Search NASA⌕ Search

SEARCH · Search NASA

Results for “Poplar”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 records
All sourcesNASA NTRSDOE OSTI
DOE OSTI2025

Effects of chemical composition and physicochemical properties of poplar biomass on the performance of 3D printed poplar-reinforced PLA materials

Lignocellulosic biomass has been well-acknowledged as a filler for making 3D printed composites. The technical performances of composites were influenced by the characteristics of the components. The correlations between poplar biomass properties and the mechanical and thermal performances of the 3D printed poplar-plastic composites were investigated. The characteristics of poplar were modified by different pretreatment methods, including using hot water, dilute acid, and organic solvent (organosolv), and each treated poplar biomass was applied as a filler in a polylactic acid (PLA) polymer matrix to produce eco-friendly materials. These solvent pretreatments increased the hydrophobicity and surface area of poplar. Organosolv treated poplar showed the highest cellulose content and significantly increased Young's modulus of its biocomposites. Principal component analysis revealed that the specific surface area and water contact angle of biomass contributed to the thermal stability of biocomposites. Additionally, the degree of polymerization of cellulose and xylan content within the biomass correlated with the biocomposites' break stress. Notably, the crystallinity of biocomposites impacted the modulus of these materials. The reported relationships between biomass characteristics and 3D printed composite behaviors provide guidance for optimizing biomass processing in biocomposite applications.

Ji, Anqi [State Univ. of New York (SUNY), Syracuse↗
DOE OSTI2024

SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach (Final Report)

SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach In the SyPro Poplar project, we aimed to integrate omics, bioinformatics, synthetic biology, and genetic engineering approaches to develop transgenic poplar trees with sustained photosynthetic activity and increased biomass production under individual and the simultaneous occurrence of water deficit, increased soil salinity, and elevated temperatures. Specifically, we intended to (i) study the functions of selected stress-responsive genes at tissue and cell type-specific levels, (ii) discover novel motifs and construct stress-responsive synthetic promoters, and (iii) use these promoters to drive the expression of genes shown to confer abiotic stress tolerance in a variety of crops and develop abiotic stress-tolerant poplars in a coordinated fashion.

09 BIOMASS FUELS↗
DOE OSTI2025

Tonoplast Sucrose Transporter SUT4-Dependent Sugar Partitioning Modulates Phenological Transitions and Reproductive Success in Poplar

Climate uncertainty is intensifying the need for greater plasticity in carbohydrate reserve utilization to support winter survival and spring growth in woody perennials. In poplar, the single-copy SUT4, which encodes a tonoplast-localized sucrose transporter, and the SUT5/SUT6 genome duplicates, which encode plasma membrane-localized transporters, are expressed year-round, with SUT4 showing the highest expression during cool seasons. Given its role in vacuolar sucrose efflux and winter-predominant expression, SUT4 may play a key role in modulating seasonal carbohydrate dynamics. While SUT4-knockdown and knockout effects have been studied under greenhouse conditions, their impact under field conditions remains unexplored. Here, we report a field-based study comparing CRISPR knockout mutants of winter-expressed SUT4 and SUT5/SUT6 in Populus tremula x alba. We show that sut4, but not sut5/6, mutants exhibited earlier autumn leaf senescence, delayed spring bud flush, reduced stem growth, and altered sugar partitioning in winter xylem and bark relative to controls. After 2 years in the field, all genotypes flowered before leaf flush in early spring; however, sut4 mutants produced sterile ovules despite developing normal-looking catkins. Metabolic profiling revealed disrupted sucrose and raffinose dynamics in elongating sut4 catkins. This was accompanied by transcriptomic signatures of elevated stress and downregulation of proanthocyanidin biosynthesis and circadian clock genes. These findings highlight the critical role of SUT4 in coordinating sugar allocation, stress responses, and seasonal development in poplar.

09 BIOMASS FUELS↗
DOE OSTI2020

Vacuum Pyrolysis of Hybrid Poplar Milled Wood Lignin with Fourier Transform-Ion Cyclotron Resonance Mass Spectrometry Analysis of Feedstock and Products for the Elucidation of Reaction Mechanisms

The pyrolysis of lignocellulosic materials is a promising technique to produce fuels and chemicals. It is well known that the most abundant products of lignin pyrolysis are oligomeric molecules, known as pyrolytic lignin (PL). The chemical composition of PL has been extensively studied; however, there is still an important debate whether these oligomers are produced directly from the lignin or from the recombination of monomeric pyrolytic products. Existing theories are unable to describe the effect of vacuum on the distribution of pyrolysis products. Hybrid poplar milled wood lignin (MWL) was initially isolated and thoroughly characterized by Fourier transform-ion cyclotron resonance mass spectrometry (FT-ICR MS). Chemical formulas were assigned to each oligomeric compound detected. The MWL was also subjected to vacuum pyrolysis in a modified pyroprobe at 250, 750, and 1000 mbar (absolute pressure), and the resulting liquid products were analyzed by FT-ICR MS. A new strategy to assign structural representations to the oligomeric PL products is proposed, based on the plausible pyrolysis reaction mechanisms of depolymerization/fragmentation applied to original MWL oligomer formulas. Our results support the hypothesis that PL is formed from the removal of moieties from primary lignin pyrolysis products with between three and five aromatic rings. This depolymerization/fragmentation allows the oligomers to reduce their molecular weights to the point where they can be removed from the reaction zone by direct vaporization. Furthermore, this phenomenon highlights the importance of pressure on removal mechanisms and their impact on the molecular weight of the resulting products from lignin pyrolysis.

09 BIOMASS FUELS↗
DOE OSTI2020

Compensatory Guaiacyl Lignin Biosynthesis at the Expense of Syringyl Lignin in 4CL1 -Knockout Poplar -Knockout Poplar

The lignin biosynthetic pathway is highly conserved in angiosperms, yet pathway manipulations give rise to a variety of taxon-specific outcomes. Knockout of lignin-associated 4-coumarate:CoA ligases (4CLs) in herbaceous species mainly reduces guaiacyl (G) lignin and enhances cell wall saccharification. In this work we show that CRISPR-knockout of 4CL1 in poplar (Populus tremula x alba) preferentially reduced syringyl (S) lignin, with negligible effects on biomass recalcitrance. Concordant with reduced S-lignin was downregulation of ferulate 5-hydroxylases (F5Hs). Lignification was largely sustained by 4CL5, a low-affinity paralog of 4CL1 typically with only minor xylem expression or activity. Levels of caffeate, the preferred substrate of 4CL5, increased in line with significant upregulation of caffeoyl shikimate esterase1. Upregulation of caffeoyl-CoA O-methyltransferase1 and downregulation of F5Hs are consistent with preferential funneling of 4CL5 products toward G-lignin biosynthesis at the expense of S-lignin. Thus, transcriptional and metabolic adaptations to 4CL1-knockout appear to have enabled 4CL5 catalysis at a level sufficient to sustain lignification. Finally, genes involved in sulfur assimilation, the glutathione-ascorbate cycle, and various antioxidant systems were upregulated in the mutants, suggesting cascading responses to perturbed thioesterification in lignin biosynthesis.

09 BIOMASS FUELS↗
DOE OSTI2023

Bark morphological and chemical features are differentially correlated with disease resistance and yield in hybrid poplar taxa

In the southeastern United States, the establishment of short-rotation intensively cultured plantations of hybrid poplar has been hindered by its susceptibility to stem cankers. We evaluated the tradeoffs between biomass yield and disease tolerance in hybrid poplar genotypes belonging to P. deltoides × P. maximowiczii (DM), P. deltoides × P. nigra (DN), P. trichocarpa × P. maximowiczii (TM), and P. deltoides × P. deltoides (DD) taxa. We hypothesized that canker resistant genotypes will have thicker bark but bark thickness and biomass yield will be negatively correlated. After two growing seasons, the DD genotypes developed thicker bark compared to the genotypes of other taxa and bark thickness was not correlated with biomass yield in the DD genotypes (R 2 = 0.002). However, in the TM, DM, and DN genotypes, bark thickness was negatively correlated with biomass yield (R 2 = 0.33–0.77). Disease incidence studies revealed that the DM genotypes were most susceptible to canker whereas no disease was detected in DD genotypes. Furthermore, bark analysis conducted by Fourier transform infrared spectroscopy coupled with multivariate analysis showed that that DD genotypes to be chemically separate from the three hybrid genotypes and that bark chemistry was correlated with canker disease incidence. Taken together, these results reveal that it is possible to generate hybrid poplar genotypes with thicker bark, disease resistance, and higher biomass yields. This insight should guide further efforts to develop genetically improved hybrid poplar genotypes, both in terms of biomass yield and disease tolerance, for cultivation in the southeastern United States. Hybrid poplar cultivation in southeastern United States is hindered by its susceptibility to stem cankers. We evaluated tradeoffs between yield and canker disease resistance in various hybrid poplar genotypes. After two growing seasons, the DD genotypes showed disease resistance and developed thicker bark that was chemically distinct from the other genotypes. Bark thickness was not correlated with yield in the DD genotypes but was negatively correlated with yield in the other genotypes. These results will guide the development of hybrid poplar genotypes that are both disease resistant and high yielding for cultivation in the southeastern United States.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2025

Inorganic acid-catalyzed hydrogen peroxide-acetic acid pretreatment for selective delignification of poplar

Effects of different inorganic acids as catalysts on the delignification ability of hydrogen peroxide-acetic acid (HPAA) pretreatment were unclear. Herein, the oxidizability of HCl, HBr, H 2 SO 4 , and H 3 PO 4 -catalyzed HPAA on the delignification of poplar were investigated. The ionized H + from inorganic acids catalyzed the synthesis of peracetic acid and improved the oxidizability of HPAA. The anion of inorganic acids caused ineffective decomposition of peroxides and inorganic acids. After the addition of poplar, the H 2 SO 4 -catalyzed HPAA pretreatment exhibited the lowest pH than other inorganic acids catalyzed systems. After the catalysis by inorganic acid, HPAA removed 78.1–91.4 % poplar lignin. Compared with other inorganic acids, the H + of H 2 SO 4 exhibited superior retention in HPAA pretreatment of poplar. After poplar pretreated with the same initial pH value of inorganic acid-catalyzed HPAA, the H 2 SO 4 -catalyzed HPAA showed the strongest delignification ability of poplar. The presence of free radicals in inorganic acid-catalyzed HPAA was unnecessary for the delignification of poplar. Furthermore, this paper elucidated that the ionized H + of inorganic acid mainly enhanced the oxidizability of HPAA for the selectively delignification of ability of HPAA pretreatment.

In-situ synthesis↗
DOE OSTI2025

The effects of expression of a hyperthermophilic endoglucanase and nutrient conditions on poplar growth and physiology

Abstract Efficient production and processing of poplar biomass feedstock requires costly pretreatments and enzyme additives. Transgenic alterations of poplar can reduce the need for these inputs by increasing biomass, improving lignocellulose quality and enhancing nutrient uptake. Previously, a transgenic line of poplar expressing a bacterial hyperthermophilic endoglucanase (TnCelB) in Populus alba × grandidentata (P39) was developed and characterized. This study reports the effects on the TnCelB transgenic poplar line under a reduced nutrient treatment. Overall, the nutrient treatment was the source of more observed significant differences than the genotype. Wild type and TnCelB poplar had similar responses in biomass allocation and net photosynthesis. TnCelB trees had a wrinkled leaf phenotype and relative to wild type, had reduced total biomass, reduced water-use efficiency, and a decreased proportion of cellulose to hemicellulose and lignin. In low nutrient conditions, TnCelB trees had increased structural carbohydrates with stable lignin values. The TnCelB line presents a viable option for poplar biomass feedstock, offering biomass comparable to wild type poplar and more efficient processing, with only mild negative phenotypes.

Natalie, Bethanie M. (ORCID:0009000843856585)↗
DOE OSTI2020

Use of the lignocellulose-degrading bacterium Caldicellulosiruptor bescii to assess recalcitrance and conversion of wild-type and transgenic poplar

Abstract Background Biological conversion of lignocellulosic biomass is significantly hindered by feedstock recalcitrance, which is typically assessed through an enzymatic digestion assay, often preceded by a thermal and/or chemical pretreatment. Here, we assay 17 lines of unpretreated transgenic black cottonwood ( Populus trichocarpa ) utilizing a lignocellulose-degrading, metabolically engineered bacterium, Caldicellulosiruptor bescii . The poplar lines were assessed by incubation with an engineered C. bescii strain that solubilized and converted the hexose and pentose carbohydrates to ethanol and acetate. The resulting fermentation titer and biomass solubilization were then utilized as a measure of biomass recalcitrance and compared to data previously reported on the transgenic poplar samples. Results Of the 17 transgenic poplar lines examined with C. bescii , a wide variation in solubilization and fermentation titer was observed. While the wild type poplar control demonstrated relatively high recalcitrance with a total solubilization of only 20% and a fermentation titer of 7.3 mM, the transgenic lines resulted in solubilization ranging from 15 to 79% and fermentation titers from 6.8 to 29.6 mM. Additionally, a strong inverse correlation ( R 2 = 0.8) between conversion efficiency and lignin content was observed with lower lignin samples more easily converted and solubilized by C. bescii . Conclusions Feedstock recalcitrance can be significantly reduced with transgenic plants, but finding the correct modification may require a large sample set to identify the most advantageous genetic modifications for the feedstock. Utilizing C. bescii as a screening assay for recalcitrance, poplar lines with down-regulation of coumarate 3-hydroxylase 3 (C3H3) resulted in the highest degrees of solubilization and conversion by C. bescii . One such line, with a growth phenotype similar to the wild-type, generated more than three times the fermentation products of the wild-type poplar control, suggesting that excellent digestibility can be achieved without compromising fitness of the tree.

09 BIOMASS FUELS↗
DOE OSTI2021

Field evaluation of transgenic hybrid poplars with desirable wood properties and enhanced growth for biofuel production by bicistronic expression of PdGA20ox1 and PtrMYB3 in wood-forming tissue

Background: To create an ideotype woody bioenergy crop with desirable growth and biomass properties, we utilized the viral 2A-meidated bicistronic expression strategy to express both PtrMYB3 ( MYB46 ortholog of Populus trichocarpa , a master regulator of secondary wall biosynthesis) and PdGA20ox1 (a GA20-oxidase from Pinus densiflora that produces gibberellins) in wood-forming tissue (i.e., developing xylem). Results: Transgenic Arabidopsis plants expressing the gene construct DX15::PdGA20ox1-2A-PtrMYB3 showed a significant increase in both stem fresh weight (threefold) and secondary wall thickening (1.27-fold) relative to wild-type (WT) plants. Transgenic poplars harboring the same gene construct grown in a greenhouse for 60 days had a stem fresh weight up to 2.6-fold greater than that of WT plants. In a living modified organism (LMO) field test conducted for 3 months of active growing season, the stem height and diameter growth of the transgenic poplars were 1.7- and 1.6-fold higher than those of WT plants, respectively, with minimal adverse growth defects. Although no significant changes in secondary wall thickening of the stem tissue of the transgenic poplars were observed, cellulose content was increased up to 14.4 wt% compared to WT, resulting in improved saccharification efficiency of the transgenic poplars. Moreover, enhanced woody biomass production by the transgenic poplars was further validated by re-planting in the same LMO field for additional two growing seasons. Conclusions: Taken together, these results show considerably enhanced wood formation of our transgenic poplars, with improved wood quality for biofuel production.

09 BIOMASS FUELS↗
DOE OSTI2020

Genetic identification of 91 poplar cultivars based on SSR markers

Accurate genetic identification and relationship analysis of poplar cultivars is necessary to establish commercial poplar plantations and select suitable breeding strategies. In this study, 91 poplar cultivars belonging to four sections (Aigeiros, Tacamahaca, Populus and Turanga) and inter/intra-sectional hybrids were genotyped using 18 polymorphic simple sequence repeat (SSR) markers. In total, 222 alleles were amplified with an average of 12.3 alleles per marker. The mean polymorphic information content and power of discrimination were 0.706 and 0.813, respectively. Five SSR markers (ORPM_103, ORPM_247, GCPM_1048, GCPM_1255 and LG_X_19) constituted a core fingerprint and were sufficient to identify all the tested cultivars. With some notable exceptions, cultivars of the same species generally clustered together in cluster (UPGMA) and ordination (PCO) analyses. Flow cytometry indicated that 11 poplar cultivars were triploid. Among these, seven had three alleles at some loci, suggesting that SSR markers could indicate the ploidy level to some extent. This study provides useful genetic information for the identification and protection of poplar cultivars in China and offers a guideline for the selection of poplar crossing parents based on ploidy level and genetic relationships.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Elucidating Mechanisms of Rust Pathogenesis for Engineering Resistance in Poplar

The overall objective of this research was to elucidate the molecular basis for the virulence of Melampsora larici-populina towards Populus spp. in order to address the formidable challenge of engineering durable resistance in poplar against leaf rust. Our original research plan was built on the technically innovative approach of using dual host systems and known host defense proteins and pathogen avirulent effectors along with genome-wide approaches to identify key pathogenesis effectors of Melampsora larici-populina that target poplar defense and nutrient acquisition. Our efforts focused on developing high-throughput experimental approaches and systems to enable us to address our overarching hypothesis that rust effectors with homology to other fungal effectors will either bypass the poplar immune system and/or suppress effector-triggered immunity through conserved mechanisms, and that an analysis of these interaction networks would provide for new approaches to develop rust-resistant poplar. Three main objectives were originally proposed: (1) mine key rust effectors that suppress host immunity; (2) elucidate interaction networks in poplar targeted by key rust effectors; (3) generate transgenic poplar resources for identification of genes involved in pathogen infection or host defense triggered by rust. Generally, we worked towards all three objectives by developing and applying complementary molecular, genomic, biochemical and plant transformation approaches.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2021

Genetic Modification of KNAT7 Transcription Factor Expression Enhances Saccharification and Reduces Recalcitrance of Woody Biomass in Poplars

The precise role of KNAT7 transcription factors (TFs) in regulating secondary cell wall (SCW) biosynthesis in poplars has remained unknown, while our understanding of KNAT7 functions in other plants is continuously evolving. To study the impact of genetic modifications of homologous and heterologous KNAT7 gene expression on SCW formation in transgenic poplars, we prepared poplar KNAT7 ( PtKNAT7 ) overexpression ( PtKNAT7 -OE) and antisense suppression ( PtKNAT7 -AS) vector constructs for the generation of transgenic poplar lines via Agrobacterium -mediated transformation. Since the overexpression of homologous genes can sometimes result in co-suppression, we also overexpressed Arabidopsis KNAT7 ( AtKNAT7-OE ) in transgenic poplars. In all these constructs, the expression of KNAT7 transgenes was driven by developing xylem (DX)-specific promoter, DX15. Compared to wild-type (WT) controls, many SCW biosynthesis genes downstream of KNAT7 were highly expressed in poplar PtKNAT7-OE and AtKNAT7-OE lines. Yet, no significant increase in lignin content of woody biomass of these transgenic lines was observed. PtKNAT7-AS lines, however, showed reduced expression of many SCW biosynthesis genes downstream of KNAT7 accompanied by a reduction in lignin content of wood compared to WT controls. Syringyl to Guaiacyl lignin (S/G) ratios were significantly increased in all three KNAT7 knockdown and overexpression transgenic lines than WT controls. These transgenic lines were essentially indistinguishable from WT controls in terms of their growth phenotype. Saccharification efficiency of woody biomass was significantly increased in all transgenic lines than WT controls. Overall, our results demonstrated that developing xylem-specific alteration of KNAT7 expression affects the expression of SCW biosynthesis genes, impacting at least the lignification process and improving saccharification efficiency, hence providing one of the powerful tools for improving bioethanol production from woody biomass of bioenergy crops and trees.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Genetically engineered poplar wood effectively enhances the efficiency of deep eutectic solvent-mediated one-pot processing

Although lignocellulosic biomass is a renewable resource with the potential to replace fossil-derived fuels and chemicals, its recalcitrance, largely due to lignin, limits its utilization. Recent advancements in genetic engineering have produced transgenic trees with reduced lignin content and/or modified lignin structure without compromising growth traits. Here, three engineered poplar varieties are evaluated as feedstocks using a biocompatible one-pot deep eutectic solvent-mediated process that integrates biomass fractionation and enzymatic saccharification within a single reactor, eliminating water washing and reconditioning. All transgenic poplars exhibit higher fermentable sugar yields than wild-type (WT) trees. Notably, QsuB poplar, incorporating 3,4-dihydroxybenzoate in lignin, achieves the highest glucose conversion yield of 91.3% (vs. 73.0% from WT). AT5 and MdCHS3 poplars, incorporating ferulate esters and naringenin, also demonstrate improved glucose yields (86.7 and 84.7%, respectively), confirming reduced biomass recalcitrance. Additionally, residual lignins are valorized via hydrogenolysis into phenolic compounds, with comparable alkylphenol production across all lines. These findings demonstrate that the transgenic poplar lines not only serve as superior feedstocks for sugar conversion but also provide a rich resource for phenolic compound production, enhancing the operational and economic viability of integrated biorefinery processes.

biomasses↗
DOE OSTI2021

Effect of Dilute Acetic Acid Hydrolysis on Xylooligosaccharide Production and the Inhibitory Effect of Cellulolytic Enzyme Lignin from Poplar

Acetic acid (AC) hydrolysis has been reported to prepare xylooligosaccharides (XOS) from poplar. However, the influence of AC hydrolysis on the lignin structure changes is not clear, which is important for the following enzymatic hydrolysis of poplar. Herein, AC was used to produce XOS, and cellulase adsorption on cellulolytic enzyme lignin (CEL) from AC-hydrolyzed poplar and its inhibitory effect on two commercial cellulase preparations were investigated. AC hydrolysis gave a XOS yield of 39.8% from poplar. After AC hydrolysis at 170 °C, the hydrophobicity and ζ-potential of CEL decreased to 2.3 L/g and 14.8 mV, respectively. The adsorption strength of CTec2 on CEL samples did not increase by AC hydrolysis, and the inhibitory effect of CEL on Celluclast 1.5L and β-glucosidase was observed, but not on CTec2. CEL samples improved the lytic polysaccharide monooxygenase (LPMO) activity of the enzymatic hydrolysis by CTec2. After CEL samples were added in enzymatic hydrolysis, the free filter paper activity of Celluclast 1.5L and β-G retained in the enzymatic hydrolysate decreased from 60.5 to 29.3–42.9%. The addition of CEL samples in enzymatic hydrolysis could not decrease the free filter paper activity of CTec2 retained in the enzymatic hydrolysate. In the enzymatic hydrolysis with CEL samples, higher glucose yields were obtained by CTec2 than those by Celluclast 1.5L and β-glucosidase. This work will help to understand the structure and inhibitory effects of AC-CELs and guide the development of AC hydrolysis for the production of XOS and monosaccharides from poplar.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2024

Two-dimensional heteronuclear single quantum coherence (HSQC) NMR spectra of lignin isolated from field grown transgenic poplar

Here we present a curated dataset of a series of two-dimensional heteronuclear single quantum coherence (HSQC) nuclear magnetic resonance (NMR) spectra of lignin isolated from a field grown transgenic poplar engineered with a monolignol 4-O-methyltransferase (MOMT4). The poplar was collected from a 2-year-old rotation trees within a three-year field trial experiment. The poplar was Soxhlet-extracted with toluene/ethanol and the extractives-free poplar was then ball-milled in a Retsch PM100 planetary ball mill using a porcelain jar with ceramic balls at 600 rpm for 2 h (in 5 min on and 5 min off cycles to avoid excessive sample heating). The ball-milled materials were then subjected to enzymatic hydrolysis for 48 h followed by centrifugation and washing with deionized water. The solid residue was extracted twice with 96:4 (v/v) 1,4-dioxane/water mixture at room temperature overnight. The extracts were combined, rotary evaporated, and freeze-dried to recover the lignin. The dry lignin samples were dissolved in deuterated dimethyl sulfoxide for NMR experiments. 13C–1H HSQC experiments were performed in a Bruker Avance III HD 500 MHz NMR spectrometer operating at a frequency of 125.12 MHz for the 13C nucleus using a standard Bruker pulse sequence (hsqcetgpsisp2.2) on a Prodigy platform cryoprobe. The NMR spectra were acquired under the following acquisition conditions: 220 ppm spectral width in F1 (13C) dimension with 256 data points and 12 ppm spectral width in F2 (1H) dimension with 1024 data points, a 90° pulse, a one bond C–H coupling constant of 145 Hz, a 1.0 s pulse delay, and 64 scans. All the data was processed using the Bruker’s TopSpin 3.6 software. The NMR spectra provides structural characteristics information about lignin in field grown transgenic MOMT4 poplar. Additional meta data is embedded in the raw spectra figures.

Lignin structure, HSQC, poplar, field trial, MOMT4↗
DOE OSTI2024

Proton NMR spectra of lignin isolated from field grown transgenic poplar

Here we present a curated dataset of a series of 1H nuclear magnetic resonance (NMR) spectra of lignin isolated from transgenic monolignol 4-O-methyltransferase (MOMT4) engineered poplar. The transgenic poplar was collected from a 2-year-old rotation trees within a three-year field trial experiment. Two replicates were collected for each transgenic poplar for the 1H NMR analysis. The poplar samples were Soxhlet-extracted with toluene/ethanol to remove the extractives and the extractives-free poplar was then ball-milled in a Retsch PM100 planetary ball mill using a porcelain jar with ceramic balls at 600 rpm for 2 h. The ball-milled materials were subjected to enzymatic hydrolysis for 48 h followed by centrifugation and washing with deionized water. The solid residue was extracted twice with 96:4 (v/v) 1,4-dioxane/water mixture at room temperature overnight. The extracts were combined, rotary evaporated, and freeze-dried to recover lignin. The dry lignin samples were dissolved in deuterated dimethyl sulfoxide and transferred into a 5 mm NMR tube. 1H NMR experiments were performed in a Bruker Avance III HD 500 MHz NMR spectrometer operating at a frequency of 125.12 MHz for the 13C nucleus using a standard Bruker pulse sequence (zg) on a Prodigy platform cryoprobe. The NMR spectra were acquired with 16 ppm spectra width, 32k data points, 3s pulse delay, and 16 scans. All the data was processed using the Bruker’s TopSpin 3.6 software. Additional meta data is embedded in the raw spectra files.

1H NMR, lignin, poplar, field trial, MOMT4, CBI↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗