Search NASA⌕ Search

SEARCH · Search NASA

Results for “agroinfiltration”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

5 records
All sourcesNASA NTRSDOE OSTI
DOE OSTI2026

Causes and consequences of experimental variation in Nicotiana benthamiana transient expression

Infiltration of Agrobacterium tumefaciens into Nicotiana benthamiana has become a foundational technique in plant biology, enabling efficient delivery of transgenes in planta with technical ease, robust signal, and relatively high throughput. Despite transient expression’s prevalence in disciplines such as synthetic biology, little work has been done to describe and address the variability inherent in this system, a concern for experiments that rely on highly quantitative readouts. In a comprehensive analysis of N. benthamiana agroinfiltration experiments, we model sources of variability that affect transient expression. Our findings emphasize the need to validate normalization methods under the specific conditions of each study, as distinct normalization schemes do not always reduce variation either within or between experiments. Using a dataset of 1915 plants collected over three years, we develop a model of variation in N. benthamiana transient expression, using power analysis to determine the number of individual plants required for a given effect size. Drawing on our longitudinal data, these findings inform practical guidelines for minimizing variability through strategic experimental design and power analysis, providing a foundation for more robust and reproducible use of N. benthamiana in quantitative plant biology and synthetic biology applications.

Tang, Sophia N. [Joint BioEnergy Institute (JBEI),↗
DOE OSTI2020

Imaging of multiple fluorescent proteins in canopies enables synthetic biology in plants

Reverse genetics approaches have revolutionized plant biology and agriculture. Phenomics has the prospect of bridging plant phenotypes with genes, including transgenes, to transform agricultural fields. Genetically encoded fluorescent proteins (FPs) have revolutionized plant biology paradigms in gene expression, protein trafficking and plant physiology. While the first instance of plant canopy imaging of green fluorescent protein (GFP) was performed over 25 years ago, modern phenomics has largely ignored fluorescence as a transgene expression device despite the burgeoning FP colour palette available to plant biologists. Here, we show a new platform for stand-off imaging of plant canopies expressing a wide variety of FP genes. The platform-the fluorescence-inducing laser projector (FILP)-uses an ultra-low-noise camera to image a scene illuminated by compact diode lasers of various colours, coupled with emission filters to resolve individual FPs, to phenotype transgenic plants expressing FP genes. Each of the 20 FPs screened in plants were imaged at >3 m using FILP in a laboratory-based laser range. We also show that pairs of co-expressed fluorescence proteins can be imaged in canopies. The FILP system enabled a rapid synthetic promoter screen: starting from 2000 synthetic promoters transfected into protoplasts to FILP-imaged agroinfiltrated Nicotiana benthamiana plants in a matter of weeks, which was useful to characterize a water stress-inducible synthetic promoter. FILP canopy imaging was also accomplished for stably transformed GFP potato and in a split-GFP assay, which illustrates the flexibility of the instrument for analysing fluorescence signals in plant canopies.

abiotic stress↗
DOE OSTI2021

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

09 BIOMASS FUELS↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

A Fluorescence‐Based Transient Expression Assay for the Analysis of Upstream Open Reading Frames in Plants

Upstream open reading frames (uORFs) are regulatory elements present in the 5′ leaders of mRNA that can significantly impact downstream gene expression in eukaryotes. In crop engineering, editing of uORFs can provide an avenue to upregulate expression of native genes without the need to add persistent transgenic copies. Even with genome-wide methods to identify translated uORFs such as ribosome profiling, their functional characterization depends on validation through reporter gene assays and mutagenesis studies. Current screening methods for plants use luciferases or protoplasts to measure differential gene expression between wild-type and mutated transcript leaders, which requires tissue processing and/or substrate addition. Here, we present a time- and cost-efficient alternative to investigate transcript leaders by co-expression of two fluorescent proteins in Nicotiana benthamiana leaf tissue and test our assay on genes involved in photoprotection, editing of which could provide a pathway to increase CO 2 assimilation during sun–shade transitions.

Nicotiana benthamiana↗