Search NASA⌕ Search

SEARCH · Search NASA

Results for “water deficit stress”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 records
All sourcesNASA NTRSDOE OSTI
DOE OSTI2021

Metabolic profiling of epidermal and mesophyll tissues under water-deficit stress in Opuntia ficus-indica reveals stress-adaptive metabolic responses

Cactus pear (Opuntia ficus-indica) is a high productivity species within the Cactaceae grown in many semiarid parts of the world for food, fodder, forage, and biofuels. O. ficus-indica utilises obligate crassulacean acid metabolism (CAM), an adaptation that greatly improves water-use efficiency (WUE) and reduces crop water usage. To better understand CAM-related metabolites and water-deficit stress responses of O. ficus-indica, comparative metabolic profiling was performed on mesophyll and epidermal tissues collected from well-watered and water-deficit stressed cladodes at 50% relative water content (RWC). Tissues were collected over a 24-h period to identify metabolite levels throughout the diel cycle and analysed using a combination of acidic/basic ultra-high-performance liquid chromatography/tandem mass spectrometry (UHPLC/MS/MS) and gas chromatography/mass spectrometry (GC/MS) platforms. A total of 382 metabolites, including 210 (55%) named and 172 (45%) unnamed compounds, were characterised across both tissues. Most tricarboxylic acid (TCA) cycle and glycolysis intermediates were depleted in plants undergoing water-deficit stress indicative of CAM idling or post-idling, while the raffinose family oligosaccharides (RFO) accumulated in both mesophyll and epidermal tissues as osmoprotectants. Levels of reduced glutathione and other metabolites of the ascorbate cycle as well as oxylipins, stress hormones such as traumatic acid, and nucleotide degradation products were increased under water-deficit stress conditions. Notably, tryptophan accumulation, an atypical response, was significantly (24-fold) higher during all time points in water-deficit stressed mesophyll tissue compared with well-watered controls. Many of the metabolite increases were indicative of a highly oxidising environment under water-deficit stress. A total of 34 unnamed metabolites also accumulated in response to water-deficit stress indicating that such compounds might play important roles in water-deficit stress tolerance.

Plant Sciences↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Spatiotemporal metabolic responses to water deficit stress in distinct leaf cell-types of poplar

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue ‘omics’-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar ( Populus tremula× P. alba ) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

Single-cell proteomics of Arabidopsis leaf mesophyll reveals dynamic protein responses to water-deficit stress

Background The application of single-cell omics tools to biological systems can provide unique insights into diverse cellular populations and their heterogeneous responses to internal and external perturbations. Thus far, most single-cell studies in plant systems have been limited to RNA-sequencing approaches, which only provide indirect readouts of cellular functions. Results Here, we present a single-cell proteomics workflow for plant cells that integrates tape-sandwich protoplasting, piezoelectric cell sorting, nanoPOTS sample preparation, and ion mobility-based MS data acquisition method for label-free single-cell proteomics analysis of Arabidopsis leaf mesophyll cells. From a single leaf protoplast, over 3,000 proteins were quantified with high precision. The workflow is demonstrated to identify stress associated changes in protein abundance by analyzing 117 protoplasts from well-watered and water-deficit stressed plants. Additionally, we describe a new approach for constructing covarying protein networks at the single-cell level and demonstrate how single-cell protein covariation analysis can reveal previously unrecognized protein functions while also capturing stress-induced changes in protein–protein dynamics. Conclusions The label-free scProteomic approach presented here represents a significant advance through the demonstration of a facile protoplast isolation method combined with deep and precise proteomic coverage of Arabidopsis leaf mesophyll cell types. We believe this study will serve as an informative reference to future plant scProteomic investigations.

Arabidopsis↗
DOE OSTI2020

Genetic control of root anatomical plasticity in maize

Root anatomical phenes have important roles in soil resource capture and plant performance; however, their phenotypic plasticity and genetic architecture is poorly understood. We hypothesized that (a) the responses of root anatomical phenes to water deficit (stress plasticity) and different environmental conditions (environmental plasticity) are genetically controlled and (b) stress and environmental plasticity are associated with different genetic loci than those controlling the expression of phenes under water-stress and well-watered conditions. Root anatomy was phenotyped in a large maize (Zea mays L.) association panel in the field with and without water deficit stress in Arizona and without water deficit stress in South Africa. Anatomical phenes displayed stress and environmental plasticity; many phenotypic responses to water deficit were adaptive, and the magnitude of response varied by genotype. We identified 57 candidate genes associated with stress and environmental plasticity and 64 candidate genes associated with phenes under well-watered and water-stress conditions in Arizona and under well-watered conditions in South Africa. Four candidate genes co-localized between plasticity groups or for phenes expressed under each condition. The genetic architecture of phenotypic plasticity is highly quantitative, and many distinct genes control plasticity in response to water deficit and different environments, which poses a challenge for breeding programs.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Genetic control of root architectural plasticity in maize

Root phenotypes regulate soil resource acquisition; however, their genetic control and phenotypic plasticity are poorly understood. We hypothesized that the responses of root architectural phenes to water deficit (stress plasticity) and different environments (environmental plasticity) are under genetic control and that these loci are distinct. Root architectural phenes were phenotyped in the field using a large maize association panel with and without water deficit stress for three seasons in Arizona and without water deficit stress for four seasons in South Africa. All root phenes were plastic and varied in their plastic response. We identified candidate genes associated with stress and environmental plasticity and candidate genes associated with phenes in well-watered conditions in South Africa and in well-watered and water-stress conditions in Arizona. Few candidate genes for plasticity overlapped with those for phenes expressed under each condition. Our results suggest that phenotypic plasticity is highly quantitative, and plasticity loci are distinct from loci that control phene expression in stress and non-stress, which poses a challenge for breeding programs. To make these loci more accessible to the wider research community, we developed a public online resource that will allow for further experimental validation towards understanding the genetic control underlying phenotypic plasticity.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2024

Endophyte mediated Populus trichocarpa water use efficiency is dependent on time of day and plant water status

Endophytes are potential partners for improving the resource use efficiency of bioenergy feedstock systems such as short rotation coppiced Populus. Endophytes isolated from members of the Salicaceae family have broad host compatibility and can improve water use efficiency (WUE) through decreases in stomatal conductance. However, the literature is inconsistent with regards to the environmental conditions and temporal patterns of these benefits. This study investigates how endophyte mediated changes in Populus trichocarpa (Torr. and Gray) ‘Nisqually-1’ stomatal conductance and WUE shift with time and scale in response to water-deficit stress. Leaf gas exchange and above-ground productivity were used to evaluate the carbon and water balances of glasshouse grown plants in response to endophyte inoculation and water-deficit. Differences in stomatal conductance between control and inoculated plants were more pronounced (39.7 % decrease, Welch’s two-sample t(14.34 dfadj) = -2.358, p-value = 0.033) under water-deficit conditions in the late morning during a period of higher light intensity. The decrease in stomatal conductance accompanied a substantial increase in intrinsic WUE (iWUE) for water-deficit inoculated plants. However, increases in iWUE did not result in improvements in aboveground productivity or shoot biomass WUE (WUEsb) for water-deficit inoculated plants. This decoupling between iWUE and aboveground productivity may be an indicator of assimilate allocation to microbial metabolism as an additional carbon sink or a shift in carbon allocation towards belowground biomass. Future work should take a whole-plant approach that accounts for diurnal patterns in incident irradiance to evaluate the impact of endophyte inoculation on host WUE and stress tolerance.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2021

A physiological signal derived from sun-induced chlorophyll fluorescence quantifies crop physiological response to environmental stresses in the U.S. Corn Belt

Sun-induced chlorophyll fluorescence (SIF) measurements have shown unique potential for quantifying plant physiological stress. However, recent investigations found canopy structure and radiation largely control SIF, and physiological relevance of SIF remains yet to be fully understood. This study aims to evaluate whether the SIF-derived physiological signal improves quantification of crop responses to environmental stresses, by analyzing data at three different spatial scales within the U.S. Corn Belt, i.e. experiment plot, field, and regional scales, where ground-based portable, stationary and space-borne hyperspectral sensing systems are used, respectively. We found that, when controlling for variations in incoming radiation and canopy structure, crop SIF signals can be decomposed into non-physiological (i.e. canopy structure and radiation, 60% ~ 82%) and physiological information (i.e. physiological SIF yield, Φ F , 17% ~ 31%), which confirms the contribution of physiological variation to SIF. We further evaluated whether Φ F indicated plant responses under high-temperature and high vapor pressure deficit (VPD) stresses. The plot-scale data showed that Φ F responded to the proxy for physiological stress (partial correlation coefficient, r p = 0.40, p < 0.001) while non-physiological signals of SIF did not respond ( p > 0.1). The field-scale Φ F data showed water deficit stress from the comparison between irrigated and rainfed fields, and Φ F was positively correlated with canopy-scale stomatal conductance, a reliable indicator of plant physiological condition (correlation coefficient r = 0.60 and 0.56 for an irrigated and rainfed sites, respectively). The regional-scale data showed Φ F was more strongly correlated spatially with air temperature and VPD ( r = 0.23 and 0.39) than SIF ( r = 0.11 and 0.34) for the U.S. Corn Belt. The lines of evidence suggested that Φ F reflects crop physiological responses to environmental stresses with greater sensitivity to stress factors than SIF, and the stress quantification capability of Φ F is spatially scalable. Utilizing Φ F for physiological investigations will contribute to improve our understanding of vegetation responses to high-temperature and high-VPD stresses.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2023

Global variations in critical drought thresholds that impact vegetation

ABSTRACT Identifying the thresholds of drought that, if crossed, suppress vegetation functioning is vital for accurate quantification of how land ecosystems respond to climate variability and change. We present a globally applicable framework to identify drought thresholds for vegetation responses to different levels of known soil-moisture deficits using four remotely sensed vegetation proxies spanning 2001–2018. The thresholds identified represent critical inflection points for changing vegetation responses from highly resistant to highly vulnerable in response to drought stress, and as a warning signal for substantial vegetation impacts. Drought thresholds varied geographically, with much lower percentiles of soil-moisture anomalies in vegetated areas covered by more forests, corresponding to a comparably stronger capacity to mitigate soil water deficit stress in forested ecosystems. Generally, those lower thresholds are detected in more humid climates. State-of-the-art land models, however, overestimated thresholds of soil moisture (i.e. overestimating drought impacts), especially in more humid areas with higher forest covers and arid areas with few forest covers. Based on climate model projections, we predict that the risk of vegetation damage will increase by the end of the twenty-first century in some hotspots like East Asia, Europe, Amazon, southern Australia and eastern and southern Africa. Our data-based results will inform projections on future drought impacts on terrestrial ecosystems and provide an effective tool for drought management.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2022

Relative Controls of Vapor Pressure Deficit and Soil Water Stress on Canopy Conductance in Global Simulations by an Earth System Model

Climate change impacts drought and vapor pressure deficit (VPD) that critically influence land-atmosphere water vapor and CO 2 exchange. There is a lack of model-based global evaluation of the relative roles of the two types of water stresses in limiting canopy conductance (G c ). Using the Energy Exascale Earth System Model (E3SM), we conducted four land-atmosphere coupled simulations for the historical period with and without a plant hydraulics scheme (PHS) and under present-day and quadrupling of CO 2 concentrations. By fitting an empirical model of G c to the E3SM simulations, we evaluated the sensitivity of G c to water stresses caused by VPD and soil water (SW) in the growing season. The empirical model is based on a multiplicative algorithm that adjusts G c according to VPD, soil water saturation, and their interaction. Our results show positive trends of VPD over land during the historical period, with large differences between simulations with and without PHS. Despite the differences, a majority of land pixels that experience both SW and VPD stresses are in semi-arid and tropical savanna ecosystems. G c is more sensitive to VPD than SW in less than 20% of land pixels where the empirical model provides a good fit for the simulated G c . Ignoring SW and VPD interaction may underestimate the relative role of VPD on G c by as much as 28%. Including PHS accentuates SW stress limitation on G c by simulating wetter soil and higher ET that lower VPD. Elevated CO 2 reduces G c by increasing water use efficiency and ameliorates SW stress on G c .

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2021

Detection of the Metabolic Response to Drought Stress Using Hyperspectral Reflectance

Drought is the most important limitation on crop yield. Understanding and detecting drought stress in crops is vital for improving water use efficiency through effective breeding and management. Leaf reflectance spectroscopy offers a rapid, non-destructive alternative to traditional techniques for measuring plant traits involved in a drought response. We measured drought stress in six glasshouse-grown agronomic species using physiological, biochemical and spectral data. In contrast to physiological traits, leaf metabolite concentrations revealed drought stress before it was visible to the naked eye. We used full-spectrum leaf reflectance data to predict metabolite concentrations using partial least-squares regression, with validation R2 values of 0.49 to 0.87. We show for the first time that spectroscopy may be used for the quantitative estimation of proline and abscisic acid, demonstrating the first use of hyperspectral data to detect a phytohormone. We used linear discriminant analysis and partial least squares discriminant analysis to differentiate between droughted and watered plants based on measured traits (accuracy: 71%) and raw spectral data (66%). Finally, we validated our glasshouse-developed models in an independent field trial. We demonstrate that spectroscopy can detect drought stress via underlying biochemical changes, before visual differences occur, representing a powerful advance for measuring limitations on yield.

54 ENVIRONMENTAL SCIENCES↗
NASA NTRS2018

Larch (Larix dahurica Turcz) growth response to climate change in the Siberian permafrost zone

Larch-dominant communities are the most extensive high-latitude forests in Eurasia and are experiencing the strongest impacts from warming temperatures. We analyzed larch (Larix dahurica Turcz) growth index (GI) response to climate change. The studied larch-dominant communities are located within the permafrost zone of Northern Siberia at the northern tree limit (ca. N 67° 38′, E 99° 07′). Methods included dendrochronology, analysis of climate variables, root zone moisture content, and satellitederived gross (GPP) and net (NPP) primary productivity. It was found that larch response to warming included a period of increased annual growth increment (GI) (from the 1970s to ca. 1995) with a follow on GI decline. Increase in GI correlated with summer air temperature, whereas an observed decrease in GI was caused by water stress (vapor pressure deficit and drought increase). Water stress impact on larch growth in permafrost was not observed before the onset of warming (ca. 1970). Water limitation was also indicated by GI dependence on soil moisture stored during the previous year. Water stress was especially pronounced for stands growing on rocky soils with low water-holding capacity. GPP of larch communities showed an increasing trend, whereas NPP stagnated. A similar pattern of GI response to climate warming has also been observed for Larix sibirica Ledeb, Pinus sibirica Du Tour, and Abies sibirica Ledeb in the forests of southern Siberia. Thus, warming in northern Siberia permafrost zone resulted in an initial increase in larch growth from the 1970s to the mid-1990s. After that time, larch growth increment has decreased. Since ca. 1990, water stress at the beginning of the vegetative period became, along with air temperature, a main factor affecting larch growth within the permafrost zone.

Larix dahurica↗
DOE OSTI2021

Rational design and testing of abiotic stress‐inducible synthetic promoters from poplar cis ‐regulatory elements

Summary Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

09 BIOMASS FUELS↗
DOE OSTI2025

Can Large‐Scale Satellite Products Track the Effects of Atmospheric Dryness and Soil Water Deficit on Ecosystem Productivity Under Droughts?

Drought stress, characterized by increased vapor pressure deficit (VPD) and soil water content (SWC) deficit, significantly impacts ecosystem productivity (GPP). Accurately assessing these factors in satellite remote sensing (RS) GPP products is crucial for understanding the large-scale ecological consequences of drought. However, the accuracy of RS GPP in capturing the effects of VPD and SWC deficit, compared to EC flux data, remains under-investigated. Here we evaluated 10 RS GPP products and their mean (RSmean) concerning VPD and SWC deficit across diverse ecosystems along a dryness gradient. Our results revealed that RSmean and individual products generally capture the GPP response direction (VPD: mainly negative, SWC deficit: mixed positive/negative) but consistently misestimate the absolute GPP changes. This discrepancy is ecosystem-specific and consistent across all RS products, underscoring the need to enhance RS products to better account for ecosystem-specific VPD effects and non-linear SWC deficit responses, thereby improving RS GPP accuracy under drought.

Wang, Xiaorong [Univ. of Hong Kong, Pokfulam (Hong↗
NASA NTRS2017

Estimating the Relative Water Content of Leaves in a Cotton Canopy

Remotely sensing plant canopy water status remains a long-term goal of remote sensing research. Established approaches to estimating canopy water status the Crop Water Stress Index, the Water Deficit Index and the Equivalent Water Thickness involve measurements in the thermal or reflective infrared. Here we report plant water status estimates based upon analysis of polarized visible imagery of a cotton canopy measured by ground Multi-Spectral Polarization Imager (MSPI). Such estimators potentially provide access to the plant hydrological photochemistry that manifests scattering and absorption effects in the visible spectral region.Twice during one day, +- 3 hours from solar noon, we collected polarized imagery and relative water content data on a cotton test plot located at the Arid Land Agricultural Research Center, United States Department of Agriculture, Maricopa, AZ. The test plot, a small portion of a large cotton field, contained stressed plants ready for irrigation. The evening prior to data collection we irrigated several rows of plants within the test plot. Thus, ground MSPI imagery from both morning and afternoon included cotton plants with a range of water statuses. Data analysis includes classifying the polarized imagery into sunlit reflecting, sunlit transmitting, shaded foliage and bare soil. We estimate the leaf surface reflection and interior reflection based upon the per pixel polarization and sunview directions. We compare our cotton results with our prior polarization results for corn and soybean leaves measured in the lab and corn leaves measured in the field.

Cotton Canopy↗
DOE OSTI2022

The Role of Groundwater Withdrawals on River Regulation: Example From the Columbia River Basin

The Columbia River Basin (CRB) is heavily regulated by more than 250 dams on its river system while depending significantly on groundwater withdrawals in certain sub-basins. Neglecting groundwater withdrawals in hydrologic models of the basin could result in inaccurate predictions of its water budget and thus mislead water management decisions in the basin. This work aims to understand the impacts of groundwater pumping on the spatiotemporal patterns of modeling regulated streamflow in the CRB using a modified version of the Variable Infiltration Capacity (VIC) model integrated with a water management component that accounts for groundwater withdrawals, irrigation demands, and reservoir operation (VIC-GIRR). The VIC-GIRR simulations showed that considering additional groundwater withdrawals would alleviate the stress of irrigation water deficit in the Snake River Basin with an average reduction of 10 km 3 /year. Such a reduction in water deficit resulted in slight streamflow increase over the CRB with maximum increase up to 40% during dry period in certain locations. We also note that the implementation of groundwater withdrawal does not, however, improve the overall model performance in long-term averaged streamflow and storage predictions. Our results highlight the efforts needed to examine additional important processes in representing the interactions between water withdrawals and reservoir operations. Such efforts will aid in better simulation of multi-reservoir system and improve effectiveness for agricultural productivity, power generation, flood control, and navigation purposes.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2021

Scaling plant responses to high temperature from cell to ecosystem

Plant survival and productivity decrease with exposure to less favourable environments. The negative effects of environmental factors such as water-deficit and salinity stress on vegetation are relatively well studied, primarily due to the large losses in crop yield and forest biomass caused by these stresses. Although the impact of combined heat and drought on plants has received considerable interest in recent years due to climate change, there has been less focus on ascertaining the impact of heat stress alone at a range of temporal and spatial scales. The steady increase in global mean temperatures and (more importantly) variability in extreme temperatures is translating into more frequent and extreme heat stress episodes, which in turn reduce plant productivity. Further, projected increases in both day and night temperatures and the predicted impact of these changes on agricultural and forest productivity have drawn attention to the need to better address the direct effects of heat on plants. In particular, there has been tremendous interest in understanding the short- and long-term effects of heat at the cellular and whole-plant levels, including work on crops of agricultural importance and species from less managed ecosystems. Hence, we made a concerted effort in this Special Issue to capture recent progress in our ability to quantify the impact of heat stress, and identify new tools and approaches that have been developed and implemented to capture a wide range of responses in plants. The series of reviews and research articles presented here captures our current understanding of plant physiological and molecular responses to heat stress, as well as covering phenotyping methods, genetic diversity and potential routes through which plants can acclimate and adapt to warming climates.

54 ENVIRONMENTAL SCIENCES↗