Search NASA⌕ Search

SEARCH · Search NASA

Results for “RIBOSIDES”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

31 records · Page 2
All sourcesNASA NTRSDOE OSTI
DOE OSTI2011

Preoperative Chemoradiation for Rectal Cancer Using Capecitabine and Celecoxib Correlated With Posttreatment Assessment of Thymidylate Synthase and Thymidine Phosphorylase Expression

Purpose: Thymidylate synthase (TS) and thymidine phosphorylase (TP) expression have been shown to be predictors of response to therapy. The toxicity, efficacy, surgical morbidity, and immunohistochemical TS and TP expression were assessed in surgical resection specimens after preoperative chemoradiation. Methods and Materials: Twenty patients with clinical stage I to III rectal adenocarcinoma received preoperative chemoradiation and underwent surgical resection 6 weeks later. Results: Posttreatment tumor stages were T1 to T2 and N0 in 30% of patients; T3 to T4 and N0 in 30% of patients; and T1 to T3 and N1 to N2 in 15% of patients. Pathologic complete response (pCR) was evident in 25% and tumor regression occurred in a total of 80% of patients. Anal sphincter-sparing surgery was performed in 80% of cases. Acute and perioperative complications were minimal, with no grade 3/4 toxicity or treatment breaks. Pelvic control was obtained in 90% of patients. With a median follow-up of 65.5 months (range, 8-80 months), the 6-year actuarial survival rate was 75%. Local failure was significantly associated with nonresponse to therapy and with high TS and low TP expression (p = 0.008 and p = 0.04, respectively). Conclusions: The combination of capecitabine, celecoxib, and x-radiation therapy yields excellent response: a 25% pathologic pCR, no acute grade 3/4 toxicity, and minimal surgical morbidity. Nonresponders expressed significantly increased TS levels and decreased TP levels in posttreatment resection specimens compared to responders.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2010

Post Treatment With an FGF Chimeric Growth Factor Enhances Epithelial Cell Proliferation to Improve Recovery From Radiation-Induced Intestinal Damage

Purpose: A fibroblast growth factor (FGF) 1-FGF2 chimera (FGFC) was created previously and showed greater structural stability than FGF1. This chimera was capable of stimulating epithelial cell proliferation much more strongly than FGF1 or FGF2 even without heparin. Therefore FGFC was expected to have greater biologic activity in vivo. This study evaluated and compared the protective activity of FGFC and FGF1 against radiation-induced intestinal injuries. Methods and Materials: We administered FGFC and FGF1 intraperitoneally to BALB/c mice 24 h before or after total-body irradiation (TBI). The numbers of surviving crypts were determined 3.5 days after TBI with gamma rays at doses ranging from 8 to 12 Gy. Results: The effect of FGFC was equal to or slightly superior to FGF1 with heparin. However, FGFC was significantly more effective in promoting crypt survival than FGF1 (p < 0.01) when 10 {mu}g of each FGF was administered without heparin before irradiation. In addition, FGFC was significantly more effective at promoting crypt survival (p < 0.05) than FGF1 even when administered without heparin at 24 h after TBI at 10, 11, or 12 Gy. We found that FGFC post treatment significantly promoted 5-bromo-2'-deoxyuridine incorporation into crypts and increased crypt depth, resulting in more epithelial differentiation. However, the number of apoptotic cells in FGFC-treated mice decreased to almost the same level as that in FGF1-treated mice. Conclusions: These findings suggest that FGFC strongly enhanced radioprotection with the induction of epithelial proliferation without exogenous heparin after irradiation and is useful in clinical applications for both the prevention and post treatment of radiation injuries.

63 RADIATION, THERMAL, AND OTHER ENVIRON. POLLUTAN↗
DOE OSTI2011

Dependence of Cell Survival on Iododeoxyuridine Concentration in 35-keV Photon-Activated Auger Electron Radiotherapy

Purpose: To measure and compare Chinese hamster ovary cell survival curves using monochromatic 35-keV photons and 4-MV x-rays as a function of concentration of the radiosensitizer iododeoxyuridine (IUdR). Methods and Materials: IUdR was incorporated into Chinese hamster ovary cell DNA at 16.6 {+-} 1.9%, 12.0 {+-} 1.4%, and 9.2 {+-} 1.3% thymidine replacement. Cells were irradiated from 1 to 8 Gy with 35-keV synchrotron-generated photons and conventional radiotherapy 4-MV x-rays. The effects of the radiation were measured via clonogenic survival assays. Surviving fraction was plotted vs. dose and fit to a linear quadratic model. Sensitization enhancement ratios (SER{sub 10}) were calculated as the ratio of doses required to achieve 10% surviving fraction for cells without and with DNA-incorporated IUdR. Results: At 4 MV, SER{sub 10} values were 2.6 {+-} 0.1, 2.2 {+-} 0.1, and 1.5 {+-} 0.1 for 16.6%, 12.0%, and 9.2% thymidine replacement, respectively. At 35 keV, SER{sub 10} values were 4.1 {+-} 0.2, 3.0 {+-} 0.1, and 2.0 {+-} 0.1, respectively, which yielded SER{sub 10} ratios (35 keV:4 MV) of 1.6 {+-} 0.1, 1.4 {+-} 0.1, and 1.3 {+-} 0.1, respectively. Conclusions: SER{sub 10} increases monotonically with percent thymidine replacement by IUdR for both modalities. As compared to 4-MV x-rays, 35-keV photons produce enhanced SER{sub 10} values whose ratios are linear with percent thymidine replacement and assumed to be due to Auger electrons contributing to enhanced dose to DNA. Although this Auger effectiveness factor is less than the radiosensitization factor of IUdR, both could be important for the clinical efficacy of IUdR radiotherapy.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2011

Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2011

Characterization of protoberberine analogs employed as novel human P2X{sub 7} receptor antagonists

The P2X{sub 7} receptor (P2X{sub 7}R), a member of the ATP-gated ion channel family, is regarded as a promising target for therapy of immune-related diseases including rheumatoid arthritis and chronic pain. A group of novel protoberberine analogs (compounds 3-5), discovered by screening of chemical libraries, was here investigated with respect to their function as P2X{sub 7}R antagonists. Compounds 3-5 non-competitively inhibited BzATP-induced ethidium ion influx into hP2X{sub 7}-expressing HEK293 cells, with IC{sub 50} values of 100-300 nM. This antagonistic action on the channel further confirmed that both BzATP-induced inward currents and Ca{sup 2+} influx were strongly inhibited by compounds 3-5 in patch-clamp and Ca{sup 2+} influx assays. The antagonists also effectively suppressed downstream signaling of P2X{sub 7} receptors including IL-1{beta} release and phosphorylation of ERK1/2 and p38 proteins in hP2X{sub 7}-expressing HEK293 cells or in differentiated human monocytes (THP-1 cells). Moreover, IL-2 secretion from CD3/CD28-stimulated Jurkat T cell was also dramatically inhibited by the antagonist. These results imply that novel protoberberine analogs may modulate P2X{sub 7} receptor-mediated immune responses by allosteric inhibition of the receptor. - Graphical abstract: Display Omitted

60 APPLIED LIFE SCIENCES↗
DOE OSTI2011

Intracellular GTP level determines cell's fate toward differentiation and apoptosis

Since the adequate supply of guanine nucleotides is vital for cellular activities, limitation of their syntheses would certainly result in modulation of cellular fate toward differentiation and apoptosis. The aim of this study was to set a correlation between the intracellular level of GTP and the induction of relevant signaling pathways involved in the cell's fate toward life or death. In that regard, we measured the GTP level among human leukemia K562 cells exposed to mycophenolic acid (MPA) or 3-hydrogenkwadaphnin (3-HK) as two potent inosine monophosphate dehydrogenase inhibitors. Our results supported the maturation of the cells when the intracellular GTP level was reduced by almost 30-40%. Under these conditions, 3-HK and/or MPA caused up-regulation of PKC{alpha} and PI3K/AKT pathways. Furthermore, co-treatment of cells with hypoxanthine plus 3-HK or MPA, which caused a reduction of about 60% in the intracellular GTP levels, led to apoptosis and activation of mitochondrial pathways through inverse regulation of Bcl-2/Bax expression and activation of caspase-3. Moreover, our results demonstrated that attenuation of GTP by almost 60% augmented the intracellular ROS and nuclear localization of p21 and subsequently led to cell death. These results suggest that two different threshold levels of GTP are needed for induction of differentiation and/or ROS-associated apoptosis. - Graphical abstract: Display Omitted

60 APPLIED LIFE SCIENCES↗
DOE OSTI2011

Role of adenosine A{sub 2A} receptor signaling in the nicotine-evoked attenuation of reflex cardiac sympathetic control

Baroreflex dysfunction contributes to increased cardiovascular risk in cigarette smokers. Given the importance of adenosinergic pathways in baroreflex control, the hypothesis was tested that defective central adenosinergic modulation of cardiac autonomic activity mediates the nicotine-baroreflex interaction. Baroreflex curves relating changes in heart rate (HR) to increases or decreases in blood pressure (BP) evoked by i.v. doses (1-16 {mu}g/kg) of phenylephrine (PE) and sodium nitroprusside (SNP), respectively, were constructed in conscious rats; slopes of the curves were taken as measures of baroreflex sensitivity (BRS). Nicotine (25 and 100 {mu}g/kg i.v.) dose-dependently reduced BRS{sub SNP} in contrast to no effect on BRS{sub PE}. BRS{sub SNP} was also attenuated after intracisternal (i.c.) administration of nicotine. Similar reductions in BRS{sub SNP} were observed in rats pretreated with atropine or propranolol. The combined treatment with nicotine and atropine produced additive inhibitory effects on BRS, an effect that was not demonstrated upon concurrent exposure to nicotine and propranolol. BRS{sub SNP} was reduced in preparations treated with i.c. 8-phenyltheophylline (8-PT, nonselective adenosine receptor antagonist), 8-(3-Chlorostyryl) caffeine (CSC, A{sub 2A} antagonist), or VUF5574 (A{sub 3} antagonist). In contrast, BRS{sub SNP} was preserved after blockade of A{sub 1} (DPCPX) or A{sub 2B} (alloxazine) receptors or inhibition of adenosine uptake by dipyridamole. CSC or 8-PT abrogated the BRS{sub SNP} depressant effect of nicotine whereas other adenosinergic antagonists were without effect. Together, nicotine preferentially impairs reflex tachycardia via disruption of adenosine A{sub 2A} receptor-mediated facilitation of reflex cardiac sympathoexcitation. Clinically, the attenuation by nicotine of compensatory sympathoexcitation may be detrimental in conditions such as hypothalamic defense response, posture changes, and ventricular rhythms. - Research Highlights: > The role of central adenosinergic sites in the nicotine-baroreflex interaction was investigated. > Inhibition of reflex sympathoinhibition mediates the BRS depressant action of nicotine. > Nicotine preferentially impairs reflex tachycardia via disruption of adenosine A{sub 2A} signaling. > The attenuation by nicotine of reflex sympathetic activity is clinically important.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2011

Ortho-aminoazotoluene activates mouse constitutive androstane receptor (mCAR) and increases expression of mCAR target genes

2'-3-dimethyl-4-aminoazobenzene (ortho-aminoazotoluene, OAT) is an azo dye and a rodent carcinogen that has been evaluated by the International Agency for Research on Cancer (IARC) as a possible (class 2B) human carcinogen. Its mechanism of action remains unclear. We examined the role of the xenobiotic receptor Constitutive Androstane Receptor (CAR, NR1I3) as a mediator of the effects of OAT. We found that OAT increases mouse CAR (mCAR) transactivation in a dose-dependent manner. This effect is specific because another closely related azo dye, 3'-methyl-4-dimethyl-aminoazobenzene (3'MeDAB), did not activate mCAR. Real-time Q-PCR analysis in wild-type C57BL/6 mice revealed that OAT induces the hepatic mRNA expression of the following CAR target genes: Cyp2b10, Cyp2c29, Cyp3a11, Ugt1a1, Mrp4, Mrp2 and c-Myc. CAR-null (Car{sup -/-}) mice showed no increased expression of these genes following OAT treatment, demonstrating that CAR is required for their OAT dependent induction. The OAT-induced CAR-dependent increase of Cyp2b10 and c-Myc expression was confirmed by Western blotting. Immunohistochemistry analysis of wild-type and Car{sup -/-} livers showed that OAT did not acutely induce hepatocyte proliferation, but at much later time points showed an unexpected CAR-dependent proliferative response. These studies demonstrate that mCAR is an OAT xenosensor, and indicate that at least some of the biological effects of this compound are mediated by this nuclear receptor. - Highlights: > The azo dye and mouse carcinogen OAT is a very effective mCAR activator. > OAT increases mCAR transactivation in a dose-dependent manner. > OAT CAR-dependently increases the expression of a specific subset of CAR target genes. > OAT induces an unexpectedly deferred, but CAR-dependent hepatocyte proliferation.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2010

Submicrometer Single Crystal Diffractometry for Highly Accurate Structure Determination

Submicrometer single crystal diffractometry for highly accurate structure determination was developed using the extremely stable and highly brilliant synchrotron radiation from SPring-8. This was achieved using a microbeam focusing system and the submicrometer precision low-eccentric goniometer system. We demonstrated the structure analyses with 2x2x2 {mu}m{sup 3} cytidine, 600x600x300 nm{sup 3} BaTiO{sub 3}, and 1x1x1 {mu}m{sup 3} silicon. The observed structure factors of the silicon crystal were in agreement with the structure factors determined by the Pendelloesung method and do not require absorption and extinction corrections.

46 INSTRUMENTATION RELATED TO NUCLEAR SCIENCE AND ↗
DOE OSTI2011

Photoelectron and computational studies of the copper-nucleoside anionic complexes, Cu{sup -}(cytidine) and Cu{sup -}(uridine)

The copper-nucleoside anions, Cu{sup -}(cytidine) and Cu{sup -}(uridine), have been generated in the gas phase and studied by both experimental (anion photoelectron spectroscopy) and theoretical (density functional calculations) methods. The photoelectron spectra of both systems are dominated by single, intense, and relatively narrow peaks. These peaks are centered at 2.63 and 2.71 eV for Cu{sup -}(cytidine) and Cu{sup -}(uridine), respectively. According to our calculations, Cu{sup -}(cytidine) and Cu{sup -}(uridine) species with these peak center [vertical detachment energy (VDE)] values correspond to structures in which copper atomic anions are bound to the sugar portions of their corresponding nucleosides largely through electrostatic interactions; the observed species are anion-molecule complexes. The combination of experiment and theory also reveal the presence of a slightly higher energy, anion-molecule complex isomer in the case of the Cu{sup -}(cytidine). Furthermore, our calculations found that chemically bond isomers of these species are much more stable than their anion-molecule complex counterparts, but since their calculated VDE values are larger than the photon energy used in these experiments, they were not observed.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2011

XPC is essential for nucleotide excision repair of zidovudine-induced DNA damage in human hepatoma cells

Zidovudine (3'-azido-3'-dexoythymidine, AZT), a nucleoside reverse transcriptase inhibitor, can be incorporated into DNA and cause DNA damage. The mechanisms underlying the repair of AZT-induced DNA damage are unknown. To investigate the pathways involved in the recognition and repair of AZT-induced DNA damage, human hepatoma HepG2 cells were incubated with AZT for 2 weeks and the expression of DNA damage signaling pathways was determined using a pathway-based real-time PCR array. Compared to control cultures, damaged DNA binding and nucleotide excision repair (NER) pathways showed significantly increased gene expression. Further analysis indicated that AZT treatment increased the expression of genes associated with NER, including XPC, XPA, RPA1, GTF2H1, and ERCC1. Western blot analysis demonstrated that the protein levels of XPC and GTF2H1 were also significantly up-regulated. To explore further the function of XPC in the repair of AZT-induced DNA damage, XPC expression was stably knocked down by 71% using short hairpin RNA interference. In the XPC knocked-down cells, 100 {mu}M AZT treatment significantly increased [{sup 3}H]AZT incorporation into DNA, decreased the total number of viable cells, increased the release of lactate dehydrogenase, induced apoptosis, and caused a more extensive G2/M cell cycle arrest when compared to non-transfected HepG2 cells or HepG2 cells transfected with a scrambled short hairpin RNA sequence. Overall, these data indicate that XPC plays an essential role in the NER repair of AZT-induced DNA damage.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2011

L-carnitine protects against nickel-induced neurotoxicity by maintaining mitochondrial function in Neuro-2a cells

Mitochondrial dysfunction is thought to be a part of the mechanism underlying nickel-induced neurotoxicity. L-carnitine (LC), a quaternary ammonium compound biosynthesized from the amino acids lysine and methionine in all mammalian species, manifests its neuroprotective effects by improving mitochondrial energetics and function. The purpose of this study was to investigate whether LC could efficiently protect against nickel-induced neurotoxicity. Here, we exposed a mouse neuroblastoma cell line (Neuro-2a) to different concentrations of nickel chloride (NiCl{sub 2}) (0.25, 0.5, 1, and 2 mM) for 24 h, or to 0.5 mM and 1 mM NiCl{sub 2} for various periods (0, 3, 6, 12, or 24 h). We found that nickel significantly increased the cell viability loss and lactate dehydrogenase (LDH) release in Neuro-2a cells. In addition, nickel exposure significantly elevated reactive oxygen species (ROS) and malondialdehyde (MDA) levels, disrupted the mitochondrial membrane potential ({Delta}{Psi}{sub m}), reduced adenosine-5'-triphosphate (ATP) concentrations and decreased mitochondrial DNA (mtDNA) copy numbers and mtRNA transcript levels. However, all of the cytotoxicities and mitochondrial dysfunctions that were triggered by nickel were efficiently attenuated by pretreatment with LC. These protective effects of LC may be attributable to its role in maintaining mitochondrial function in nickel-treated cells. Our results suggest that LC may have great pharmacological potential in protecting against the adverse effects of nickel in the nervous system.

60 APPLIED LIFE SCIENCES↗