Search NASA⌕ Search

SEARCH · Search NASA

Results for “laser capture microdissection”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 records
All sourcesNASA NTRSDOE OSTI
DOE OSTI2021

Cell-Type-Specific Proteomics Analysis of a Small Number of Plant Cells by Integrating Laser Capture Microdissection with a Nanodroplet Sample Processing Platform

Plant organs and tissues contain multiple cell types, which are well organized in 3-dimensional structure to efficiently perform physiological functions such as homeostasis, response to environmental perturbation, pathogen infection. It is critically important to perform molecular measurements at the cell-type-specific level to discover mechanisms and unique features of cell populations that govern differentiation and respond to external perturbations. Although mass spectrometry-based proteomics has been demonstrated as an enabling discovery tool to study plant physiology, conventional approaches require millions of cells to generate robust biological conclusions. Such requirements mask the cell-to-cell heterogeneities and limit the comprehensive profiling of plant proteins at spatially resolved and cell-type-specific resolutions. This protocol describes a recently-developed proteomics workflow for studying a small number of plant cells by integrating laser capture microdissection, microfluidic nanodroplet-based sample preparation, with ultrasensitive liquid chromatography-mass spectrometry. Using poplar as a model tree species, we provide detailed protocols, including plant tissue harvest, tissue preparation, cryosectioning, laser microdissection, protein digestion, mass spectrometry measurement, and data analysis. We show the workflow enables the precise identification and quantification of thousands of proteins from hundreds of isolated plant root and leaf cells.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Regulators of early maize leaf development inferred from transcriptomes of laser capture microdissection (LCM)-isolated embryonic leaf cells

The superior photosynthetic efficiency of C 4 leaves over C 3 leaves is owing to their unique Kranz anatomy, in which the vein is surrounded by one layer of bundle sheath (BS) cells and one layer of mesophyll (M) cells. Kranz anatomy development starts from three contiguous ground meristem (GM) cells, but its regulators and underlying molecular mechanism are largely unknown. To identify the regulators, we obtained the transcriptomes of 11 maize embryonic leaf cell types from five stages of pre-Kranz cells starting from median GM cells and six stages of pre-M cells starting from undifferentiated cells. Principal component and clustering analyses of transcriptomic data revealed rapid pre-Kranz cell differentiation in the first two stages but slow differentiation in the last three stages, suggesting early Kranz cell fate determination. In contrast, pre-M cells exhibit a more prolonged transcriptional differentiation process. Differential gene expression and coexpression analyses identified gene coexpression modules, one of which included 3 auxin transporter and 18 transcription factor (TF) genes, including known regulators of Kranz anatomy and/or vascular development. In situ hybridization of 11 TF genes validated their expression in early Kranz development. We determined the binding motifs of 15 TFs, predicted TF target gene relationships among the 18 TF and 3 auxin transporter genes, and validated 67 predictions by electrophoresis mobility shift assay. From these data, we constructed a gene regulatory network for Kranz development. Our study sheds light on the regulation of early maize leaf development and provides candidate leaf development regulators for future study.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2025

Spatial top-down proteomics for the functional characterization of human kidney

Background: The Human Proteome Project has credibly detected nearly 93% of the roughly 20,000 proteins which are predicted by the human genome. However, the proteome is enigmatic, where alterations in amino acid sequences from polymorphisms and alternative splicing, errors in translation, and post-translational modifications result in a proteome depth estimated at several million unique proteoforms. Recently mass spectrometry has been demonstrated in several landmark efforts mapping the human proteoform landscape in bulk analyses. Herein, we developed an integrated workflow for characterizing proteoforms from human tissue in a spatially resolved manner by coupling laser capture microdissection, nanoliter-scale sample preparation, and mass spectrometry imaging. Results: Using healthy human kidney sections as the case study, we focused our analyses on the major functional tissue units including glomeruli, tubules, and medullary rays. After laser capture microdissection, these isolated functional tissue units were processed with microPOTS (microdroplet processing in one-pot for trace samples) for sensitive top-down proteomics measurement. This provided a quantitative database of 616 proteoforms that was further leveraged as a library for mass spectrometry imaging with near-cellular spatial resolution over the entire section. Notably, several mitochondrial proteoforms were found to be differentially abundant between glomeruli and convoluted tubules, and further spatial contextualization was provided by mass spectrometry imaging confirming unique differences identified by microPOTS, and further expanding the field-of-view for unique distributions such as enhanced abundance of a truncated form (1-74) of ubiquitin within cortical regions. Conclusions: We developed an integrated workflow to directly identify proteoforms and reveal their spatial distributions. Where of the 20 differentially abundant proteoforms identified as discriminate between tubules and glomeruli by microPOTS, the vast majority of tubular proteoforms were of mitochondrial origin (8 of 10) where discriminate proteoforms in glomeruli were primarily hemoglobin subunits (9 of 10). These trends were also identified within ion images demonstrating spatially resolved characterization of proteoforms that has the potential to reshape discovery-based proteomics because the proteoforms are the ultimate effector of cellular functions. Applications of this technology have the potential to unravel etiology and pathophysiology of disease states, informing on biologically active proteoforms, which remodel the proteomic landscape in chronic and acute disorders.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

Data for The Stem Cell-Type Transcriptome of Bioenergy Sorghum Reveals the Spatial Regulation of Secondary Cell Wall Networks

Bioenergy sorghum is a low-input, drought-resilient, deep-rooting annual crop that has high biomass yield potential enabling the sustainable production of biofuels, biopower, and bioproducts. Bioenergy sorghum’s 4-5 m stems account for ~80% of the harvested biomass. Stems accumulate high levels of sucrose that could be used to synthesize bioethanol and useful biopolymers if information about stem cell-type gene expression and regulation was available to enable engineering. To obtain this information, Laser Capture Microdissection (LCM) was used to isolate and collect transcriptome profiles from five major cell types that are present in stems of the sweet sorghum Wray. Transcriptome analysis identified genes with cell-type specific and cell-preferred expression patterns that reflect the distinct metabolic, transport, and regulatory functions of each cell type. Analysis of cell-type specific gene regulatory networks (GRNs) revealed that unique TF families contribute to distinct regulatory landscapes, where regulation is organized through various modes and identifiable network motifs. Cell-specific transcriptome data was combined with a stem developmental transcriptome dataset to identify the GRN that differentially activates the secondary cell wall (SCW) formation in stem xylem sclerenchyma and epidermal cells. The cell-type transcriptomic dataset provides a valuable source of information about the function of sorghum stem cell types and GRNs that will enable the engineering of bioenergy sorghum stems.

Software↗
DOE OSTI2024

The stem cell-type transcriptome of bioenergy sorghum reveals the spatial regulation of secondary cell wall networks

Stems accumulate high levels of sucrose that could be used to synthesize bioethanol and useful biopolymers if information about stem cell-type gene expression and regulation was available to enable engineering. To obtain this information, Laser Capture Microdissection (LCM) was used to isolate and collect transcriptome profiles from five major cell types that are present in stems of the sweet sorghum Wray. Transcriptome analysis identified genes with cell-type specific and cell-preferred expression patterns that reflect the distinct metabolic, transport, and regulatory functions of each cell type.

cell specificity↗
DOE OSTI2022

Proteomic Profiling of Intra-Islet Features Reveals Substructure-Specific Protein Signatures

Despite their diminutive size, islets of Langerhans play a large role in maintaining systemic energy balance in the body. New technologies have enabled us to go from studying the whole pancreas, to isolated whole islets, to partial islet sections, and now to islet substructures isolated from within the islet. Using a microfluidic nanodroplet-based proteomics platform coupled with laser capture microdissection (LCM), we present an in-depth investigation of protein profiles specific to regions within the islet. These regions studied include the vascular tissue containing interface boundary, micro-vascular tissue internal to the islet, isolated endocrine cells, islet sections with vasculature intact, and finally acinar tissue from around the islet. Unique protein signatures observed in the inner vasculature potentially indicate increased innervation and intra-islet neuron-like crosstalk compared to external vasculature. We also demonstrate the utility of these data for isolating localized structure-specific drug-target interactions using existing protein/drug binding databases.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

An optimized approach and inflation media for obtaining complimentary mass spectrometry-based omics data from human lung tissue

Human disease states are biomolecularly multifaceted and can span across phenotypic states, therefore it is important to understand diseases on all levels, across cell types, and within and across microanatomical tissue compartments. To obtain an accurate and representative view of the molecular landscape within human lungs, this fragile tissue must be inflated and embedded to maintain spatial fidelity of the location of molecules and minimize molecular degradation for molecular imaging experiments. Here, we evaluated agarose inflation and carboxymethyl cellulose embedding media and determined effective tissue preparation protocols for performing bulk and spatial mass spectrometry-based omics measurements. Mass spectrometry imaging methods were optimized to boost the number of annotatable molecules in agarose inflated lung samples. This optimized protocol permitted the observation of unique lipid distributions within several airway regions in the lung tissue block. Laser capture microdissection of these airway regions followed by high-resolution proteomic analysis allowed us to begin linking the lipidome with the proteome in a spatially resolved manner, where we observed proteins with high abundance specifically localized to the airway regions. We also compared our mass spectrometry results to lung tissue samples preserved using two other inflation/embedding media, but we identified several pitfalls with the sample preparation steps using this preservation method. Overall, we demonstrated the versatility of the inflation method, and we can start to reveal how the metabolome, lipidome, and proteome are connected spatially in human lungs and across disease states through a variety of different experiments.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Spatially Resolved Top-Down Proteomics of Tissue Sections Based on a Microfluidic Nanodroplet Sample Preparation Platform

Conventional proteomics measures the averaged signal from mixed cell populations or bulk tissues, leading to the dilution of significant changes in subpopulations of cells that might serve as important biomarkers. Recent developments in bottom-up proteomics have enabled spatial mapping of cellular heterogeneity in tissue microenvironments. However, bottom-up proteomics cannot precisely infer the abundance changes of intact proteins, which are presented as proteoforms. Herein, we described a spatially resolved top-down proteomics (TDP) platform for proteoform identification and quantification directly on thin tissue sections. The spatial TDP platform consisted of a nanoPOTS (nanodroplet Processing in One pot for Trace Samples)-based sample preparation system and an LCM (laser capture microdissection)-based cell isolation system. We improved the nanoPOTS sample preparation by adding benzonase in the extraction buffer to enhance the coverage of nucleus proteins. Using ~200 cultured cells as model samples, the improved approach increased proteoform identifications from 493 to 700; newly identified proteoforms primarily corresponded to nuclear proteins. To demonstrate the spatial TDP platform in tissue samples, we analyzed LCM-isolated tissue voxels from rat brain cortex and hypothalamus regions. We quantified 426 proteoforms by combining identifications from TopPIC and TDPortal with the quantitation from ProMex. Several proteoforms corresponding to the same gene exhibited mixed abundance profiles between two tissue regions, suggesting potential PTM-specific spatial distributions. The spatial TDP workflow has prospects for biomarker discovery at proteoform level from small tissue sections.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Cell‐type‐specific transcriptomics uncovers spatial regulatory networks in bioenergy sorghum stems

SUMMARY Bioenergy sorghum is a low‐input, drought‐resilient, deep‐rooting annual crop that has high biomass yield potential enabling the sustainable production of biofuels, biopower, and bioproducts. Bioenergy sorghum's 4–5 m stems account for ~80% of the harvested biomass. Stems accumulate high levels of sucrose that could be used to synthesize bioethanol and useful biopolymers if information about cell‐type gene expression and regulation in stems was available to enable engineering. To obtain this information, laser capture microdissection was used to isolate and collect transcriptome profiles from five major cell types that are present in stems of the sweet sorghum Wray. Transcriptome analysis identified genes with cell‐type‐specific and cell‐preferred expression patterns that reflect the distinct metabolic, transport, and regulatory functions of each cell type. Analysis of cell‐type‐specific gene regulatory networks (GRNs) revealed that unique transcription factor families contribute to distinct regulatory landscapes, where regulation is organized through various modes and identifiable network motifs. Cell‐specific transcriptome data was combined with known secondary cell wall (SCW) networks to identify the GRNs that differentially activate SCW formation in vascular sclerenchyma and epidermal cells. The spatial transcriptomic dataset provides a valuable source of information about the function of different sorghum cell types and GRNs that will enable the engineering of bioenergy sorghum stems, and an interactive web application developed during this project will allow easy access and exploration of the data ( https://mc‐lab.shinyapps.io/lcm‐dataset/ ).

09 BIOMASS FUELS↗
DOE OSTI2020

HIV influences clustering and intracellular replication of hepatitis C virus

We report HCV and HIV coinfection is common and HIV leads to increased HCV viraemia and accelerated disease progression. However, the biological basis of this interaction remains poorly understood and little is known about the impact of HIV on HCV replication at the cellular level. We analysed HCV RNA, based on single-cell laser-capture microdissection, in liver biopsies from monoinfected (n = 4) and HCV/HIV-coinfected (n = 5) participants. HCV RNA was assayed in 3200 hepatocytes with information of spatial position. We compared HCV RNA levels and clustering properties of infection between mono- and coinfected participants, and developed a mathematical model of infection. Although the median plasma HCV RNA level and the fraction of infected cells were comparable in monoinfected (7.0 log 10 IU/mL and ~ 30%) and coinfected (7.3 log 10 IU/mL and ~ 40%) participants, the median HCV RNA per infected hepatocyte in monoinfected (2.8IU) was significantly lower than in coinfected (8.2IU) participants (p = .03). Clustering of infected cells was more prominent in monoinfected participants (91% of samples) than in coinfected participants (~48%), p = .0045, suggesting that spatial spread may be influenced by HIV coinfection. Interestingly, when clustering does occur, the size of clusters is similar in both types of infection. A mathematical model of infection suggested that HIV allows higher intracellular accumulation of HCV RNA by impeding the export of HCV RNA. Our observations show that HIV coinfection impacts intracellular accumulation of HCV RNA and the clustering of HCV-infected cells, but to a less extent the fraction of HCV-infected cells.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Enhanced Spatial Mapping of Histone Proteoforms in Human Kidney Through MALDI-MSI by High-Field UHMR-Orbitrap Detection

Core histones including H2A, H2B, H3, and H4 are key modulators of cellular repair, transcription, and replication within eukaryotic cells, playing vital roles within the pathogenesis of disease and cellular responses to environmental stimuli. Traditional mass spectrometry (MS) based bottom-up and top-down proteomics allows for the comprehensive identification of proteins and of post-translational modification (PTM) harboring proteoforms. However, these methodologies have difficulties preserving near cellular spatial distributions because they typically require laser capture microdissection (LCM) and advanced sample preparation techniques. Herein, we coupled matrix-assisted laser desorption/ionization (MALDI) source with a Thermo Scientific Q-Exactive HF Orbitrap MS upgraded with ultra-high mass range (UHMR) boards for the first demonstration of complementary high-resolution accurate mass measurements of proteoforms directly from tissue using this benchtop mass spectrometer. The platform achieved isotopic resolution throughout the detected mass range, providing confident assignments of proteoforms with low ppm mass error and a vastly improved duty cycle over other Fourier transform mass analyzers. Proteoform mapping of core histones was demonstrated on sections of human kidney at near-cellular spatial resolution, with several key distributions of histone and other proteoforms noted within both healthy biopsy and a section from a renal cell carcinoma (RCC) containing nephrectomy. Further, the use of MALDI-MS imaging (MSI) for proteoform mapping demonstrates several steps towards high-throughput accurate identification of proteoforms and provides a new tool for mapping biomolecule distributions throughout tissue sections in extended mass ranges.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2024

Coupling Microdroplet-Based Sample Preparation, Multiplexed Isobaric Labeling, and Nanoflow Peptide Fractionation for Deep Proteome Profiling of the Tissue Microenvironment

There is increasing interest in developing in-depth proteomic approaches for mapping tissue heterogeneity in a cell-type-specific manner to better understand and predict the function of complex biological systems such as human organs. Existing spatially resolved proteomics technologies cannot provide deep proteome coverage due to limited sensitivity and poor sample recovery. Herein, we seamlessly combined laser capture microdissection with a low-volume sample processing technology that includes a microfluidic device named microPOTS (microdroplet processing in one pot for trace samples), multiplexed isobaric labeling, and a nanoflow peptide fractionation approach. The integrated workflow allowed us to maximize proteome coverage of laser-isolated tissue samples containing nanogram levels of proteins. We demonstrated that the deep spatial proteomics platform can quantify more than 5000 unique proteins from a small-sized human pancreatic tissue pixel (∼60,000 μm2) and differentiate unique protein abundance patterns in pancreas. Furthermore, the use of the microPOTS chip eliminated the requirement for advanced microfabrication capabilities and specialized nanoliter liquid handling equipment, making it more accessible to proteomic laboratories.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2022

Hanging drop sample preparation improves sensitivity of spatial proteomics

Spatial proteomics holds great promise for revealing tissue heterogeneity in both physiological and pathological conditions. However, one significant limitation of most spatial proteomics workflows is the requirement of large sample amounts that blurs cell-type-specific or microstructure-specific information. In this study, we developed an improved sample preparation approach for spatial proteomics and integrated it with our previously-established laser capture microdissection (LCM) and microfluidics sample processing platform. Specifically, we developed a hanging drop (HD) method to improve the sample recovery by positioning a nanowell chip upside-down during protein extraction and tryptic digestion steps. Compared with the commonly-used sitting-drop method, the HD method keeps the tissue pixel away from the container surface, and thus improves the accessibility of the extraction/digestion buffer to the tissue sample. The HD method can increase the MS signal by 7 fold, leading to a 66% increase in the number of identified proteins. An average of 721, 1489, and 2521 proteins can be quantitatively profiled from laser-dissected 10 μm-thick mouse liver tissue pixels with areas of 0.0025, 0.01, and 0.04 mm 2 , respectively. The improved system was further validated in the study of cell-type-specific proteomes of mouse uterine tissues.

47 OTHER INSTRUMENTATION↗
DOE OSTI2025

Enhanced Spatial Proteomics and Metabolomics from a Single Tissue Section Using MALDI-MSI and LCM-microPOTS Platforms

Spatially resolved mass spectrometry (MS)-based multi-omics workflows are becoming more utilized for revealing the complex biology that occurs within tissues. However, these approaches commonly require multiple independent tissue sections to analyze the metabolite and protein compositions of these samples. This poses a significant challenge in preserving cell- or region-specific molecular fidelity, as variations between tissue sections can compromise the accurate correlation of molecular data. Here, in this study, we developed workflows for comprehensive multi-omics profiling from a single tissue section (STS) using different MS modalities. We enhanced the functionality of an electrically insulated substrate by employing metal-assisted approaches that enabled both MS-based untargeted spatial metabolomics and proteomics from STS. This allowed metabolite imaging using matrix-assisted laser desorption/ionization-MS imaging (MALDI-MSI), without compromising it for subsequent proteome profiling with laser capture microdissection (LCM)-based technology. Specifically, implementing copper tape as a backing for polyethylene naphthalate (PEN) slides enabled the detection of >140 metabolites across a poplar root tissue section using MALDI-trapped ion mobility spectrometry time of flight (timsTOF)-MS. Afterwards, we detected 6,571 unique proteins from two distinct root regions by leveraging LCM technology coupled to our microdroplet based sample preparation approach. We also developed an alternative workflow utilizing gold-coated PEN substrates for imaging with MALDI-Fourier-transform ion cyclotron resonance (FTICR)-MS, which permitted the profiling of >170 metabolites and the identification of 6,542 unique proteins across a single poplar root tissue section. These results were comparable to using each assay independently without modifications. These approaches offer new opportunities for high-resolution molecular profiling of multiple omics-levels across biological tissues.

Veličković, Marija [Pacific Northwest National Lab↗
DOE OSTI2020

Accurate Identification of Deamidation and Citrullination from Global Shotgun Proteomics Data Using a Dual-Search Delta Score Strategy

While proteins with deamidated/citrullinated amino acids play critical roles in the pathogenesis of many human diseases, identifying these modifications in complex biological samples has been an ongoing challenge. Herein we present a method to accurately identify these modifications from shotgun proteomics data from a deep proteome profiling study of human pancreatic islets obtained by laser capture microdissection. All MS/MS spectra were searched against database by MSGF+ twice with or without a +0.9840 Da mass shift on amino acids asparagine, glutamine, and arginine (NQR) as a dynamic modification. Consequently, for each spectrum the resulting two peptide-to-spectrum matches (PSM) with their respective MSGF+ scores were used for Delta Score calculation. It was observed that all PSMs with positive Delta Score values were clustered with mass errors around 0 ppm, while PSMs with negative Delta Score values were distributed nearly equally within the defined mass error range (20 ppm) for database searching. To estimate false discovery rate (FDR), a “pseudo-decoy” approach was applied whether datasets were searched against a database with a “real modification” mass shift (+0.9840 Da) and a “mock modification” mass shift (+1.0227 Da). FDR was controlled to ~2% with a Delta Score filter greater than zero. Manual inspection of spectra showed that PSMs with positive Delta Score value contained deamidated/citrullinated fragments in their MS/MS spectra. Finally, the results demonstrated that in-situ deamidated/citrullinated peptides can be accurately identified from shotgun tissue proteomics data by the Dual-search Delta Score Strategy.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

Novel Cell-Type-Specific Drought-Responsive Proteins in Root Tips of Field-Grown Perennial Switchgrass

The root-tip region of plants, including the root cap, forms the most basal terminal of the root and exhibits a high degree of cellular complexity in terms of morphology, cytological function, and interaction with environmental cues in the soil. Cells in this region follow a developmental trajectory, transitioning from stem cells to meristematic cells, and ultimately to fully differentiated cell types. However, our understanding of root-tip cell-type specific proteomic responses to abiotic stresses, such as drought, particularly under field conditions, remains limited. This study aimed to identify spatially resolved, cell type-specific proteomes in switchgrass (Panicum virgatum) root tips under drought stress. Root tips were collected from seven-year-old, field-grown switchgrass ‘Alamo’ plants excavated under both well-watered and long-term drought conditions. Cell type-specific proteins were identified using laser capture microdissection (LCM) coupled with nanoPOTS (Nanodroplet Processing in One Pot for Trace Samples) and nano-LC-MS proteomics analysis. Five distinct cell types were targeted: (1) cells in the quiescent center and stem cell niche (QuC), (2) protodermal epidermal cells (PEC) in the meristematic zone, (3) epidermal cells in the transition and elongation zones above the root cap (Epi), (4) peripheral root cap cells (PRC), forming 2–3 layers below the PEC and 1–2 layers above the root border cells, and (5) columella root cap cells (Col) comprising of the columella initials and a single underlying layer of cells undergoing active growth. Principal component analysis (PCA) revealed clear separation among the five targeted cell types, confirming distinct proteomic profiles. Proteins predominantly enriched in each cell type were linked to distinct cellular functions, with QuC cells showing involvement in chromosomal behavior, DNA replication, and mitosis—key processes for stem cell niche regulation. Drought stress resulted in alterations of proteostasis, as evidenced by significant decreases in ribosomal proteins and increases in protein synthesis inhibitors. Moreover, drought stress induced unique cell-type–specific proteins involved in phytohormone biosynthesis and signaling pathways, including auxin, cytokinin, and jasmonic acid. In particular, QuC cells were more highly enriched in proteins associated with DNA repair and mitotic processes. Metabolic pathways related to amino acids, carbohydrates, and lipids were differentially affected in a cell-type–dependent manner, whereas general stress-responsive proteins exhibited consistent changes across all five cell types. Overall, this study provides unique spatially resolved, cell-type-specific proteomic profiles in root tips, representing a significant advancement in our understanding of the cellular mechanisms underlying plant responses to drought stress in natural field conditions.

perennial grass↗
DOE OSTI2022

Antiretroviral therapy for HIV and intrahepatic hepatitis C virus replication

HIV alters host responses to hepatitis C virus (HCV). However, the impact of antiretroviral therapy (ART) on HCV is rarely understood in relevant tissues and never before within individual hepatocytes. HIV and HCV kinetics were studied before and after ART initiation among 19 HIV/HCV co-infected persons. From five persons with the largest decline in plasma HCV RNA, liver tissues collected before and during ART, when plasma HIV RNA was undetectable, were studied. Here we used single-cell laser capture microdissection and quantitative PCR to assess intrahepatic HCV. Immunohistochemistry was performed to characterize intrahepatic immune cell populations. Plasma HCV RNA declined by 0.81 (0.52–1.60) log 10 IU/ml from a median (range) 7.26 (6.05–7.29) log 10 IU/ml and correlated with proportions of HCV-infected hepatocytes (r = 0.89, P = 2 × 10 -5 ), which declined from median (range) of 37% (6–49%) to 23% (0.5–52%) after plasma HIV clearance. Median (range) HCV RNA abundance within cells was unchanged in four of five participants. Liver T-cell abundance unexpectedly decreased, whereas natural killer (NK) and NK T-cell infiltration increased, correlating with changes in proportions of HCV-infected hepatocytes (r = -0.82 and r = -0.73, respectively). Hepatocyte expression of HLA-E, an NK cell restriction marker, correlated with proportions of HCV-infected hepatocytes (r = 0.79). These are the first data to show that ART control of HIV reduces the intrahepatic burden of HCV. Furthermore, our data suggest that HIV affects the pathogenesis of HCV infection by an NK/NK T-cell-mediated mechanism that may involve HLA-E and can be rescued, at least in part, by ART.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗