeling effort to re-create the conditions under which the leaks occurred and to formulate a conceptual model as to the extent and distribution of leaked radioactive contaminants in the adjacent soil material. The focus of this work was on developing an understanding of the key features, processes and bounding conditions related to tank A-105 leak events that occurred in the 1960's. The activities include estimation of leak composition, non-isothermal multiphase flow and transport modeling, and geochemical modeling. The STOMP{sup C} Water-Air-Energy modeling code was utilized to implement the three-dimensional representation of the subsurface tank and the surrounding flow field. Once constructed, the model was used to evaluate the conceptual understanding of leaks originating from different parts of the tank under the elevated temperature boundary conditions that were imposed by surrounding tanks at the time of the historical leaks. The chemical evolution of the liquid waste was also evaluated as it leaked from the tank under transient pressure and temperature gradients. The results of the preliminary evaluation suggested the presence of a heat-pipe effect beneath tank A-105 in which water vapor at an elevated temperature is driven away from the base of the tank to a position where water vapor cools, condenses and is then drawn back toward the tank by the strong capillary attraction of the dry soil. A non-sorbing contaminant (Tc-99) was introduced into this flow field to better understand the potential distribution patterns of leaked contaminants that may have occurred during the historical leak events. (authors)

12 MANAGEMENT OF RADIOACTIVE AND NON-RADIOACTIVE W↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗