SEARCH · Search NASA

Results for “inducible promoter”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 records

All sources NASA NTRS DOE OSTI

NASA NTRS2001

Characterization of the yeast copper-inducible promoter system in Arabidopsis thaliana

Inducible promoters or gene-switches are used to both spatially and temporally regulate gene expression. Such regulation can provide information concerning the function of a gene in a developmental context as well as avoid potential harmful effects due to overexpression. A gfp construct under the control of a copper-inducible promoter was introduced into Arabidopsis thaliana (L.) Heynh. and the regulatory parameters of this inducible promoter were determined. Here, we describe the time-course of up- and down-regulation of GFP expression in response to copper level, the optimal regulatory levels of copper, and the tissue specificity of expression in three transgenic lines. We conclude that the copper-inducible promoter system may be useful in regulating the time and location of gene expression in A. thaliana.

Non-NASA Center↗

DOE OSTI2020

Methods of designing programmable inducible promoters

Described herein is a method for identifying synthetic inducible promoters that have specified induction and/or repression for DNA binding proteins such as an allosteric transcription factor and an inducer molecule. The method includes an in vitro selection from an unselected polynucleotide library comprising a plurality of random degeneracies, and an in vivo selection to produce an induced promoter library. Produced is an induction table, which allows the selection of a promoter with specific induction and/or repression properties. Also included are biosensors containing the synthetic inducible promoters.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗

DOE OSTI2020

Host cells and methods using a repressor polypeptide and an inducible promoter for gene expression

The present invention provides for a system comprising (a) a first nucleic acid comprising a nucleotide sequence encoding a nucleotide sequence of interest operatively linked to a promoter comprising a repressor polypeptide binding site, and (b) a second nucleic acid comprising a nucleotide sequence encoding a repressor polypeptide having at least 70% amino acid identity with EilR, SmvR, KmrR, RcdA, or QacR; wherein expression of the nucleotide sequence of interest from the promoter is induced by the presence of a hydrophobic inducer, such as a hydrophobic cation inducer, such as a triarylmethane, acridine, phenazine, phenothiazine, or xanthene.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗

DOE OSTI2022

Host cells and methods using a repressor polypeptide and an inducible promoter for gene expression

Ruegg, Thomas L.↗

DOE OSTI2024

Development of inducible promoters for regulating gene expression in Clostridium tyrobutyricum for biobutanol production

Abstract Clostridium tyrobutyricumis an anaerobe known for its ability to produce short‐chain fatty acids, alcohols, and esters. We aimed to develop inducible promoters for fine‐tuning gene expression inC. tyrobutyricum. Synthetic inducible promoters were created by employing anEscherichia coli lacoperator to regulate the thiolase promoter (PCathl) fromClostridium acetobutylicum, with the best one (LacI‐Pto4s) showing a 5.86‐fold dynamic range with isopropyl β‐d‐thiogalactoside (IPTG) induction. A LT‐Pt7 system with a dynamic range of 11.6‐fold was then created by combining LacI‐Pto4s with a T7 expression system composing of RNA polymerase (T7RNAP) and Pt7lacpromoter. Furthermore, two inducible expression systems BgaR‐PbgaLA and BgaR‐PbgaLB with a dynamic range of ~40‐fold were developed by optimizing a lactose‐inducible expression system fromClostridium perfringenswith modified 5′ untranslated region (5′ UTR) and ribosome‐binding site (RBS). BgaR‐PbgaLB was then used to regulate the expressions of a bifunctional aldehyde/alcohol dehydrogenase encoded byadhE2 and butyryl‐CoA/acetate Co‐A transferase encoded bycat1 inC. tyrobutyricumwild type and Δcat1::adhE2, respectively, demonstrating its efficient inducible gene regulation. The regulatedcat1 expression also confirmed that the Cat1‐catalyzed reaction was responsible for acetate assimilation inC. tyrobutyricum. The inducible promoters offer new tools for tuning gene expression inC. tyrobutyricumfor industrial applications.

Biotechnology & Applied Microbiology↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2025

Comparing four heat-inducible promoters in stably transformed sugarcane regarding spatial and temporal control of transgene expression reveals candidates to drive stem-preferred transgene expression

Small heat shock protein (sHSP) promoters contain cis-regulatory elements that facilitate transcription in response to heat stress, making them valuable tools for functional studies through controlled gene expression and the precise regulation of gene-editing tools or morphogenic regulators. To evaluate their utility, GUS reporter gene expression driven by four plant-sourced HSP promoters (p GmHSP17.5 , p HvHSP17 , p ZmHSP17.7 , and p ZmHSP26 ) was compared across various tissues of stably transformed sugarcane before and after heat treatment. At 22°C, all promoters showed minimal activity in leaves and roots, although p ZmHSP17.7 and p HvHSP17 displayed moderate expression in stems. Following heat treatment, all promoters exhibited their highest activity in stems, followed by leaves and roots. In stem tissues, p GmHSP17.5 displayed heat-induced uidA expression comparable to the constitutive p ZmUbi promoter. Notably, heat-induced reporter gene activity in stem middle sections of single-copy transgenic lines containing p ZmHSP17.7 , p HvHSP17 , or p ZmHSP26 exceeded p ZmUbi -derived uidA activity by 9.7-fold, 3.8-fold, and 3.0-fold, respectively, with 346- to 3,672-fold induction compared to control conditions. Most promoters showed peak expression in the middle sections of the stem, while p HvHSP17 was the most active in the stem apices. Histochemical analysis revealed that p ZmHSP17.7 and p HvHSP17 were active in both parenchyma cells and vascular bundles within sugarcane stems. Among leaf tissues, mature leaves exhibited greater expression than senescing or immature leaves, while root activity remained consistently minimal across all promoters. Temperature-course experiments identified distinct activation thresholds: 34°C–36°C for p ZmHSP17.7 , 36°C for p ZmHSP26 , 36°C–38°C for p HvHSP17 , and 40°C–42°C for p GmHSP17.5 . Drought stress also induced reporter gene transcription in stems under HSP promoters, although with lower fold induction than heat treatment. These findings provide valuable tools for gene function studies and biotechnology applications, including heat stress tolerance research, controlled transgene expression in metabolic engineering, precision gene editing, and developmental biology studies.

60 APPLIED LIFE SCIENCES↗

DOE OSTI2020

Root Microbiome Modulates Plant Growth Promotion Induced by Low Doses of Glyphosate

Since the introduction of glyphosate-resistant crops, glyphosate has become the most common and widely used herbicide around the world. Due to its intensive use and ability to bind to soil particles, it can be found at low concentrations in the environment. The effect of these remnants of glyphosate in plants has not been broadly studied; however, glyphosate 1,000 to 100,000 times less concentrated than the recommended field dose promoted growth in several species in laboratory and greenhouse experiments. However, this effect is rarely observed in agricultural fields, where complex communities of microbes have a central role in the way plants respond to external cues. Our study reveals how root-associated bacteria modulate the responses of Arabidopsis to low doses of glyphosate, shifting between growth promotion and growth inhibition.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2026

MassIVE MSV000100641 - Multilayered regulation by RNA thermometers enables precise control of Cas9 expression in E. coli: Cas9-based genome editing technologies can rapidly generate mutations to probe a diverse array of mutant genotypes. However, aberrant Cas9 nuclease translation and activity can occur despite the use of inducible promoters to control expression, leading to extensive cell death. This background killing caused by promoter leakiness severely limits the application of Cas9 for generating mutant libraries because of the potential for population skew. We demonstrate the utility of temperature sensitive RNA elements as a layer of post-transcriptional regulation to reduce the impact of promoter leak. We observe significant temperature-dependent increases in cell survival when certain RNA thermometers (RNATs) are placed upstream of the cas9 coding sequence. We also show that the most highly repressing RNAT, hsp17rep, significantly reduces population skew with a library of characterized guide RNAs in Escherichia coli. This strategy should be applicable to all bacterial Cas9-based methods and technologies.

Explore the source record for details and available documents.

Alexander, William G. [Oak Ridge National Laborato↗

DOE OSTI2021

Multiplexed characterization of rationally designed promoter architectures deconstructs combinatorial logic for IPTG-inducible systems

Abstract A crucial step towards engineering biological systems is the ability to precisely tune the genetic response to environmental stimuli. In the case of Escherichia coli inducible promoters, our incomplete understanding of the relationship between sequence composition and gene expression hinders our ability to predictably control transcriptional responses. Here, we profile the expression dynamics of 8269 rationally designed, IPTG-inducible promoters that collectively explore the individual and combinatorial effects of RNA polymerase and LacI repressor binding site strengths. We then fit a statistical mechanics model to measured expression that accurately models gene expression and reveals properties of theoretically optimal inducible promoters. Furthermore, we characterize three alternative promoter architectures and show that repositioning binding sites within promoters influences the types of combinatorial effects observed between promoter elements. In total, this approach enables us to deconstruct relationships between inducible promoter elements and discover practical insights for engineering inducible promoters with desirable characteristics.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2021

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

09 BIOMASS FUELS↗

DOE OSTI2022

Performance of abiotic stress-inducible synthetic promoters in genetically engineered hybrid poplar (Populus tremula × Populus alba)

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six s ynthetic d rought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis -regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2025

Elucidating Electric Field-Induced Rate Promotion of Brønsted Acid-Catalyzed Alcohol Dehydration

Applied potentials have been demonstrated as a powerful tool to promote heterogeneous Brønsted acid catalysis by orders of magnitude, leveraging interfacial electric fields to stabilize protonated intermediates. However, the use of flat two-dimensional electrodes with inherently low active site densities limits the application of conventional thermochemical characterization techniques that can probe the nature of catalytic active sites. Here, we use kinetic analyses with an electrostatics-based model to elucidate the intricacies of potential-induced rate promotion, employing liquid-phase dehydration of 1-methylcyclopentanol catalyzed by carboxylic acid groups on carbon nanotubes as a probe system. By using a basket electrode to directly polarize catalyst powder, we demonstrate that thermocatalytic reaction rates can be promoted by 100,000-fold, exhibiting a log–linear dependence on applied potential with rate-potential scalings as high as 125 ± 4 mV per 10-fold rate increase. In agreement with model predictions, we show that lower ionic strengths attenuate potential sensitivity, resulting from a weakening of the interfacial electric field that interacts with the acidic proton. Furthermore, we experimentally confirm the model-predicted “isokinetic potential” (at ∼0.6 V vs Ag/AgCl)─the potential at which all rate scaling lines at various ionic strengths intersect, making the rate independent of ionic strength. Base titrations reveal that only ∼8% of the carboxylic acid sites are catalytically active, yet these same active sites are operational at the highest and lowest potentials. Collectively, our results provide a key methodology for modeling catalytic effects of electric fields, quantifying active sites under applied potential, and demonstrating fundamental principles of electric field-induced rate promotion.

Catalysts↗

DOE OSTI2022

Examination of Genetic Control Elements in the Phototrophic Firmicute Heliomicrobium modesticaldum

Heliomicrobium modesticaldum has been used as a model organism for the Heliobacteria, the only phototrophic family in the Firmicutes. It is a moderately thermophilic anoxygenic phototrophic bacterium that is capable of fermentative growth in the dark. The genetic manipulation of H. modesticaldum is still in its infancy. Methods to introduce genes through the use of exogenous plasmids and to delete genes from the chromosome through the use of the native CRISPR/Cas system have been developed in the last several years. To expand our genetic toolkit, it was necessary to control gene expression. In this study, we analyzed constitutive and inducible promoters developed for clostridia for their use in H. modesticaldum and further tested two reporters, adhB and lacZ, as indicators of promoter strength. Alcohol dehydrogenase (AdhB) was unsuitable as a reporter in this species due to high endogenous activity and/or low activity of the reporter, but a thermostable LacZ worked well as a reporter. A set of constitutive promoters previously reported to work in Clostridium thermocellum was found to be reliable for controlling the expression of the lacZ reporter gene in H. modesticaldum at a range of activities spanning an order of magnitude. An anhydrotetracycline-inducible promoter was created by inserting tetO operators into a strong constitutive promoter, but it was not fully repressible. The implementation of a xylose-inducible promoter resulted in complete repression of β-gal in the absence of xylose, and reliable expression tunable through the concentration of xylose added to the culture.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2022

Dynamic and single cell characterization of a CRISPR-interference toolset in Pseudomonas putida KT2440 for β-ketoadipate production from p -coumarate

We report Pseudomonas putida KT2440 is a well-studied bacterium for the conversion of lignin-derived aromatic compounds to bioproducts. The development of advanced genetic tools in P. putida has reduced the turnaround time for hypothesis testing and enabled the construction of strains capable of producing various products of interest. Here, we evaluate an inducible CRISPR-interference (CRISPRi) toolset on fluorescent, essential, and metabolic targets. Nuclease-deficient Cas9 (dCas9) expressed with the arabinose (8K)-inducible promoter was shown to be tightly regulated across various media conditions and when targeting essential genes. In addition to bulk growth data, single cell time lapse microscopy was conducted, which revealed intrinsic heterogeneity in knockdown rate within an isoclonal population. The dynamics of knockdown were studied across genomic targets in exponentially-growing cells, revealing a universal 1.75 ± 0.38 hour quiescent phase after induction where 1.5 ± 0.35 doublings occur before a phenotypic response is observed. To demonstrate application of this CRISPRi toolset, β-ketoadipate, a monomer for performance-advantaged nylon, was produced at a 4.39 ± 0.5 g/L and yield of 0.76 ± 0.10 mol/mol from p-coumarate, a hydroxycinnamic acid that can be derived from grasses. These cultivation metrics were achieved by using the higher strength IPTG (1K)-inducible promoter to knockdown the pcaIJ operon in the βKA pathway during early exponential phase. This allowed the majority of the carbon to be shunted into the desired product while eliminating the need for a supplemental carbon and energy source to support growth and maintenance.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2025

The Pseudoenzyme β‐Amylase9 From Arabidopsis Activates α‐Amylase3: A Possible Mechanism to Promote Stress‐Induced Starch Degradation

ABSTRACT Starch accumulation in plants provides carbon for nighttime use, for regrowth after periods of dormancy, and for times of stress. Both ɑ‐ and β‐amylases (AMYs and BAMs, respectively) catalyze starch hydrolysis, but their functional roles are unclear. Moreover, the presence of catalytically inactive amylases that show starch excess phenotypes when deleted presents questions on how starch degradation is regulated. Plants lacking one of these catalytically inactive β‐amylases, BAM9, have enhanced starch accumulation when combined with mutations in BAM1 and BAM3, the primary starch degrading BAMs in response to stress and at night, respectively. BAM9 has been reported to be transcriptionally induced by stress although the mechanism for BAM9 function is unclear. From yeast two‐hybrid experiments, we identified the plastid‐localized AMY3 as a potential interaction partner for BAM9. We found that BAM9 interacted with AMY3 in vitro and that BAM9 enhances AMY3 activity about three‐fold. Modeling of the AMY3‐BAM9 complex predicted a previously undescribed alpha–alpha hairpin in AMY3 that could serve as a potential interaction site. Additionally, AMY3 lacking the alpha–alpha hairpin is unaffected by BAM9. Structural analysis of AMY3 showed that it can form a homodimer in solution and that BAM9 appears to replace one of the AMY3 monomers to form a heterodimer. The presence of both BAM9 and AMY3 in many vascular plant lineages, along with model‐based evidence that they heterodimerize, suggests that the interaction is conserved. Collectively these data suggest that BAM9 is a pseudoamylase that activates AMY3 in response to cellular stress, possibly facilitating stress recovery.

Biochemistry & Molecular Biology↗

DOE OSTI2025

Thermophilic site-specific recombination system for rapid insertion of heterologous DNA into the Clostridium thermocellum chromosome

Clostridium thermocellum is an anaerobic thermophile capable of producing ethanol and other commodity chemicals from lignocellulosic biomass. The insertion of heterologous DNA into the C. thermocellum chromosome is currently achieved via a time-consuming homologous recombination process, where a single stable insertion can take 2–4 weeks or more to construct. In this work, we developed a thermostable version of the Serine recombinase Assisted Genome Engineering (tSAGE) approach for gene insertion in C. thermocellum utilizing a site-specific recombinase from Geobacillus sp. Y412MC61, enabling quick and easy insertion of DNA into the chromosome for accelerated genetic tool screening and heterologous gene expression. Using tSAGE, chromosomal insertion of plasmid DNA occurred at a maximum transformation efficiency of 5 × 10 3 CFU/µg, which is comparable to the transformation efficiency of a replicating control plasmid in C. thermocellum. Using tSAGE, we chromosomally integrated and characterized 17 reporter genes, 15 homologous and 31 heterologous constitutive promoters of varying strengths, 4 inducible promoters, and 5 riboswitches in C. thermocellum. We also determined that a 6–7 nucleotide gap between the ribosome binding site (RBS) and the start codon is optimal for high expression by employing a library of superfolder green fluorescent protein expression constructs driven by our strongest tested promoter (P clo1313_1194 ) with different distances between the RBS and start codon. The tools developed here will aid in accelerating C. thermocellum strain engineering for producing sustainable fuels and chemicals directly from plant biomass.

Biofuels↗

NASA NTRS2003

Transcriptional regulation of IGF-I expression in skeletal muscle

The present study investigated the role of transcription in the regulation of insulin-like growth factor (IGF)-I expression in skeletal muscle. RT-PCR was used to determine endogenous expression of IGF-I pre-mRNA and mRNA in control (Con) and functionally overloaded (FO) rat plantaris. The transcriptional activities of five different-length IGF-I promoter fragments controlling transcription of a firefly luciferase (FLuc) reporter gene were tested in vitro by transfection of myoblasts or in vivo during FO by direct gene transfer into the plantaris. Increased endogenous IGF-I gene transcription during 7 days of plantaris FO was evidenced by an approximately 140-160% increase (P < 0.0001) in IGF-I pre-mRNA (a transcriptional marker). IGF-I mRNA expression also increased by approximately 90% (P < 0.0001), and it was correlated (R = 0.93; P < 0.0001) with the pre-mRNA increases. The three longest IGF-I exon 1 promoters induced reporter gene expression in proliferating C2C12 and L6E9 myoblasts. In differentiated L6E9 myotubes, promoter activity increased approximately two- to threefold over myoblasts. Overexpression of calcineurin and MyoD increased the activity of the -852/+192 promoter in C2C12 myotubes by approximately 5- and approximately 18-fold, respectively. However, FO did not induce these exogenous promoter fragments. Nevertheless, the present findings are consistent with the hypothesis that the IGF-I gene is transcriptionally regulated during muscle hypertrophy in vivo as evidenced by the induction of the endogenous IGF-I pre-mRNA during plantaris FO. The exon 1 promoter region of the IGF-I gene is sufficient to direct inducible expression in vitro; however, an in vivo response to FO may require elements outside the -852/+346 region of the exon 1 IGF-I promoter or features inherent to the endogenous IGF-I gene.

Non-NASA Center↗