Search NASA⌕ Search

SEARCH · Search NASA

Results for “Sequence motif analysis”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 records
All sourcesNASA NTRSDOE OSTI
DOE OSTI2024

Sequence, structure prediction, and epitope analysis of the polymorphic membrane protein family in Chlamydia trachomatis

The polymorphic membrane proteins (Pmps) are a family of autotransporters that play an important role in infection, adhesion and immunity in Chlamydia trachomatis. Here we show that the characteristic GGA(I,L,V) and FxxN tetrapeptide repeats fit into a larger repeat sequence, which correspond to the coils of a large beta-helical domain in high quality structure predictions. Analysis of the protein using structure prediction algorithms provided novel insight to the chlamydial Pmp family of proteins. While the tetrapeptide motifs themselves are predicted to play a structural role in folding and close stacking of the beta-helical backbone of the passenger domain, we found many of the interesting features of Pmps are localized to the side loops jutting out from the beta helix including protease cleavage, host cell adhesion, and B-cell epitopes; while T-cell epitopes are predominantly found in the beta-helix itself. This analysis more accurately defines the Pmp family of Chlamydia and may better inform rational vaccine design and functional studies.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Uncovering DNA-PKcs ancient phylogeny, unique sequence motifs and insights for human disease

DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is a key member of the phosphatidylinositol-3 kinase-like (PIKK) family of protein kinases with critical roles in DNA-double strand break repair, transcription, metastasis, mitosis, RNA processing, and innate and adaptive immunity. The absence of DNA-PKcs from many model organisms has led to the assumption that DNA-PKcs is a vertebrate-specific PIKK. Here, we find that DNA-PKcs is widely distributed in invertebrates, fungi, plants, and protists, and that threonines 2609, 2638, and 2647 of the ABCDE cluster of phosphorylation sites are highly conserved amongst most Eukaryotes. Furthermore, we identify highly conserved amino acid sequence motifs and domains that are characteristic of DNA-PKcs relative to other PIKKs. These include residues in the Forehead domain and a novel motif we have termed YRPD, located in an α helix C-terminal to the ABCDE phosphorylation site loop. Combining sequence with biochemistry plus structural data on human DNA-PKcs unveils conserved sequence and conformational features with functional insights and implications. The defined generally progressive DNA-PKcs sequence diversification uncovers conserved functionality supported by Evolutionary Trace analysis, suggesting that for many organisms both functional sites and evolutionary pressures remain identical due to fundamental cell biology. The mining of cancer genomic data and germline mutations causing human inherited disease reveal that robust DNA-PKcs activity in tumors is detrimental to patient survival, whereas germline mutations compromising function are linked to severe immunodeficiency and neuronal degeneration. We anticipate that these collective results will enable ongoing DNA-PKcs functional analyses with biological and medical implications.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Real-time structural motif searching in proteins using an inverted index strategy

Biochemical and biological functions of proteins are the product of both the overall fold of the polypeptide chain, and, typically, structural motifs made up of smaller numbers of amino acids constituting a catalytic center or a binding site that may be remote from one another in amino acid sequence. Detection of such structural motifs can provide valuable insights into the function(s) of previously uncharacterized proteins. Technically, this remains an extremely challenging problem because of the size of the Protein Data Bank (PDB) archive. Existing methods depend on a clustering by sequence similarity and can be computationally slow. We have developed a new approach that uses an inverted index strategy capable of analyzing >170,000 PDB structures with unmatched speed. The efficiency of the inverted index method depends critically on identifying the small number of structures containing the query motif and ignoring most of the structures that are irrelevant. Our approach (implemented at motif.rcsb.org ) enables real-time retrieval and superposition of structural motifs, either extracted from a reference structure or uploaded by the user. Herein, we describe the method and present five case studies that exemplify its efficacy and speed for analyzing 3D structures of both proteins and nucleic acids.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

X-ray crystal structure of the Escherichia coli RadD DNA repair protein bound to ADP reveals a novel zinc ribbon domain

Genome maintenance is an essential process in all cells. In prokaryotes, the RadD protein is important for survival under conditions that include DNA-damaging radiation. Precisely how RadD participates in genome maintenance remains unclear. Here we present a high-resolution X-ray crystal structure of ADP-bound Escherichia coli RadD, revealing a zinc-ribbon element that was not modelled in a previous RadD crystal structure. Insights into the mode of nucleotide binding and additional structure refinement afforded by the new RadD model will help to drive investigations into the activity of RadD as a genome stability and repair factor.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

Mutations that confer resistance to broadly-neutralizing antibodies define HIV-1 variants of transmitting mothers from that of non-transmitting mothers

Despite considerable reduction of mother-to-child transmission (MTCT) of HIV through use of maternal and infant antiretroviral therapy (ART), over 150,000 infants continue to become infected with HIV annually, falling far short of the World Health Organization goal of reaching <20,000 annual pediatric HIV cases worldwide by 2020. Prior to the widespread use of ART in the setting of pregnancy, over half of infants born to HIV-infected mothers were protected against HIV acquisition. Yet, the role of maternal immune factors in this protection against vertical transmission is still unclear, hampering the development of synergistic strategies to further reduce MTCT. It has been established that infant transmitted/founder (T/F) viruses are often resistant to maternal plasma, yet it is unknown if the neutralization resistance profile of circulating viruses predicts the maternal risk of transmission to her infant. In this study, we amplified HIV-1 envelope genes ( env ) by single genome amplification and produced representative Env variants from plasma of 19 non-transmitting mothers from the U.S. Women Infant Transmission Study (WITS), enrolled in the pre-ART era. Maternal HIV Env variants from non-transmitting mothers had similar sensitivity to autologous plasma as observed for non-transmitting variants from transmitting mothers. In contrast, infant variants were on average 30% less sensitive to paired plasma neutralization compared to non-transmitted maternal variants from both transmitting and non-transmitting mothers (p = 0.015). Importantly, a signature sequence analysis revealed that motifs enriched in env sequences from transmitting mothers were associated with broadly neutralizing antibody (bnAb) resistance. Altogether, our findings suggest that circulating maternal virus resistance to bnAb-mediated neutralization, but not autologous plasma neutralization, near the time of delivery, predicts increased MTCT risk. These results caution that enhancement of maternal plasma neutralization through passive or active vaccination during pregnancy may potentially drive the evolution of variants fit for vertical transmission.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

FUN-PROSE: A deep learning approach to predict condition-specific gene expression in fungi

mRNA levels of all genes in a genome is a critical piece of information defining the overall state of the cell in a given environmental condition. Being able to reconstruct such condition-specific expression in fungal genomes is particularly important to metabolically engineer these organisms to produce desired chemicals in industrially scalable conditions. Most previous deep learning approaches focused on predicting the average expression levels of a gene based on its promoter sequence, ignoring its variation across different conditions. Here we present FUN-PROSE—a deep learning model trained to predict differential expression of individual genes across various conditions using their promoter sequences and expression levels of all transcription factors. We train and test our model on three fungal species and get the correlation between predicted and observed condition-specific gene expression as high as 0.85. We then interpret our model to extract promoter sequence motifs responsible for variable expression of individual genes. We also carried out input feature importance analysis to connect individual transcription factors to their gene targets. A sizeable fraction of both sequence motifs and TF-gene interactions learned by our model agree with previously known biological information, while the rest corresponds to either novel biological facts or indirect correlations.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Cacao pod transcriptome profiling of seven genotypes identifies features associated with post-penetration resistance to Phytophthora palmivora

Abstract The oomycete Phytophthora palmivora infects the fruit of cacao trees ( Theobroma cacao ) causing black pod rot and reducing yields. Cacao genotypes vary in their resistance levels to P. palmivora , yet our understanding of how cacao fruit respond to the pathogen at the molecular level during disease establishment is limited. To address this issue, disease development and RNA-Seq studies were conducted on pods of seven cacao genotypes (ICS1, WFT, Gu133, Spa9, CCN51, Sca6 and Pound7) to better understand their reactions to the post-penetration stage of P. palmivora infection. The pod tissue- P. palmivora pathogen assay resulted in the genotypes being classified as susceptible (ICS1, WFT, Gu133 and Spa9) or resistant (CCN51, Sca6 and Pound7). The number of differentially expressed genes (DEGs) ranged from 1625 to 6957 depending on genotype. A custom gene correlation approach identified 34 correlation groups. De novo motif analysis was conducted on upstream promoter sequences of differentially expressed genes, identifying 76 novel motifs, 31 of which were over-represented in the upstream sequences of correlation groups and associated with gene ontology terms related to oxidative stress response, defense against fungal pathogens, general metabolism and cell function. Genes in one correlation group (Group 6) were strongly induced in all genotypes and enriched in genes annotated with defense-responsive terms. Expression pattern profiling revealed that genes in Group 6 were induced to higher levels in the resistant genotypes. An additional analysis allowed the identification of 17 candidate cis -regulatory modules likely to be involved in cacao defense against P. palmivora . This study is a comprehensive exploration of the cacao pod transcriptional response to P. palmivora spread after infection. We identified cacao genes, promoter motifs, and promoter motif combinations associated with post-penetration resistance to P. palmivora in cacao pods and provide this information as a resource to support future and ongoing efforts to breed P. palmivora -resistant cacao.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2026

Data for FUN-PROSE: A Deep Learning Approach to Predict Condition-Specific Gene Expression in Fungi

mRNA levels of all genes in a genome is a critical piece of information defining the overall state of the cell in a given environmental condition. Being able to reconstruct such condition-specific expression in fungal genomes is particularly important to metabolically engineer these organisms to produce desired chemicals in industrially scalable conditions. Most previous deep learning approaches focused on predicting the average expression levels of a gene based on its promoter sequence, ignoring its variation across different conditions. Here we present FUN-PROSE—a deep learning model trained to predict differential expression of individual genes across various conditions using their promoter sequences and expression levels of all transcription factors. We train and test our model on three fungal species and get the correlation between predicted and observed condition-specific gene expression as high as 0.85. We then interpret our model to extract promoter sequence motifs responsible for variable expression of individual genes. We also carried out input feature importance analysis to connect individual transcription factors to their gene targets. A sizeable fraction of both sequence motifs and TF-gene interactions learned by our model agree with previously known biological information, while the rest corresponds to either novel biological facts or indirect correlations.

Genomics↗
DOE OSTI2022

CovS inactivation reduces CovR promoter binding at diverse virulence factor encoding genes in group A Streptococcus

The control of virulence gene regulator (CovR), also called caspsule synthesis regulator (CsrR), is critical to how the major human pathogen group A Streptococcus fine-tunes virulence factor production. CovR phosphorylation (CovR~P) levels are determined by its cognate sensor kinase CovS, and functional abrogating mutations in CovS can occur in invasive GAS isolates leading to hypervirulence. Presently, the mechanism of CovR-DNA binding specificity is unclear, and the impact of CovS inactivation on global CovR binding has not been assessed. Thus, we performed CovR chromatin immunoprecipitation sequencing (ChIP-seq) analysis in the emm1 strain MGAS2221 and its CovS kinase deficient derivative strain 2221-CovS-E281A. We identified that CovR bound in the promoter regions of nearly all virulence factor encoding genes in the CovR regulon. Additionally, direct CovR binding was observed for numerous genes encoding proteins involved in amino acid metabolism, but we found limited direct CovR binding to genes encoding other transcriptional regulators. The consensus sequence AATRANAAAARVABTAAA was present in the promoters of genes directly regulated by CovR, and mutations of highly conserved positions within this motif relieved CovR repression of the hasA and MGAS2221_0187 promoters. Analysis of strain 2221-CovS-E281A revealed that binding of CovR at repressed, but not activated, promoters is highly dependent on CovR~P state. CovR repressed virulence factor encoding genes could be grouped dependent on how CovR~P dependent variation in DNA binding correlated with gene transcript levels. Taken together, the data show that CovR repression of virulence factor encoding genes is primarily direct in nature, involves binding to a newly-identified DNA binding motif, and is relieved by CovS inactivation. These data provide new mechanistic insights into one of the most important bacterial virulence regulators and allow for subsequent focused investigations into how CovR-DNA interaction at directly controlled promoters impacts GAS pathogenesis.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

maslov-group/FUN-PROSE

mRNA levels of all genes in a genome is a critical piece of information defining the overall state of the cell in a given environmental condition. Being able to reconstruct such condition-specific expression in fungal genomes is particularly important to metabolically engineer these organisms to produce desired chemicals in industrially scalable conditions. Most previous deep learning approaches focused on predicting the average expression levels of a gene based on its promoter sequence, ignoring its variation across different conditions. Here we present FUN-PROSE—a deep learning model trained to predict differential expression of individual genes across various conditions using their promoter sequences and expression levels of all transcription factors. We train and test our model on three fungal species and get the correlation between predicted and observed condition-specific gene expression as high as 0.85. We then interpret our model to extract promoter sequence motifs responsible for variable expression of individual genes. We also carried out input feature importance analysis to connect individual transcription factors to their gene targets. A sizeable fraction of both sequence motifs and TF-gene interactions learned by our model agree with previously known biological information, while the rest corresponds to either novel biological facts or indirect correlations.

Liu, Simon↗
DOE OSTI2022

RNAseq-based transcriptome assembly of Clostridium acetobutylicum for functional genome annotation and discovery

Accurate genome annotations are essential in modern biology and biotechnology, yet they are still largely based on genome sequencing and comparative analyses. We show that the Clostridium acetobutylicum genome annotation can be markedly improved by integrating bioinformatic predictions with RNA sequencing (RNAseq) data. Samples were acquired under butanol, butyrate, and unstressed treatments across various growth conditions. Analysis of an initial assembly revealed errors due to background signals and limitations of assembly algorithms. Hurdles for RNAseq transcriptome mapping include optimizing library complexity and sequencing depth, yet most studies report low sequencing depth and ignore the effect of ribosomal RNA abundance. An integrative analysis was developed to combine motif predictions, single-nucleotide resolution sequencing depth, and library complexity to resolve difficulties in assembly curation. This minimized false positive error and determined gene boundaries, in some cases, to the exact base-pair of prior studies. This will be the first strand-specific transcriptome assembly in a Clostridium organism.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2020

The parallelism motifs of genomic data analysis

Genomic datasets are growing dramatically as the cost of sequencing continues to decline and small sequencing devices become available. Enormous community databases store and share these data with the research community, but some of these genomic data analysis problems require large-scale computational platforms to meet both the memory and computational requirements. These applications differ from scientific simulations that dominate the workload on high-end parallel systems today and place different requirements on programming support, software libraries and parallel architectural design. For example, they involve irregular communication patterns such as asynchronous updates to shared data structures. We consider several problems in high-performance genomics analysis, including alignment, profiling, clustering and assembly for both single genomes and metagenomes. We identify some of the common computational patterns or ‘motifs’ that help inform parallelization strategies and compare our motifs to some of the established lists, arguing that at least two key patterns, sorting and hashing, are missing. This article is part of a discussion meeting issue ‘Numerical algorithms for high-performance computational science’.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Viral afterlife: SARS-CoV-2 as a reservoir of immunomimetic peptides that reassemble into proinflammatory supramolecular complexes

It is unclear how severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection leads to the strong but ineffective inflammatory response that characterizes severe Coronavirus disease 2019 (COVID-19), with amplified immune activation in diverse cell types, including cells without angiotensin-converting enzyme 2 receptors necessary for infection. Proteolytic degradation of SARS-CoV-2 virions is a milestone in host viral clearance, but the impact of remnant viral peptide fragments from high viral loads is not known. Here, we examine the inflammatory capacity of fragmented viral components from the perspective of supramolecular self-organization in the infected host environment. Interestingly, a machine learning analysis to SARS-CoV-2 proteome reveals sequence motifs that mimic host antimicrobial peptides (xenoAMPs), especially highly cationic human cathelicidin LL-37 capable of augmenting inflammation. Such xenoAMPs are strongly enriched in SARS-CoV-2 relative to low-pathogenicity coronaviruses. Moreover, xenoAMPs from SARS-CoV-2 but not low-pathogenicity homologs assemble double-stranded RNA (dsRNA) into nanocrystalline complexes with lattice constants commensurate with the steric size of Toll-like receptor (TLR)-3 and therefore capable of multivalent binding. Such complexes amplify cytokine secretion in diverse uninfected cell types in culture (epithelial cells, endothelial cells, keratinocytes, monocytes, and macrophages), similar to cathelicidin’s role in rheumatoid arthritis and lupus. The induced transcriptome matches well with the global gene expression pattern in COVID-19, despite using <0.3% of the viral proteome. Delivery of these complexes to uninfected mice boosts plasma interleukin-6 and CXCL1 levels as observed in COVID-19 patients.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2023

A cellular selection identifies elongated flavodoxins that support electron transfer to sulfite reductase

Flavodoxins (Flds) mediate the flux of electrons between oxidoreductases in diverse metabolic pathways. To investigate whether Flds can support electron transfer to a sulfite reductase (SIR) that evolved to couple with a ferredoxin, we evaluated the ability of Flds to transfer electrons from a ferredoxin-NADP reductase (FNR) to a ferredoxin-dependent SIR using growth complementation of an Escherichia coli strain with a sulfur metabolism defect. We show that Flds from cyanobacteria complement this growth defect when coexpressed with an FNR and an SIR that evolved to couple with a plant ferredoxin. When we evaluated the effect of peptide insertion on Fld-mediated electron transfer, we observed a sensitivity to insertions within regions predicted to be proximal to the cofactor and partner binding sites, while a high insertion tolerance was detected within loops distal from the cofactor and within regions of helices and sheets that are proximal to those loops. Bioinformatic analysis showed that natural Fld sequence variability predicts a large fraction of the motifs that tolerate insertion of the octapeptide SGRPGSLS. In conclusion, these results represent the first evidence that Flds can support electron transfer to assimilatory SIRs, and they suggest that the pattern of insertion tolerance is influenced by interactions with oxidoreductase partners.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

An extended motif in the SARS-CoV-2 spike modulates binding and release of host coatomer in retrograde trafficking

β-Coronaviruses such as SARS-CoV-2 hijack coatomer protein-I (COPI) for spike protein retrograde trafficking to the progeny assembly site in endoplasmic reticulum-Golgi intermediate compartment (ERGIC). However, limited residue-level details are available into how the spike interacts with COPI. Here we identify an extended COPI binding motif in the spike that encompasses the canonical K-x-H dibasic sequence. This motif demonstrates selectivity for αCOPI subunit. Guided by an in silico analysis of dibasic motifs in the human proteome, we employ mutagenesis and binding assays to show that the spike motif terminal residues are critical modulators of complex dissociation, which is essential for spike release in ERGIC. αCOPI residues critical for spike motif binding are elucidated by mutagenesis and crystallography and found to be conserved in the zoonotic reservoirs, bats, pangolins, camels, and in humans. Collectively, our investigation on the spike motif identifies key COPI binding determinants with implications for retrograde trafficking.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

High-resolution mapping reveals hotspots and sex-biased recombination in Populus trichocarpa

Abstract Fine-scale meiotic recombination is fundamental to the outcome of natural and artificial selection. Here, dense genetic mapping and haplotype reconstruction were used to estimate recombination for a full factorial Populus trichocarpa cross of 7 males and 7 females. Genomes of the resulting 49 full-sib families (N = 829 offspring) were resequenced, and high-fidelity biallelic SNP/INDELs and pedigree information were used to ascertain allelic phase and impute progeny genotypes to recover gametic haplotypes. The 14 parental genetic maps contained 1,820 SNP/INDELs on average that covered 376.7 Mb of physical length across 19 chromosomes. Comparison of parental and progeny haplotypes allowed fine-scale demarcation of cross-over regions, where 38,846 cross-over events in 1,658 gametes were observed. Cross-over events were positively associated with gene density and negatively associated with GC content and long-terminal repeats. One of the most striking findings was higher rates of cross-overs in males in 8 out of 19 chromosomes. Regions with elevated male cross-over rates had lower gene density and GC content than windows showing no sex bias. High-resolution analysis identified 67 candidate cross-over hotspots spread throughout the genome. DNA sequence motifs enriched in these regions showed striking similarity to those of maize, Arabidopsis, and wheat. These findings, and recombination estimates, will be useful for ongoing efforts to accelerate domestication of this and other biomass feedstocks, as well as future studies investigating broader questions related to evolutionary history, perennial development, phenology, wood formation, vegetative propagation, and dioecy that cannot be studied using annual plant model systems.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

A broad specificity β-propeller enzyme from Rhodopseudomonas palustris that hydrolyzes many lactones including γ-valerolactone

Lactones are prevalent in biological and industrial settings, yet there is a lack of information regarding enzymes used to metabolize these compounds. One compound, γ-valerolactone (GVL), is used as a solvent to dissolve plant cell walls into sugars and aromatic molecules for subsequent microbial conversion to fuels and chemicals. Despite the promise of GVL as a renewable solvent for biomass deconstruction, residual GVL can be toxic to microbial fermentation. Here, we identified a Ca 2+ -dependent enzyme from Rhodopseudomonas palustris (Rpa3624) and showed that it can hydrolyze aliphatic and aromatic lactones and esters, including GVL. Maximum-likelihood phylogenetic analysis of other related lactonases with experimentally determined substrate preferences shows that Rpa3624 separates by sequence motifs into a subclade with preference for hydrophobic substrates. Additionally, we solved crystal structures of this β-propeller enzyme separately with either phosphate, an inhibitor, or a mixture of GVL and products to define an active site where calcium-bound water and calcium-bound aspartic and glutamic acid residues make close contact with substrate and product. Our kinetic characterization of WT and mutant enzymes combined with structural insights inform a reaction mechanism that centers around activation of a calcium-bound water molecule promoted by general base catalysis and close contacts with substrate and a potential intermediate. Similarity of Rpa3624 with other β-propeller lactonases suggests this mechanism may be relevant for other members of this emerging class of versatile catalysts.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗