Search NASA⌕ Search

SEARCH · Search NASA

Results for “DNA motif”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 records
All sourcesNASA NTRSDOE OSTI
NASA NTRS2003

cWINNOWER Algorithm for Finding Fuzzy DNA Motifs

The cWINNOWER algorithm detects fuzzy motifs in DNA sequences rich in protein-binding signals. A signal is defined as any short nucleotide pattern having up to d mutations differing from a motif of length l. The algorithm finds such motifs if multiple mutated copies of the motif (i.e., the signals) are present in the DNA sequence in sufficient abundance. The cWINNOWER algorithm substantially improves the sensitivity of the winnower method of Pevzner and Sze by imposing a consensus constraint, enabling it to detect much weaker signals. We studied the minimum number of detectable motifs qc as a function of sequence length N for random sequences. We found that qc increases linearly with N for a fast version of the algorithm based on counting three-member sub-cliques. Imposing consensus constraints reduces qc, by a factor of three in this case, which makes the algorithm dramatically more sensitive. Our most sensitive algorithm, which counts four-member sub-cliques, needs a minimum of only 13 signals to detect motifs in a sequence of length N = 12000 for (l,d) = (15,4).

Liang, Shoudan↗
NASA NTRS2004

cWINNOWER algorithm for finding fuzzy dna motifs

The cWINNOWER algorithm detects fuzzy motifs in DNA sequences rich in protein-binding signals. A signal is defined as any short nucleotide pattern having up to d mutations differing from a motif of length l. The algorithm finds such motifs if a clique consisting of a sufficiently large number of mutated copies of the motif (i.e., the signals) is present in the DNA sequence. The cWINNOWER algorithm substantially improves the sensitivity of the winnower method of Pevzner and Sze by imposing a consensus constraint, enabling it to detect much weaker signals. We studied the minimum detectable clique size qc as a function of sequence length N for random sequences. We found that qc increases linearly with N for a fast version of the algorithm based on counting three-member sub-cliques. Imposing consensus constraints reduces qc by a factor of three in this case, which makes the algorithm dramatically more sensitive. Our most sensitive algorithm, which counts four-member sub-cliques, needs a minimum of only 13 signals to detect motifs in a sequence of length N = 12,000 for (l, d) = (15, 4). Copyright Imperial College Press.

Evaluation Studies↗
DOE OSTI2025

Discovering methylated DNA motifs in bacterial nanopore sequencing data with MIJAMP

Abstract Bacterial DNA methylation is involved in diverse cellular functions, including modulation of gene expression, DNA repair, and restriction–modification systems for defense against viruses and other foreign DNA. Restriction systems hinder efforts to engineer organisms to produce fuels and chemicals from waste and renewable feedstocks by degrading DNA during transformation. Methylome analysis allows identification of motifs within a bacterial chromosome that may be targeted by native restriction enzymes. Further expression of the corresponding methyltransferases in Escherichia coli allows plasmid DNA to be protected from restriction in the target organism, thereby drastically enhancing transformation efficiency. Nanopore sequencing can detect methylated bases, but software is needed to transform modified base coordinates into methylated motifs. Here, we develop MIJAMP (MIJAMP Is Just A MethylBED Parser), a software package that was developed to discover methylated motifs from the output of ONT’s Modkit or other data in the methylBED format. MIJAMP employs a human-driven refinement strategy that empirically validates all motifs against genome-wide methylation data, thus eliminating incorrect motifs. MIJAMP also reports methylation data on specific, user-defined motifs. Using MIJAMP, we determined the methylated motifs both in a control strain (wild-type E. coli) and in Synecococcus sp. strain PCC7002, laying the foundation for improved transformation in this organism. MIJAMP is available at https://code.ornl.gov/alexander-public/mijamp/. One Sentence Summary: Here we describe software written to discover DNA methylation motifs from nanopore sequencing data.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS2000

A calmodulin binding protein from Arabidopsis is induced by ethylene and contains a DNA-binding motif

Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.

Non-NASA Center↗
DOE OSTI2021

Rapid Cis–Trans Coevolution Driven by a Novel Gene Retroposed from a Eukaryotic Conserved CCR4–NOT Component in Drosophila

Young, or newly evolved, genes arise ubiquitously across the tree of life, and they can rapidly acquire novel functions that influence a diverse array of biological processes. Previous work identified a young regulatory duplicate gene in Drosophila, Zeus that unexpectedly diverged rapidly from its parent, Caf40, an extremely conserved component in the CCR4–NOT machinery in post-transcriptional and post-translational regulation of eukaryotic cells, and took on roles in the male reproductive system. This neofunctionalization was accompanied by differential binding of the Zeus protein to loci throughout the Drosophila melanogaster genome. However, the way in which new DNA-binding proteins acquire and coevolve with their targets in the genome is not understood. Here, by comparing Zeus ChIP-Seq data from D. melanogaster and D. simulans to the ancestral Caf40 binding events from D. yakuba, a species that diverged before the duplication event, we found a dynamic pattern in which Zeus binding rapidly coevolved with a previously unknown DNA motif, which we term Caf40 and Zeus-Associated Motif (CAZAM), under the influence of positive selection. Interestingly, while both copies of Zeus acquired targets at male-biased and testis-specific genes, D. melanogaster and D. simulans proteins have specialized binding on different chromosomes, a pattern echoed in the evolution of the associated motif. Using CRISPR-Cas9-mediated gene knockout of Zeus and RNA-Seq, we found that Zeus regulated the expression of 661 differentially expressed genes (DEGs). Our results suggest that the evolution of young regulatory genes can be coupled to substantial rewiring of the transcriptional networks into which they integrate, even over short evolutionary timescales. Our results thus uncover dynamic genome-wide evolutionary processes associated with new genes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Reconfigurable Two-Dimensional DNA Lattices: Static and Dynamic Angle Control

Branched DNA motifs serve as the basic construction elements for all synthetic DNA nanostructures. However, precise control of branching orientation remains a key challenge to further heighten the overall structural order. Here in this study, we use two strategies to control the branching orientation. The first one is based on immobile Holliday junctions which employ specific nucleotide sequences at the branch points which dictate their orientation. The second strategy is to use angle-enforcing struts to fix the branching orientation with flexible spacers at the branch points. We have also demonstrated that the branching orientation control can be achieved dynamically, either by canonical Watson–Crick base pairing or non-canonical nucleobase interactions (e.g., i-motif and G-quadruplex). With precise angle control and feedback from the chemical environment, these results will enable novel DNA nanomechanical sensing devices, and precisely-ordered three-dimensional architectures.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2021

Reconfigurable Two‐Dimensional DNA Lattices: Static and Dynamic Angle Control

Abstract Branched DNA motifs serve as the basic construction elements for all synthetic DNA nanostructures. However, precise control of branching orientation remains a key challenge to further heighten the overall structural order. In this study, we use two strategies to control the branching orientation. The first one is based on immobile Holliday junctions which employ specific nucleotide sequences at the branch points which dictate their orientation. The second strategy is to use angle‐enforcing struts to fix the branching orientation with flexible spacers at the branch points. We have also demonstrated that the branching orientation control can be achieved dynamically, either by canonical Watson–Crick base pairing or non‐canonical nucleobase interactions (e.g., i‐motif and G‐quadruplex). With precise angle control and feedback from the chemical environment, these results will enable novel DNA nanomechanical sensing devices, and precisely‐ordered three‐dimensional architectures.

Wang, Wen↗
DOE OSTI2024

Mechanism of DNA origami folding elucidated by mesoscopic simulations

Abstract Many experimental and computational efforts have sought to understand DNA origami folding, but the time and length scales of this process pose significant challenges. Here, we present a mesoscopic model that uses a switchable force field to capture the behavior of single- and double-stranded DNA motifs and transitions between them, allowing us to simulate the folding of DNA origami up to several kilobases in size. Brownian dynamics simulations of small structures reveal a hierarchical folding process involving zipping into a partially folded precursor followed by crystallization into the final structure. We elucidate the effects of various design choices on folding order and kinetics. Larger structures are found to exhibit heterogeneous staple incorporation kinetics and frequent trapping in metastable states, as opposed to more accessible structures which exhibit first-order kinetics and virtually defect-free folding. This model opens an avenue to better understand and design DNA nanostructures for improved yield and folding performance.

77 NANOSCIENCE AND NANOTECHNOLOGY↗
DOE OSTI2021

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

09 BIOMASS FUELS↗
DOE OSTI2023

A Telomerase-Activated Magnetic Resonance Imaging Probe for Consecutively Monitoring Tumor Growth Kinetics and In Situ Screening Inhibitors

Telomerase has long been considered as a biomarker for cancer diagnosis and a therapeutic target for drug discovery. Detecting telomerase activity in vivo could provide more direct information of tumor progression and response to drug treatment, which, however, is hampered by the lack of an effective probe that can generate an output signal without a tissue penetration depth limit. Here in this study, using the principle of distance-dependent magnetic resonance tuning, we constructed a telomerase-activated magnetic resonance imaging probe (TAMP) by connecting superparamagnetic ferroferric oxide nanoparticles (SPFONs) and paramagnetic Gd-DOTA (Gd(III) 1,4,7,10- tetraazacyclododecane-1,4,7,10-tetraazacyclododecane-1,4,7,10-tet-raacetic acid) complexes via telomerase-responsive DNA motifs. Upon telomerase-catalyzed extension of the primer in TAMP, Gd-DOTA-conjugated oligonucleotides can be liberated from the surface of SPFONs through a DNA strand displacement reaction, restoring the T 1 signal of the Gd-DOTA for a direct readout of the telomerase activity. Here we show that, by tracking telomerase activity, this probe provides consistent monitoring of tumor growth kinetics during progression and in response to drug treatment and enables in situ screening of telomerase inhibitors in whole-animal models. This study provides an alternative toolkit for cancer diagnosis, treatment response assessment, and anticancer drug screening.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2024

A compact stem-loop DNA aptamer targets a uracil-binding pocket in the SARS-CoV-2 nucleocapsid RNA-binding domain

Abstract SARS-CoV-2 nucleocapsid (N) protein is a structural component of the virus with essential roles in the replication and packaging of the viral RNA genome. The N protein is also an important target of COVID-19 antigen tests and a promising vaccine candidate along with the spike protein. Here, we report a compact stem-loop DNA aptamer that binds tightly to the N-terminal RNA-binding domain of SARS-CoV-2 N protein. Crystallographic analysis shows that a hexanucleotide DNA motif (5′-TCGGAT-3′) of the aptamer fits into a positively charged concave surface of N-NTD and engages essential RNA-binding residues including Tyr109, which mediates a sequence-specific interaction in a uracil-binding pocket. Avid binding of the DNA aptamer allows isolation and sensitive detection of full-length N protein from crude cell lysates, demonstrating its selectivity and utility in biochemical applications. We further designed a chemically modified DNA aptamer and used it as a probe to examine the interaction of N-NTD with various RNA motifs, which revealed a strong preference for uridine-rich sequences. Our studies provide a high-affinity chemical probe for the SARS-CoV-2 N protein RNA-binding domain, which may be useful for diagnostic applications and investigating novel antiviral agents.

Biochemistry & Molecular Biology↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Structural basis of DNA binding by the WhiB-like transcription factor WhiB3 in Mycobacterium tuberculosis

Mycobacterium tuberculosis (Mtb) WhiB3 is an iron–sulfur cluster-containing transcription factor belonging to a subclass of the WhiB-Like (Wbl) family that is widely distributed in the phylum Actinobacteria. WhiB3 plays a crucial role in the survival and pathogenesis of Mtb. It binds to the conserved region 4 of the principal sigma factor (σ A 4 ) in the RNA polymerase holoenzyme to regulate gene expression like other known Wbl proteins in Mtb. However, the structural basis of how WhiB3 coordinates with σ A 4 to bind DNA and regulate transcription is unclear. Here we determined crystal structures of the WhiB3:σ A 4 complex without and with DNA at 1.5 Å and 2.45 Å, respectively, to elucidate how WhiB3 interacts with DNA to regulate gene expression. These structures reveal that the WhiB3:σ A 4 complex shares a molecular interface similar to other structurally characterized Wbl proteins and also possesses a subclass-specific Arg-rich DNA-binding motif. We demonstrate that this newly defined Arg-rich motif is required for WhiB3 binding to DNA in vitro and transcriptional regulation in Mycobacterium smegmatis. Together, our study provides empirical evidence of how WhiB3 regulates gene expression in Mtb by partnering with σ A 4 and engaging with DNA via the subclass-specific structural motif, distinct from the modes of DNA interaction by WhiB1 and WhiB7.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Uncovering DNA-PKcs ancient phylogeny, unique sequence motifs and insights for human disease

DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is a key member of the phosphatidylinositol-3 kinase-like (PIKK) family of protein kinases with critical roles in DNA-double strand break repair, transcription, metastasis, mitosis, RNA processing, and innate and adaptive immunity. The absence of DNA-PKcs from many model organisms has led to the assumption that DNA-PKcs is a vertebrate-specific PIKK. Here, we find that DNA-PKcs is widely distributed in invertebrates, fungi, plants, and protists, and that threonines 2609, 2638, and 2647 of the ABCDE cluster of phosphorylation sites are highly conserved amongst most Eukaryotes. Furthermore, we identify highly conserved amino acid sequence motifs and domains that are characteristic of DNA-PKcs relative to other PIKKs. These include residues in the Forehead domain and a novel motif we have termed YRPD, located in an α helix C-terminal to the ABCDE phosphorylation site loop. Combining sequence with biochemistry plus structural data on human DNA-PKcs unveils conserved sequence and conformational features with functional insights and implications. The defined generally progressive DNA-PKcs sequence diversification uncovers conserved functionality supported by Evolutionary Trace analysis, suggesting that for many organisms both functional sites and evolutionary pressures remain identical due to fundamental cell biology. The mining of cancer genomic data and germline mutations causing human inherited disease reveal that robust DNA-PKcs activity in tumors is detrimental to patient survival, whereas germline mutations compromising function are linked to severe immunodeficiency and neuronal degeneration. We anticipate that these collective results will enable ongoing DNA-PKcs functional analyses with biological and medical implications.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Orienting an Organic Semiconductor into DNA 3D Arrays by Covalent Bonds

Abstract A quasi‐one‐dimensional organic semiconductor, hepta(p‐phenylene vinylene) (HPV), was incorporated into a DNA tensegrity triangle motif using a covalent strategy. 3D arrays were self‐assembled from an HPV‐DNA pseudo‐rhombohedron edge by rational design and characterized by X‐ray diffraction. Templated by the DNA motif, HPV molecules exist as single‐molecule fluorescence emitters at the concentration of 8 mM within the crystal lattice. The anisotropic fluorescence emission from HPV‐DNA crystals indicates HPV molecules are well aligned in the macroscopic 3D DNA lattices. Sophisticated nanodevices and functional materials constructed from DNA can be developed from this strategy by addressing functional components with molecular accuracy.

Wang, Xiao↗
DOE OSTI2021

Orienting an Organic Semiconductor into DNA 3D Arrays by Covalent Bonds

We report a quasi-one-dimensional organic semiconductor, hepta(p-phenylene vinylene) (HPV), was incorporated into a DNA tensegrity triangle motif using a covalent strategy. 3D arrays were self-assembled from an HPV-DNA pseudo-rhombohedron edge by rational design and characterized by X-ray diffraction. Templated by the DNA motif, HPV molecules exist as single-molecule fluorescence emitters at the concentration of 8 mM within the crystal lattice. The anisotropic fluorescence emission from HPV-DNA crystals indicates HPV molecules are well aligned in the macroscopic 3D DNA lattices. Sophisticated nanodevices and functional materials constructed from DNA can be developed from this strategy by addressing functional components with molecular accuracy.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗