Search NASA⌕ Search

SEARCH · Search NASA

Results for “Gene Expression”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 records
All sourcesNASA NTRSDOE OSTI
DOE OSTI2021

Nonadditive gene expression is correlated with nonadditive phenotypic expression in interspecific triploid hybrids of willow ( Salix spp.)

Many studies have highlighted the complex and diverse basis for heterosis in inbred crops. Despite the lack of a consensus model, it is vital that we turn our attention to understanding heterosis in undomesticated, heterozygous, and polyploid species, such as willow (Salix spp.). Shrub willow is a dedicated energy crop bred to be fast-growing and high yielding on marginal land without competing with food crops. A trend in willow breeding is the consistent pattern of heterosis in triploids produced from crosses between diploid and tetraploid species. Here, we test whether differentially expressed genes are associated with heterosis in triploid families derived from diploid Salix purpurea, diploid Salix viminalis, and tetraploid Salix miyabeana parents. Three biological replicates of shoot tips from all family progeny and parents were collected after 12 weeks in the greenhouse and RNA extracted for RNA-Seq analysis. This study provides evidence that nonadditive patterns of gene expression are correlated with nonadditive phenotypic expression in interspecific triploid hybrids of willow. Expression-level dominance was most correlated with heterosis for biomass yield traits and was highly enriched for processes involved in starch and sucrose metabolism. In addition, there was a global dosage effect of parent alleles in triploid hybrids, with expression proportional to copy number variation. Importantly, differentially expressed genes between family parents were most predictive of heterosis for both field and greenhouse collected traits. Altogether, these data will be used to progress models of heterosis to complement the growing genomic resources available for the improvement of heterozygous perennial bioenergy crops.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

A modular chromosomally integrated toolkit for ectopic gene expression in Vibrio cholerae

The ability to express genes ectopically in bacteria is essential for diverse academic and industrial applications. Two major considerations when utilizing regulated promoter systems for ectopic gene expression are (1) the ability to titrate gene expression by addition of an exogenous inducer and (2) the leakiness of the promoter element in the absence of the inducer. Here, we describe a modular chromosomally integrated platform for ectopic gene expression in Vibrio cholerae . We compare the broadly used promoter elements P tac and P BAD to versions that have an additional theophylline-responsive riboswitch (P tac -riboswitch and P BAD -riboswitch). These constructs all exhibited unimodal titratable induction of gene expression, however, max induction varied with P tac > P BAD > P BAD -riboswitch > P tac -riboswitch. We also developed a sensitive reporter system to quantify promoter leakiness and show that leakiness for P tac > P tac -riboswitch > P BAD ; while the newly developed P BAD -riboswitch exhibited no detectable leakiness. We demonstrate the utility of the tightly inducible P BAD -riboswitch construct using the dynamic activity of type IV competence pili in V. cholerae as a model system. The modular chromosomally integrated toolkit for ectopic gene expression described here should be valuable for the genetic study of V. cholerae and could be adapted for use in other species.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Gene expression of functionally-related genes coevolves across fungal species: detecting coevolution of gene expression using phylogenetic comparative methods

Researchers often measure changes in gene expression across conditions to better understand the shared functional roles and regulatory mechanisms of different genes. Analogous to this is comparing gene expression across species, which can improve our understanding of the evolutionary processes shaping the evolution of both individual genes and functional pathways. One area of interest is determining genes showing signals of coevolution, which can also indicate potential functional similarity, analogous to co-expression analysis often performed across conditions for a single species. However, as with any trait, comparing gene expression across species can be confounded by the non-independence of species due to shared ancestry, making standard hypothesis testing inappropriate. We compared RNA-Seq data across 18 fungal species using a multivariate Brownian Motion phylogenetic comparative method (PCM), which allowed us to quantify coevolution between protein pairs while directly accounting for the shared ancestry of the species. Our work indicates proteins which physically-interact show stronger signals of coevolution than randomly-generated pairs. Interactions with stronger empirical and computational evidence also showing stronger signals of coevolution. We examined the effects of number of protein interactions and gene expression levels on coevolution, finding both factors are overall poor predictors of the strength of coevolution between a protein pair. Simulations further demonstrate the potential issues of analyzing gene expression coevolution without accounting for shared ancestry in a standard hypothesis testing framework. Furthermore, our simulations indicate the use of a randomly-generated null distribution as a means of determining statistical significance for detecting coevolving genes with phylogenetically-uncorrected correlations, as has previously been done, is less accurate than PCMs, although is a significant improvement over standard hypothesis testing. These methods are further improved by using a phylogenetically-corrected correlation metric. Our work highlights potential benefits of using PCMs to detect gene expression coevolution from high-throughput omics scale data. This framework can be built upon to investigate other evolutionary hypotheses, such as changes in transcription regulatory mechanisms across species.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

A transcriptome software comparison for the analyses of treatments expected to give subtle gene expression responses

Background: In this comparative study we evaluate the performance of four software tools: DNAstar-D (DESeq2), DNAstar-E (edgeR), CLC Genomics and Partek Flow for identification of differentially expressed genes (DEGs) using a transcriptome of E. coli. The RNA-seq data are from the effect of below-background radiation 5.5 nGy total dose (0.2nGy/hr) on E. coli grown shielded from natural radiation 655 m below ground in a pre-World War II steel vault. The gene expression response to three supplemented sources of radiation designed to mimic natural background, 1952 – 5720 nGy in total dose (71–208 nGy/hr), are compared to this “radiation-deprived” treatment. In addition, RNA-seq data of Caenorhabditis elegans nematode from similar radiation treatments was analyzed by three of the software packages. Results: In E. coli, the four software programs identified one of the supplementary sources of radiation (KCl) to evoke about 5 times more transcribed genes than the minus-radiation treatment (69–114 differentially expressed genes, DEGs), and so the rest of the analyses used this KCl vs “Minus” comparison. After imposing a 30-read minimum cutoff, one of the DNAStar options shared two of the three steps (mapping, normalization, and statistic) with Partek Flow (they both used median of ratios to normalize and the DESeq2 statistical package), and these two programs identified the highest number of DEGs in common with each other (53). In contrast, when the programs used different approaches in each of the three steps, between 31 and 40 DEGs were found in common. Regarding the extent of expression differences, three of the four programs gave high fold-change results (15–178 fold), but one (DNAstar’s DESeq2) resulted in more conservative fold-changes (1.5–3.5). In a parallel study comparing three qPCR commercial validation software programs, these programs also gave variable results as to which genes were significantly regulated. Similarly, the C. elegans analysis showed exaggerated fold-changes in CLC and DNAstar’s edgeR while DNAstar-D was more conservative. Conclusions: Regarding the extent of expression (fold-change), and considering the subtlety of the very low level radiation treatments, in E. coli three of the four programs gave what we consider exaggerated fold-change results (15 – 178 fold), but one (DNAstar’s DESeq2) gave more realistic fold-changes (1.5–3.5). When RT-qPCR validation comparisons to transcriptome results were carried out, they supported the more conservative DNAstar-D’s expression results. When another model organism’s (nematode) response to these radiation differences was similarly analyzed, DNAstar-D also resulted in the most conservative expression patterns. Therefore, we would propose DESeq2 (“DNAstar-D”) as an appropriate software tool for differential gene expression studies for treatments expected to give subtle transcriptome responses.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRSDate not supplied

Gene expression changes in peripheral blood mononuclear cells of ISS crewmembers suggest impacts of spaceflight on cell death

In space, living organisms are exposed to numerous stress factors including microgravity and space radiation. For humans, these harmful environmental factors have been known to cause negative health impacts such as immune dysfunction. Understanding the mechanisms by which spaceflight impacts human health at the molecular level is critical not only for accurately assessing the risks associated with spaceflight, but also for developing effective countermeasures. This study is part of the Functional Immune Project, intended to determine alterations in crewmembers` immunobiology before, during, and after spaceflight. For this project, blood samples were collected from International Space Station (ISS) crewmembers at the following time points: i) at two pre-flight time points of 180 days (L180) and 45 days (L45) before launch. ii) During flight, blood was drawn at approximately the midpoint (mid-flight, MF) of the mission, and shortly before egress from the ISS (late-flight, LF). iii) Post-flight blood samples were collected within 24 hrs (R0), 30 days (R30) and 90 days (R90) after landing. For each crewmember, blood was also drawn from a matching test subject on the ground at the corresponding time point. For both the ISS crewmembers and the ground control subjects, total RNA was isolated from peripheral blood mononuclear cells (PBMC) and mRNA was analysed using next generation RNA-sequencing (NGS). Differentially expressed genes were determined by performing contrast analysis. Using the data from all of the time points from the ground control subjects as a control, a number of dysregulated genes were identified in astronauts at MF, LF and R0, including downregulations of several cell cycle related genes including CDKN1A and VEGFA at MF and LF. Pathway analysis of these differentially expressed genes indicated that, in space, pathways associated with autophagy and senescence were affected. Our analysis also indicated that the genes related to metabolisms were downregulated in the microgravity environment. Taken together, our data suggests that PBMC in the ISS crewmembers may be starved, resulting in autophagy and delayed senescence in space. Such findings are in agreement with delayed cell death in PBMC under simulated microgravity conditions on the ground and offer an explanation for telomere lengthening that has been reported among the ISS astronauts in flight.

Maria Moreno-Villanueva↗
NASA NTRSDate not supplied

Gene Expression Changes in Peripheral Blood Mononuclear Cells of ISS Crewmembers Suggest Impacts of Spaceflight on Cell Death

In space, living organisms are exposed to numerous stress factors including microgravity and space radiation. For humans, these harmful environmental factors have been known to cause negative health impacts such as immune dysfunction. Understanding the mechanisms by which spaceflight impacts human health at the molecular level is critical not only for accurately assessing the risks associated with spaceflight, but also for developing effective countermeasures. This study is part of the Functional Immune Project, intended to determine alterations in crewmembers` immunobiology before, during, and after spaceflight. For this project, blood samples were collected from International Space Station (ISS) crewmembers at the following time points: i) at two pre-flight time points of 180 days (L180) and 45 days (L45) before launch. ii) During flight, blood was drawn at approximately the midpoint (mid-flight, MF) of the mission, and shortly before egress from the ISS (late-flight, LF). iii) Post-flight blood samples were collected within 24 hrs (R0), 30 days (R30) and 90 days (R90) after landing. For each crewmember, blood was also drawn from a matching test subject on the ground at the corresponding time point. For both the ISS crewmembers and the ground control subjects, total RNA was isolated from peripheral blood mononuclear cells (PBMC) and mRNA was analysed using next generation RNA-sequencing (NGS). Differentially expressed genes were determined by performing contrast analysis. Using the data from all of the time points from the ground control subjects as a control, a number of dysregulated genes were identified in astronauts at MF, LF and R0, including downregulations of several cell cycle related genes including CDKN1A and VEGFA at MF and LF. Pathway analysis of these differentially expressed genes indicated that, in space, pathways associated with autophagy and senescence were affected. Our analysis also indicated that the genes related to metabolisms were downregulated in the microgravity environment. Taken together, we hypothesize that PBMC in the ISS crewmembers may be starved, resulting in autophagy and delayed senescence in space. Such findings are in agreement with delayed cell death in PBMC under simulated microgravity conditions on the ground and offer an explanation for telomere lengthening that has been reported among the ISS astronauts in flight

Maria Moreno-Villanueva↗
DOE OSTI2020

Single‐parent expression drives dynamic gene expression complementation in maize hybrids

SUMMARY Single‐parent expression (SPE) is defined as gene expression in only one of the two parents. SPE can arise from differential expression between parental alleles, termed non‐presence/absence (non‐PAV) SPE, or from the physical absence of a gene in one parent, termed PAV SPE. We used transcriptome data of diverse Zea mays (maize) inbreds and hybrids, including 401 samples from five different tissues, to test for differences between these types of SPE genes. Although commonly observed, SPE is highly genotype and tissue specific. A positive correlation was observed between the genetic distance of the two inbred parents and the number of SPE genes identified. Regulatory analysis showed that PAV SPE and non‐PAV SPE genes are mainly regulated by cis effects, with a small fraction under trans regulation. Polymorphic transposable element insertions in promoter sequences contributed to the high level of cis regulation for PAV SPE and non‐PAV SPE genes. PAV SPE genes were more frequently expressed in hybrids than non‐PAV SPE genes. The expression of parentally silent alleles in hybrids of non‐PAV SPE genes was relatively rare but occurred in most hybrids. Non‐PAV SPE genes with expression of the silent allele in hybrids are more likely to exhibit above high parent expression level than hybrids that do not express the silent allele, leading to non‐additive expression. This study provides a comprehensive understanding of the nature of non‐PAV SPE and PAV SPE genes and their roles in gene expression complementation in maize hybrids.

Li, Zhi↗
DOE OSTI2025

Changes in leaf economic trait relationships across a precipitation gradient are related to differential gene expression in a C 4 perennial grass

Summary The leaf economics spectrum (LES) describes a suite of functional traits that consistently covary at large spatial and taxonomic scales. Despite its importance at these larger scales, few studies have examined the major drivers of intraspecific variation in the LES – phenotypic plasticity and standing genetic variation. Using experimental precipitation manipulations, we examined whether covariation among leaf economics traits and selection on leaf economics traits and trait combinations change as diverse genotypes of the widespread perennial grass Panicum virgatum are exposed to differences in precipitation. We also used RNA‐Seq to examine whether groups of co‐expressed genes that align with leaf economics traits function in processes hypothesized to underlie the LES. Water availability impacted leaf economics trait covariation in important ways – covariation between leaf economics traits and selection on covariation between traits (i.e. correlational selection) tended to be strongest when water availability was high. Additionally, many genes associated with leaf economics traits functioned in processes that may explain how the LES originates, such as chloroplasts, cell walls, and nitrogen metabolism. Water availability is likely an important modulator of selection and evolution of the LES in P. virgatum that can be better understood by examining gene expression.

Heckman, Robert W. [Department of Integrative Biol↗
DOE OSTI2020

COnTORT: COmprehensive Transcriptomic ORganizational Tool for Simultaneously Retrieving and Organizing Numerous Gene Expression Data Sets from the NCBI Gene Expression Omnibus Database

We introduce COnTORT ( CO mprehensive T ranscriptomic OR ganizational T ool), a publicly available program that retrieves all available gene expression data and associated metadata for an organism from the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database. The data are compiled into text files that can be used for downstream bioinformatic applications.

Myers, Kevin S.↗
DOE OSTI2024

The quantitative genetics of gene expression in Mimulus guttatus

Gene expression can be influenced by genetic variants that are closely linked to the expressed gene (cis eQTLs) and variants in other parts of the genome (trans eQTLs). We created a multiparental mapping population by sampling genotypes from a single natural population of Mimulus guttatus and scored gene expression in the leaves of 1,588 plants. We find that nearly every measured gene exhibits cis regulatory variation (91% have FDR < 0.05). cis eQTLs are usually allelic series with three or more functionally distinct alleles. The cis locus explains about two thirds of the standing genetic variance (on average) but varies among genes and tends to be greatest when there is high indel variation in the upstream regulatory region and high nucleotide diversity in the coding sequence. Despite mapping over 10,000 trans eQTL / affected gene pairs, most of the genetic variance generated by trans acting loci remains unexplained. This implies a large reservoir of trans acting genes with subtle or diffuse effects. Mapped trans eQTLs show lower allelic diversity but much higher genetic dominance than cis eQTLs. Several analyses also indicate that trans eQTLs make a substantial contribution to the genetic correlations in expression among different genes. They may thus be essential determinants of “gene expression modules,” which has important implications for the evolution of gene expression and how it is studied by geneticists.

59 BASIC BIOLOGICAL SCIENCES↗
NASA NTRS2012

Gene Expression Measurement Module (GEMM) - A Fully Automated, Miniaturized Instrument for Measuring Gene Expression in Space

The capability to measure gene expression on board spacecraft opens the door to a large number of high-value experiments on the influence of the space environment on biological systems. For example, measurements of gene expression will help us to understand adaptation of terrestrial life to conditions beyond the planet of origin, identify deleterious effects of the space environment on a wide range of organisms from microbes to humans, develop effective countermeasures against these effects, and determine the metabolic bases of microbial pathogenicity and drug resistance. These and other applications hold significant potential for discoveries in space biology, biotechnology, and medicine. Supported by funding from the NASA Astrobiology Science and Technology Instrument Development Program, we are developing a fully automated, miniaturized, integrated fluidic system for small spacecraft capable of in-situ measurement of expression of several hundreds of microbial genes from multiple samples. The instrument will be capable of (1) lysing cell walls of bacteria sampled from cultures grown in space, (2) extracting and purifying RNA released from cells, (3) hybridizing the RNA on a microarray and (4) providing readout of the microarray signal, all in a single microfluidics cartridge. The device is suitable for deployment on nanosatellite platforms developed by NASA Ames' Small Spacecraft Division. To meet space and other technical constraints imposed by these platforms, a number of technical innovations are being implemented. The integration and end-to-end technological and biological validation of the instrument are carried out using as a model the photosynthetic bacterium Synechococcus elongatus, known for its remarkable metabolic diversity and resilience to adverse conditions. Each step in the measurement process-lysis, nucleic acid extraction, purification, and hybridization to an array-is assessed through comparison of the results obtained using the instrument with those from standard laboratory protocols. Once developed, the system can be used with minor modifications for multiple experiments on different platforms in space, including extension to higher organisms and microbial monitoring. A proposed version of GEMM that is capable of handling both microbial and tissue samples on the International Space Station will be briefly summarized.

Pohorille, Andrew↗
DOE OSTI2021

Development of dual‐inducible duet‐expression vectors for tunable gene expression control and CRISPR interference‐based gene repression in Pseudomonas putida KT2440

Summary The development of P. putida as an industrial host requires a sophisticated molecular toolbox for strain improvement, including vectors for gene expression and repression. To augment existing expression plasmids for metabolic engineering, we developed a series of dual‐inducible duet‐expression vectors for P. putida KT2440. A number of inducible promoters (P lac , P tac , P tetR/tetA and P bad ) were used in different combinations to differentially regulate the expression of individual genes. Protein expression was evaluated by measuring the fluorescence of reporter proteins (GFP and RFP). Our experiments demonstrated the use of compatible plasmids, a useful approach to coexpress multiple genes in P. putida KT2440. These duet vectors were modified to generate a fully inducible CRISPR interference system using two catalytically inactive Cas9 variants from S. pasteurianus (dCas9) and S. pyogenes (spdCas9). The utility of developed CRISPRi system(s) was demonstrated by repressing the expression of nine conditionally essential genes, resulting in growth impairment and prolonged lag phase for P. putida KT2440 growth on glucose. Furthermore, the system was shown to be tightly regulated, tunable and to provide a simple way to identify essential genes with an observable phenotype.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Phenotypically anchored transcriptomics across diverse agrichemicals reveals conserved pathways and unique gene expression signatures in zebrafish

Agrichemicals such as herbicides, fungicides, insecticides, and biocides are widely used in agriculture, yet some are associated with adverse effects in humans and the environment. While many of these chemicals have been extensively studied in vitro and are included in the EPA’s ToxCast program, comprehensive in vivo comparisons using RNA sequencing across structurally diverse agrichemicals, in a single screening platform, are lacking. In this study, we examined structurally diverse agrichemicals found in the U.S. Environmental Protection Agency’s (EPA) Toxcast Phase I and II library by statically exposing early life stage zebrafish at 6 h post fertilization (hpf) until 120 hpf at concentrations ranging from 0.25 to 100 µM. Morphological outcomes were assessed at 120 hpf across 10 endpoints, including yolk sac edema, craniofacial malformations, and axis abnormalities. Chemicals that produced robust concentration-response relationships were selected for transcriptomic profiling. For transcriptomic analysis, zebrafish were statically exposed to each chemical and sampled at 48 hpf, prior to the onset of morphological effects observed at 120 hpf. Differential expression analysis identified between 0 and 4,538 differentially expressed genes (DEGs) per chemical, with no clear correlation to morphological severity. Both DEG and co-expression network analyses revealed chemical-specific expression patterns that converged on shared biological pathways, including neurodevelopment and cytoskeletal organization. Key regulatory genes such as mylpfa and krt4 were identified within co-expression modules, suggesting their potential role in conserved toxicity mechanisms. Semantic similarity analysis of enriched gene ontology (GO) terms, when compared to existing datasets, highlighted gaps in the annotation of neurodevelopmental processes, indicating that some in vivo effects may not be fully captured by current curated resources. The results provide new insights into the modes of action of diverse agrichemicals and establish a framework for understanding how agrichemical structure relates to biological function in a vertebrate model.

agrichemical↗
DOE OSTI2022

Concentration-response gene expression analysis in zebrafish reveals phenotypically-anchored transcriptional responses to retene

Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous environmental contaminants and are associated with human disease. Canonically, many PAHs induce toxicity via activation of the aryl hydrocarbon receptor (AHR) pathway. While the interaction between PAHs and the AHR is well-established, understanding which AHR-regulated transcriptional effects directly result in observable phenotypes and which are adaptive or benign is important to better understand PAH toxicity. Retene is a frequently detected PAH in environmental sampling and has been associated with AHR2-dependent developmental toxicity in zebrafish, though its mechanism of toxicity has not been fully elucidated. To interrogate transcriptional changes causally associated with retene toxicity, we conducted whole-animal RNA sequencing at 48 hours post-fertilization after exposure to eight retene concentrations. The concentrations were selected to produce effects ranging from no phenotype to mortality and malformations in 100% of animals at 5 days post-fertilization. We identified a concentration-response relationship between retene teratogenicity and differential gene expression in both number of DEGs and magnitude of expression change. Elevated expression of cyp1a at retene concentrations below the threshold for teratogenicity suggested that while cyp1a expression is a sensitive biomarker of AHR activation, it may be too sensitive to serve as a biomarker of AHR-dependent teratogenicity. Genes differentially expressed at only non-teratogenic concentrations were enriched for transforming growth factor-ß (TGF-ß) signaling pathway disruption while DEGs identified at only teratogenic concentrations were significantly enriched for response to xenobiotic stimulus and reduction-oxidation reaction activity. DEGs which spanned both non-teratogenic and teratogenic concentrations showed similar disrupted biological processes to those unique to teratogenic concentrations, indicating these processes were disrupted at low exposure concentrations. Gene co-expression network analysis identified several gene modules, including those associated with PAHs and AHR2 activation. One, Module 7, was strongly enriched for AHR2-associated genes and contained the strongest responses to retene. Benchmark concentration (BMC) of Module 7 genes identified a median BMC of 7.5 µM, nearly the highest retene concentration with no associated teratogenicity, supporting the hypothesis that Module 7 genes are largely responsible for retene toxicity.

Toxin, Zebrafish, Retene, Transcriptomics, network↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Feed status and skin injury modulate immunopathology, global gene expression, and survival in channel catfish during virulent Aeromonas hydrophila infection

Introduction VirulentAeromonas hydrophilais a major pathogen in channel catfish (Ictalurus punctatus), that causes motileAeromonassepticemia and significant economic losses. We investigated the effect of feeding status and skin integrity on the host immune response, disease survival, and gastrointestinal pathology following a vAh challenge. Methods Using a bath immersion model, channel catfish were divided into four treatment groups: fin clipped and fed (FCF), fin clipped but not fed (FCN), not fin clipped but fed (NCF), and not fin clipped nor fed (NCN) alongside non-challenged control groups The FCF and NCF groups were fed 2 h prior to the challenge, but the FCN and NCN groups were not. Survival analysis, histopathological assessment, and RNA sequencing were conducted across groups at different time intervals throughout the vAh challenge. Results Survival rates were lowest in the FCF and FCN groups (30% and 23% survival, respectively), suggesting that both feeding and skin damage contributed to disease severity. Histopathological analyses revealed more severe intestinal and gastric lesions in fed groups, characterized by epithelial necrosis, hemorrhage, and edema. Transcriptomic analysis among the groups identified significant differentially expressed genes associated with inflammation, apoptosis, and metabolic stress, with notable upregulation of interleukin 1-beta (il-1β), and complement C3 (c3). Gene ontology enrichment highlighted distinct immune activation patterns between fed and unfed groups, with enhanced pathogen recognition and pro-inflammatory responses in unfed fish. Discussion These findings suggest feeding prior to infection may exacerbate disease pathology, potentially by creating a physiological state conducive to facilitate pathogen proliferation and dampened early immune responses, whereas short-term fasting appears to promote early immune activation. This study provides novel insights into the complex interplay between feed status, physical injury, and immune response to vAh infection.

Immunology↗
DOE OSTI2021

Long-Term Effects of Very Low Dose Particle Radiation on Gene Expression in the Heart: Degenerative Disease Risks

Compared to low doses of gamma irradiation (γ-IR), high-charge-and-energy (HZE) particle IR may have different biological response thresholds in cardiac tissue at lower doses, and these effects may be IR type and dose dependent. Three- to four-month-old female CB6F1/Hsd mice were exposed once to one of four different doses of the following types of radiation: γ-IR 137Cs (40-160 cGy, 0.662 MeV), 14Si-IR (4-32 cGy, 260 MeV/n), or 22Ti-IR (3-26 cGy, 1 GeV/n). At 16 months post-exposure, animals were sacrificed and hearts were harvested and archived as part of the NASA Space Radiation Tissue Sharing Forum. These heart tissue samples were used in our study for RNA isolation and microarray hybridization. Functional annotation of twofold up/down differentially expressed genes (DEGs) and bioinformatics analyses revealed the following: (i) there were no clear lower IR thresholds for HZE- or γ-IR; (ii) there were 12 common DEGs across all 3 IR types; (iii) these 12 overlapping genes predicted various degrees of cardiovascular, pulmonary, and metabolic diseases, cancer, and aging; and (iv) these 12 genes revealed an exclusive non-linear DEG pattern in 14Si- and 22Ti-IR-exposed hearts, whereas two-thirds of γ-IR-exposed hearts revealed a linear pattern of DEGs. Thus, our study may provide experimental evidence of excess relative risk (ERR) quantification of low/very low doses of full-body space-type IR-associated degenerative disease development.

63 RADIATION, THERMAL, AND OTHER ENVIRON. POLLUTAN↗