Exascale Advancements In Kokkos Core
Summary of Kokokkos (open source) release features relevant to application developers working on exascale systems.
SEARCH · Search NASA
Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
Summary of Kokokkos (open source) release features relevant to application developers working on exascale systems.
This drilling data for Utah FORGE well 16B(78)-32 include a well survey, core summary, mud and mud temperature logs, daily reports of the drilling process, and additional data from the Pason oil and gas company. Well 16B(78)-32 serves as the production well for reservoir creation, fluid circulation, and demonstration of heat extraction for the FORGE project. It has been drilled as a doublet approximately 300 feet parallel to and above the injection well 16A(78)-32. The proposed total depth was 10,658 feet, which was exceeded. Spudding began on April 26th, 2023. As of June 20th, 2023, the total depth measured 10,947 feet and the vertical depth measured 8,357 feet. Drilling included the trial use of insulated drill pipe (IDP) from Eavor Technologies, which was considered a success. IDP restricts counter-current heat transfer between drilling fluid inside the drill string and hotter returning fluid in the annulus, thereby ensuring the bottomhole assembly (BHA) remains submerged in cool fluid. Eavor rented 350 joints of IDP to FORGE which were run in two consecutive BHAs at the well. The results of this trial are included here.
R&D efforts in support of the Oak Ridge National Laboratory (ORNL) Isotope Program Radioisotope Portfolio are led by the Radioisotope Science and Technology Division (RSTD). In addition to supporting the ORNL Isotope Program Radioisotope Portfolio, RSTD supports a portfolio of research related to fundamental properties of radioisotopes and radioisotope applications, including diagnostic and therapeutic uses of medical radioisotopes, radioisotopes for national security, and the production of 238 Pu for the National Aeronautics and Space Administration (NASA) and US Department of Energy (DOE) Office of Nuclear Energy. RSTD is organized into functional science and engineering groups, with most staff members supporting multiple programs. The goal of this organization is to enable synergy between programs such that R&D advances coming from other programs may provide benefit to the ORNL Isotope Program. R&D within RSTD is focused around addressing five grand challenges, as documented in the strategic plan for the DOE Office of Isotope R&D and Production, or DOE Isotope Program (IP), Radioisotope Production R&D activities at ORNL: 1. Maximizing the scientific output of radioisotope transmutation resources, 2. Maximizing the scientific output of radioisotope processing resources, 3. Minimizing waste and having optimal waste disposition, 4. Focusing on product quality and reliability, and 5. Expanding the use of beneficial isotopes. The ORNL Core R&D program, one of the primary R&D components within the ORNL Isotope Program Radioisotope Portfolio, ranges from benchtop to demonstration activities, with a focus on researching enhanced production techniques, developing emerging isotopes, and developing the talent pipeline for radioisotope science and technology. Projects within the Core R&D Program are led primarily by RSTD staff members. In supporting enhanced production techniques, the Core R&D program presents an opportunity to fund novel R&D that might not be tied to a specific radioisotope product but still presents a high potential for broad applicability in the longer term. In supporting the development of emerging isotopes, the Core R&D program develops high-priority isotopes that are not able to be fully supported through production funds.
This document presents the facility-recommended characterization of the neutron, prompt gamma ray, and delayed gamma ray radiation fields at the Godiva IV critical assembly at the National Criticality Experiments Research Center (NCERC). The environments assessed include the In-Core location, a location on the Top Hat, 1m away from the assembly, and 2m away from the assembly. The neutron, prompt gamma ray, and delayed gamma ray energy spectra, uncertainties, and covariance matrices are presented as well as radial and axial neutron and gamma ray fluence profiles on the Top Hat surrounding the critical assembly. Recommended constants are given to facilitate the conversion of various dosimetry readings into radiation metrics desired by experimenters. Representative pulse operations are presented with conversion examples.
Summary The emerging Paradox Oil Play in southeastern Utah is among the most significant unconventional plays in the western USA. The mean total undiscovered oil resources within just the Pennsylvanian Cane Creek interval of the Paradox Basin are believed to exceed 215 million barrels. However, to date, less than 5% (~9 million barrels) of the total Cane Creek resource has been produced from fewer than 40 wells, and only approximately one-half of those are horizontal wells. More than 95% of production is from the central Cane Creek Unit (CCU). Natural fractures are a key feature of many production wells, but stimulation by induced hydraulic fractures is not consistently successful. We hypothesize that more effective production in this play will rely on better fundamental characterization, especially on better quantification of the state of stress. Approximately 110 ft of core, well logs, and a diagnostic fracture injection test (DFIT) were acquired from the State 16-2 well within the CCU. With these data, we applied two methods to constrain and clarify the state of stress. The first technique, the Simpson’s coefficient method, provides lower bounds on the two horizontal principal stresses and relies on only limited data. Alternatively, the viscoelastic stress relaxation (VSR) method is used to estimate the least horizontal principal stress, building on observations that principal stresses become more isotropic as the viscous behavior of a rock is more pronounced. Results of these two methods support the hypothesis that the state of stress in the CCU of the Paradox Basin is nearly lithostatic and isotropic. Other factors consistent with this hypothesis include high formation pore pressure, which tends to reduce the possible stress states by changing the frictional failure equilibrium; lack of induced fractures in the core, which should be present in the case of stress anisotropy; and interbedded halite layers, which given their high degree of ductility, probably lead to greater VSR for the entire sedimentary package.
The characterization of the neutron, prompt gamma-ray, and delayed gamma-ray radiation fields in the University of Texas at Austin Nuclear Engineering Teaching Laboratory (NETL) TRIGA reactor for the beam port (BP) 1/5 free-field environment at the 128-inch location adjacent to the core centerline has been accomplished. NETL is being explored as an auxiliary neutron test facility for the Sandia National Laboratories radiation effects sciences research and development campaigns. The NETL reactor is a TRIGA Mark-II pulse and steady-state, above-ground pool-type reactor. NETL is intended as a university research reactor typically used to perform irradiation experiments for students and customers, radioisotope production, as well as a training reactor. Initial criticality of the NETL TRIGA reactor was achieved on March 12, 1992, making it one of the newest test reactor facilities in the US. The neutron energy spectra, uncertainties, and covariance matrices are presented as well as a neutron fluence map of the experiment area of the cavity. For an unmoderated condition, the neutron fluence at the center of BP 1/5, at the adjacent core axial centerline, is about 8.2×10 12 n/cm 2 per MJ of reactor energy. About 67% of the neutron fluence is below 1 keV and 22% above 100 keV. The 1-MeV Damage-Equivalent Silicon (DES) fluence is roughly 1.6×10 12 n/cm 2 per MJ of reactor energy.
Explore the source record for details and available documents.
Breakdown of the DOE Advanced Gas Reactor Fuel Development and Qualification Program. Including discussion topics on TRISO technology Status Circa 2000, New Production Reactor (NPR) Fuel Experience, Fuel Qualification, US DOE Advanced Gas Reactor (AGR) Fuel Development and Qualification Program, Initial AGR Program Reference HTGR Design, Fuel Qualification Approach, Fuel Performance Modeling, Fuel Fabrication, Selected AGR-1, AGR-2, and AGR-5/6/7 Fuel Property Means, AGR Program TRISO Fuel Key Performance Data, Irradiation Performance: Fission Gas R/B, Irradiation Testing Results, Kernel and Coating Behavior During Irradiation, Locating and Studying Failed Particles Greatly Improves Understanding of Fuel Performance, Fission Product Release from UCO Fuel Compacts: AGR-1 and AGR-2 Examples, HTGR Accident Safety Testing of TRISO Fuel, Evaluating Behavior During D-LOFC Accidents, Safety Test Results for US UCO Fuel, Particle Failure Evaluation, Fuel Performance Summary, Ongoing Work and Outstanding Data Needs, Core Oxidation, Industry Engagement, and Coated-Particle-Fueled Reactor Concepts and Fuel Designs.
Natural gas in shale exists as free and adsorbed gas, subject to prevailing pore pressures and stress conditions. Accordingly, to accurately estimate/predict the shale gas recovery potential, a central requirement is to represent gas transport and sorption behavior under varying stress conditions. The objective of this work is to facilitate the interpretation of laboratory-scale experiments, at relevant conditions, in an attempt to bridge the gap in scales between laboratory- and field-scale observations. We have conducted a series of high-pressure experiments on a full-diameter core sample from the Marcellus shale. These include gas loading (pressure-decay) and depletion (production) experiments with pure methane (CH 4 ) at variable stress conditions to characterize transport and sorption behavior under reservoir-relevant conditions. Here we have formulated and applied a novel integral model for mass transfer and storage in multi-porosity shale systems that allows us to effectively investigate transport and sorption phenomena: We delineate gas transport by interpreting helium (He) pressure-decay experiments and demonstrate how to use the information gained to calculate the relevant transport coefficients of CH 4 and other gases. A separate measurement of the CH 4 sorption isotherm on a smaller sample (a shale cube) was interpreted and combined with the transport description to predict the production behavior of CH 4 from the experiments with the full-diameter core. Our experiments demonstrate that the representation of sorption hysteresis is crucial for predicting and guiding shale gas production: At the end of both gas production experiments, approximately 20% of the initial gas in place remained in the core. Without accounting for sorption hysteresis, our modeling demonstrates that the CH 4 production could be overestimated by 10%. We demonstrate that our integral, triple-porosity model provides an effective approach for the interpretation and prediction of gas transport and sorption behavior during loading and production experiments on shale cores under variable net-stress conditions. In summary, our work combines measurements and modeling of mass transfer and sorption in shales at different scales to validate a characterization approach that facilitates an improved understanding of shale gas production. Furthermore, the triple-porosity model utilized in our work defines a potential pathway for the translation of laboratory-scale experimentation to larger-scale applications.
High-Temperature Gas-cooled Reactors (HTGRs) have excellent characteristics in terms of safety and high thermal efficiency, and they are gaining a large interest from the industry as a candidate of Gen-IV reactors for a wide range of applications. The High Temperature gas-cooled Reactor Pebble-bed Module project (HTR-PM) is one of these designs and where helium gas is used to cool the pebble-bed region that consists of spherical fuel elements moderated with graphite. The HTR-PM design is based on the combined experience from the German pebble-bed reactor program from the 1960s through the 1990s and the HTR-10 experience in China during the 2000s. Idaho National Laboratory has a long experience in modeling of HTGRs working in developing neutronics and thermal hydraulics tools for the proper modeling of these reactors. The neutronics code Griffin has the capability to model pebble depletion . While the thermal hydraulics code Pronghorn was developed mainly to model the pebble bed reactors with the porous media assumption. In this work, an equilibrium core Multiphysics model was developed for the HTR-PM reactor to analyze the depressurized loss of forced cooling accident scenario (DLOFC). This paper is organized as follows: First, a brief description of the reactor and model specifications are provided. Then, the developed Multiphysics model is discussed. Finally, verification results of the steady-state equilibrium core and DLOFC accident are presented followed by a summary of the conclusions.
SUMMARY The seismic anisotropy of the Earth's solid inner core has been the topic of much research. It could be explained by the crystallographic preferred orientation (CPO) developing during convection. The likely phase is hexagonal close-packed iron (hcp), alloyed with nickel and some lighter elements. Here we use high energy synchrotron X-rays to study CPO in Fe-9wt%Si, uniaxially compressed in a diamond anvil cell in radial geometry. The experiments reveal that strong preferred orientation forms in the low-pressure body-centred cubic (bcc) phase that appears to be softer than pure iron. CPO is attributed to dominant {110}<111> slip. The onset of the bcc→hcp transition occurs at a pressure of ≈15 GPa, and the alloy remains in a two phase bcc + hcp state up to 40 GPa. The hcp phase forms first with a distinct {11$\bar{2}$0} maximum perpendicular to compression. Modelling shows that this is a transformation texture, which can be described by Burgers orientation relationship with variant selection. Experimental results suggest that bcc grains oriented with <100> parallel to compression transform into hcp first. The CPO of the hcp changes only slowly during further pressure and deviatoric stress increase at ambient temperature. After heating to 1600 K, a change in the hcp CPO is observed with alignment of (0001) planes perpendicular to compression that can be interpreted as dominant (0001)<11$\bar{2}$0> slip, combined with {10$\bar{1}$2}<$\bar{1}$011> mechanical twinning, which is similar to the deformation modes suggested previously for pure hcp iron at inner core conditions.
In the summer and fall of 2023, the University of Texas (UT) Deepwater Hydrate Coring Expedition (UT-GOM2-2) drilled, cored, made downhole measurements, and analyzed samples from the seafloor to the base of the gas hydrate stability zone at Site H, in the Walker Ridge Protracted Area Block 313 (Site H, WR313), in the Terrebonne Basin, deepwater Gulf of America (Gulf of Mexico). Analyses of data and samples from the expedition will inform biological, geochemical, and geomechanical models to constrain the role of gas hydrates in the carbon cycle and the potential for gas hydrates as an energy resource.
SUMMARY Carboxysomes are bacterial microcompartments that encapsulate Rubisco and are a core component of the cyanobacterial carbon concentration mechanism (CCM). While carboxysome number, size, and spatial organization vary in different environmental conditions (CO 2 , light availability, redox state, temperature, and light quality), the molecular mechanisms underlying this potentially adaptive process remain elusive. Herein, we observe that mutants of the circadian rhythm/metabolism factor, Regulator of Phycobilisome Association A (RpaA), exhibit a striking breakdown of carboxysomes under certain environmental conditions. We find that conditions leading to overreduction of the plastoquinone (PQ) pool (mixotrophic growth, high irradiance, or chemical inhibition of electron transfer from PQ to the cytochromeb 6 fcomplex) are accompanied by an elevated generation of reactive oxygen species (ROS) and correlate with the loss of carboxysome integrity. Carboxysome breakdown is reversed by environmental conditions or chemical inhibitors that prevent PQ overreduction and accompanying ROS generation. Taken together, our data support a novel link between the redox status of the PQ pool and carboxysome integrity. Our results have implications for the fundamental understanding of cyanobacterial energy‐balancing pathways and may indicate new research directions for understanding how the carboxysome is remodeled in response to changing environments.
Abstract We here focus on the behavior of supernovae that technically explode in 1D (spherical symmetry). When simulated in 3D, however, the outcomes of representative progenitors of this class are quite different in almost all relevant quantities. In 3D, the explosion energies can be 2 to 10 times higher, and there are correspondingly large differences in the 56 Ni yields. These differences between the 3D and 1D simulations reflect in part the relative delay to explosion of the latter and in the former the presence of protoneutron star convection that boosts the driving neutrino luminosities by as much as ∼50% at later times. In addition, we find that the ejecta in 3D models are more neutron-rich, resulting in significant weak r -process and 48 Ca yields. Furthermore, we find that in 3D the core is an interesting, though subdominant, source of acoustic power. In summary, we find that though a model might be found theoretically to explode in 1D, one must perform supernova simulations in 3D to capture most of the associated observables. The differences between 1D and 3D models are just too large to ignore.
Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.
The Graphite Technology Development Project provides data to support the design of graphite core components within specific reactor service conditions of the next generation of high-temperature, gas-cooled nuclear reactors. Physical, mechanical, and thermal properties of nuclear grade graphite were characterized for specimens that were unirradiated, irradiated, and irradiated under various stress conditions. The material properties include diameter, length, mass, density, compressive strength, tensile strength, flexural strength, modulus, resistivity, thermal diffusivity, and thermal expansion coefficient. Baseline graphite specimens are unirradiated from different grades (2114, IG-110, NBG-17, NBG-18, and PCEA) and different types used in different characterization tests (compressive, flexural, tensile, one-inch cylinder, and quarter-inch cylinder). The Advanced Graphite Creep (AGC) irradiation specimens are from a much larger number of grades and cylinder types (creep, piggyback, and pencil). For baseline graphite, characterization data for 7,756 specimens extracted from thirteen graphite billets were captured to the NDMAS database. For AGC experiments, four irradiation campaigns have been completed: AGC-1, AGC-2, AGC-3, and AGC-4. The ongoing HDG-1 (High-Dose Graphite) experiment, which began irradiation with Cycle 168B on August 26, 2020, includes specimens previously irradiated in AGC-2 in addition to the specimens originally destined for AGC-5.. Besides the characterization data, the AGC data includes irradiation monitoring and physics data representing the irradiation conditions of AGC specimens. Currently, all data for AGC-1, AGC-2, and AGC-3 have been captured to the NDMAS database. Only AGC-4 pre-irradiation and irradiation monitoring data have been captured, and HDG-1 pre-irradiation data are in process of being captured for unirradiated specimens. To date, a total of 38,149 material property records have been captured into NDMAS database for baseline and AGC specimens. All characterization data are qualified for use according to their perspective data verification reports. For the AGC irradiation campaigns, a total of 41,502 qualified physics calculation records were added for AGC-1, AGC-2, and AGC-3. Finally, a total of 173,698,505 AGC irradiation monitoring data records (thermocouple temperature, gas flow rate, gas pressure, gas moisture, applied load, and specimen displacement) have been captured to NDMAS; the majority of those records (~94%) are qualified data records.
Reactor Pressure Vessels (RPVs) are critical components in nuclear reactors, housing the reactor core and coolant under extreme conditions of temperature, pressure, and radiation. These harsh environments contribute to the degradation of RPV materials over time, presenting challenges for extending reactor operations beyond their original design lifespans. The NRC Expanded Materials Degradation Assessment (EMDA) report volume 3 have been instrumental in guiding research to support extending the operational life of light water reactors (LWRs) up to 80 years. It provides a comprehensive framework to address technical challenges related to aging and degradation mechanisms in RPVs. The LWRS program has played a key role in advancing this research, supporting projects such as the UCSB ATR-2 Experiment, material testing from Zion and Palisades reactors, and the development of advanced mini-compact tension testing techniques. These efforts have been crucial in identifying and addressing gaps in our understanding of RPV aging, contributing to the successful subsequent license renewals of eight LWR units in the U.S. The EMDA report volume 3, built on the Phenomena Identification and Ranking Table (PIRT) analysis from earlier versions of the EPRI Materials Degradation Matrix (MDM) and Issue Management Tables (IMTs), provides a detailed assessment of RPV degradation mechanisms. However, as EPRI has updated the MDM and IMT, it is important to revisit research priorities and methodologies to reflect these changes. The revised MDM and IMT may introduce new factors affecting long-term RPV performance and safety, highlighting the need for continued research and updated guidance to ensure the reliable and safe operation of reactors beyond 80 years.